Method for identifying transmission of ACO3 mRNA molecule from apple plant seed to pulp

Abstract

The invention belongs to the technical field of biology, and particularly relates to a method for identifying transmission of ACO3mRNA molecules from apple plant seeds to pulp, and the method provided by the invention can accurately, efficiently, conveniently, economically and practically identify whether the mRNA molecules can be transmitted from the seeds to the pulp in apple fruit bodies. An effective identification means for signal transmission between library organs is disclosed, and a new idea is provided for fruit tree breeding. The method provided by the invention is based on developmental genetics laws, is high in accuracy and convenient, and has great application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an identification method for the transfer of ACO3 mRNA molecules from seeds to pulp of apple plants. Background Art

[0002] Vascular plants respond to various adversities by integrating and transmitting environmental information perceived by plant organs. Long-distance signal transduction plays a vital role in plant adaptation to harsh environmental conditions and survival after adversity. In higher plants, RNA, proteins, small peptides, plant hormones, etc. can be transmitted to target organs through the vascular system, thereby regulating different biological processes. Modern research on RNA information transmission mainly focuses on the post-transcriptional regulation of endogenous non-coding RNA and the long-distance transport of mRNA between source and sink (stock-scion system and leaves to stem tips) through the vascular system. RNA molecules can be transmitted over long distances to distal tissues and cells of plants through the phloem-sieve tubes mediated by plasmodesmata (PD).

[0003] The ripening of fleshy fruits and seeds is a complex and highly coordinated developmental process. The softening of fruit tissues attracts animals to feed and spreads seeds, thus completing the entire life cycle. 1-Aminocyclopropane-1-carboxylic acid oxidase (ACO) is an important rate-limiting enzyme in the process of ethylene synthesis. Three ACO genes have been reported in apples, namely MdACO1, MdACO2, and MdACO3, which play an important role in the ripening of fruits. Apple seeds and pulp have a developed vascular system to promote the transport of water and assimilates. Among them, the main vascular bundle is an important carrier for the transport and unloading of assimilates in the fruit. The genes transmitted from the seeds are "carried" on the assimilates and pumped into the pulp parenchyma through the main vascular bundle. Then, they are transmitted between cells at close range through intercellular filaments, thereby promoting the development and ripening of the fruit. Different from the long-distance source-sink transmission in the rootstock-scion system, the identification method of molecular transmission between sink organs in apple fruit has broadened the research scope of long-distance transmission in perennial woody plants. At the same time, the superposition of multiple transmission systems has also laid the foundation for in-depth research on fruit development.

[0004] Endogenous RNA molecules that can be transmitted over long distances through plant phloem have been identified from many species such as Arabidopsis, pumpkin, cucumber, tomato, potato, pear, and apple. In the studies reported so far, the identification techniques for long-distance transmission signal molecules mainly include the detection of specific label proteins after transgenic grafting, mRNA-labeled specific molecular probes, nested RT-PCR, RT-PCR-CAPS, etc. Although these technologies are relatively accurate in identifying gene transmissibility in grafting complexes, they still have shortcomings such as cumbersome processes, high costs, long cycles, high requirements for gene sequences, and large workloads. More importantly, most of these identification approaches revolve around long-distance transport between sources and sinks in homologous or heterologous grafting systems. For the information transmission between sink organs in plant development, the identification of endogenous mRNA transmissibility should also break through new approaches and simpler and more efficient methods. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a method for identifying the transfer of apple fruit body seeds to pulp using SNP (single nucleotide polymorphism). The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0007] According to the laws of developmental genetics, apple pulp is a fleshy pseudofruit developed from the receptacle. Its genotype is homozygous and the same as that of the mother plant, while the genotype of the seeds comes from that of the parents.

[0008] The present invention provides a method for identifying the transfer of ACO3 mRNA molecules from seeds to flesh of apple plants, comprising the following steps: detecting the type of nucleotide at position 1058 of SEQ ID No.1 of ACO3 mRNA in the flesh of the apple plant to be identified, identifying or assisting in identifying whether the ACO3 mRNA molecule is transferred from seeds to flesh according to the type of the nucleotide, if the flesh of the apple plant to be identified contains ACO3 mRNA whose nucleotide at position 1058 of SEQ ID No.1 is G, the ACO3 mRNA molecule in the apple plant to be identified is transferred from seeds to flesh, the ACO3 mRNA molecule in the apple plant to be identified is transferred from seeds to flesh, if the flesh of the apple plant to be identified contains ACO3 mRNA whose nucleotide at position 1058 of SEQ ID No.1 is A but does not contain ACO3 mRNA whose nucleotide at position 1058 of SEQ ID No.1 is G, the ACO3 mRNA molecule in the apple plant to be identified is not transferred from seeds to flesh or is a candidate for not being transferred from seeds to flesh;

[0009] The Malus plant to be identified is a hybrid fruit of a male parent and a female parent, the male parent anther contains only ACO3 mRNA whose nucleotide at position 1058 is G, the female parent receptacle contains only ACO3 mRNA whose nucleotide at position 1058 is A of SEQ ID No.1, and the seeds contain both ACO3 mRNA whose nucleotide at position 1058 is A of SEQ ID No.1 and ACO3 mRNA whose nucleotide at position 1058 is G of SEQ ID No.1.

[0010] Furthermore, the method for detecting the type of the 1058th nucleotide of SEQ ID No.1 of ACO3 mRNA of the flesh of the apple plant to be identified in the above method comprises using the cDNA obtained by reverse transcription of the total RNA of the flesh of the apple plant to be identified as a template, performing PCR amplification using PCR primers to obtain a PCR product, sequencing the PCR product, and determining the type of the 1058th nucleotide of SEQ ID No.1 of ACO3 mRNA of the flesh of the apple plant to be identified;

[0011] The PCR primers include a forward primer and a reverse primer, the forward primer is a single-stranded DNA with a nucleotide sequence of SEQ ID No. 2, and the specific sequence is: 5`-AACCAAACACTTGTTGAGAGAGAG-3`; the reverse primer is a single-stranded DNA with a nucleotide sequence of SEQ ID No. 3, and the specific sequence is: 5`-GTTACATTCTACAACGATTTCCACA-3`.

[0012] Furthermore, the total RNA of the pulp of the apple plant to be identified in the above method is extracted from the pulp of the apple plant in the S6 period after flowering, and the S6 period after flowering is 130 days after pollination. Specifically, the total RNA can be extracted from the hybrid fruit (130 days after pollination) obtained after artificial pollination with the receptacle of 'Red Star' apple as the female parent and the anther of 'Honey Crisp' apple as the male parent.

[0013] Furthermore, the Malus plant to be identified in the above method may be apple. Specifically, the apple may be a hybrid of 'Red Star' apple and 'Honey Crisp' apple, and the receptacle of the 'Red Star' apple is the female parent, and the anther of the 'Honey Crisp' apple is the male parent.

[0014] The present invention also provides the use of a DNA with a nucleotide sequence of SEQ ID No. 1 or the primer in identifying the transfer of ACO3 mRNA molecules from seeds to flesh of apple plants.

[0015] The present invention obtains the respective ACO3 mRNA sequences by designing specific primers, isolating and cloning, and comparing the SNP sources in the parent and first-generation seed and pulp sequences through first-generation sequencing analysis and comparison, and finally uses SNP (single nucleotide polymorphism) to identify the transfer method from the apple fruit body seed to the pulp. The method has the characteristics of high accuracy, convenience, speed, low cost, etc. It can be used to solve the identification of mRNA molecules transferred over long distances between sink organs during the development of apple fruits, and can also be used for the study of long-distance transfer of perennial woody plants, or can be used as a general tool for accurate molecular design and guiding breeding plans. At the same time, it provides an effective new way for breeders to create new varieties with strong disease resistance, good adaptability, low cost and excellent quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The electrophoresis diagram of MdACO3 full-length amplification of seeds and flesh of the parents and hybrid fruit of 'Red Star' × 'Mi Cui' is shown. In the figure, M: DNA molecular weight standard; A: anther of the male parent 'Mi Cui'; B: receptacle of the female parent 'Red Star'; C: flesh of the hybrid fruit of 'Red Star' × 'Mi Cui'; D: seeds of the hybrid fruit of 'Red Star' × 'Mi Cui'.

[0017] Figure 2 Shown is the alignment of the MdACO3 monoclonal sequencing of the anthers of ‘Red Star’×’Mi Cui’A: male parent ‘Mi Cui’. A-1 in the figure is the first monoclonal, and so on, and MdACO3 is the reference genome sequence.

[0018] Figure 3 Shown is the sequencing sequence alignment of MdACO3 monoclonal in the receptacle of 'Red Star' × 'Mi Cui' B: the mother 'Red Star'. In the figure, B-1 is the first monoclonal, and so on, and MdACO3 is the reference genome sequence.

[0019] Figure 4 Shown is the sequence alignment of MdACO3 monoclonal sequencing of the hybrid fruit seeds of 'Red Star' × 'Mi Cui' C: In the figure, C-1 is the first monoclonal, and so on, and MdACO3 is the reference genome sequence.

[0020] Figure 5 Shown is the alignment of the MdACO3 monoclonal sequencing of the flesh of the hybrid fruit of 'Red Star' × 'Mi Cui' D: In the figure, D-1 is the first monoclonal, and so on, and MdACO3 is the reference genome sequence.

[0021] Figure 6 Shown are the relative expression levels in the fruit of 'Red Star' × 'Mi Cui' at six stages after anthesis, where S1-S6 are six developmental stages after anthesis.

[0022] Figure 7 Shown are the changes in transmission sites in 'Red Star' × 'Mi Cui' during the six periods after anthesis.

[0023] Figure 8 Shown is the fluorescence in situ hybridization of MdACO3 gene in the main vascular bundle of fruit sepals during S6 period. DETAILED DESCRIPTION

[0024] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0025] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0026] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0027] The following examples used GraphPad Prism 8 statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used, and P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) and P < 0.001 (***) indicated extremely significant differences.

[0028] Embodiment 1:

[0029] 1. Discovery of Apple MdACO3

[0030] Obtaining hybrid fruit: In 2019, in the Beijing Nankou Experimental Field (Laohou Picking Garden), with 'Red Star' as the female parent and the pollen of the male parent 'Mi Cui' was obtained to obtain the 'Red Star' × 'Mi Cui' hybrid fruit. Then collect the anthers of the male parent 'Mi Cui', the receptacle of the female parent 'Red Star', the flesh of the 'Red Star' × 'Mi Cui' hybrid fruit, and the seeds of the 'Red Star' × 'Mi Cui' hybrid fruit for later use.

[0031] The anthers of the male parent 'Mi Cui', the receptacle of the female parent 'Hong Xing', the seeds of the hybrid fruit of 'Hong Xing'×'Mi Cui', and the flesh of the hybrid fruit of 'Hong Xing'×'Mi Cui' were resequenced. Through bioinformatics analysis, a type of variation was screened out at the DNA level: the genotypes of the parents are homozygous and different, the genotypes of the flesh are the same and homozygous as the maternal genotype, and the genotypes of the seeds are heterozygous and come from both parents; at the RNA level: the genotype of the flesh is heterozygous and the SNP site comes from the seed. The MdACO3 gene related to fruit ripening was obtained through functional annotation and analysis. The mRNA sequence of MdACO3 is shown in SEQ ID No.1:

[0032]

[0033] In SEQ ID No.1, r is a or g (SEQ ID No.1 is located on Chr17 of the genome of the male parent 'Micui' or the female parent 'Hongxing', r is located at 1058bp of the MdACO3 mRNA shown in SEQ ID No.1 or 980bp downstream of ATG at the 3'UTR, that is, at position 9068201 of genome Chr17).

[0034] The nucleotide sequence of the mRNA molecule of MdACO3 is as follows:

[0035]

[0036] In the sequence of the above mRNA molecule, r is a or g.

[0037] 2. Cloning of a partial fragment of the MdACO3 gene

[0038] 1. The total RNA collected in step 1 was extracted from the anthers of the male parent 'Micui', the receptacle of the female parent 'Hongxing', the seeds of the hybrid fruit of 'Hongxing' × 'Micui', and the pulp of the hybrid fruit of 'Hongxing' × 'Micui', and the first-strand cDNA was obtained by reverse transcription.

[0039] 2. Using the cDNA obtained in step 1 as a template, perform PCR amplification using primers consisting of primers F1 and R1 to obtain a PCR amplification product.

[0040] Primer F1 (SEQ ID No. 2): 5`-AACCAAACACTTGTTGAGAGAGAG-3`

[0041] Primer R1 (SEQ ID No. 3): 5'-GTTACATTCTACAACGATTTCCACA-3'

[0042] The reaction system (50 μL) consisted of 25 μL 2× Phanta Max Buffer, 1 μL dNPT Mix (10 μM), 1 μL Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novozyme Biotechnology P505-d1), 2 μL primer F1 aqueous solution (10 μM), 2 μL primer R1 aqueous solution (10 μM), 2 μL cDNA (containing 10-50 ng cDNA) and 17 μL H 2 O. Reaction procedure: 95℃3min; 95℃15sec, 53℃15sec, 72℃1min, 35 cycles; 72℃5min; 12℃ storage. PCR amplification product was obtained.

[0043] The above PCR amplification products were subjected to gel electrophoresis. Figure 1 shown. Figure 1 The first to fifth lanes in the figure are DNA Marker, anthers of the male parent 'Mi Cui', receptacle of the female parent 'Hong Xing', flesh of the hybrid fruit of 'Hong Xing' × 'Mi Cui', and seeds of the hybrid fruit of 'Hong Xing' × 'Mi Cui'. It can be seen that the MdACO3 gene can be amplified using the cDNA of the male parent 'Mi Cui' anthers, the female parent 'Hong Xing' receptacle, flesh of the hybrid fruit of 'Hong Xing' × 'Mi Cui', and seeds of the hybrid fruit of 'Hong Xing' × 'Mi Cui' as templates.

[0044] 3. Construction of MdACO3 gene cloning vector

[0045] The recombinant vector was constructed as follows: 1 μL pTOPO-TA / Blunt Simple Vector (Beijing Adlai Biotechnology, CV1701), 1 μL 10× Enhancer (Beijing Adlai Biotechnology, CV1701), 0.5-5 μL purified PCR product (provided in step 2), and the volume was filled to 10 μL with sterile water.

[0046] The recombinant plasmids constructed according to the above system were named A, B, C, and D (A, B, C, and D represent the male parent, the female parent, the hybrid fruit seeds, and the hybrid fruit flesh, 8 monoclones in each group). A, B, C, and D were sent to Shenggong Bioengineering Company for sequencing, and 8 monoclones were measured for each recombinant plasmid. The primers F2 and R2 used for sequencing are as follows:

[0047] Primer F2: 5`-TGTAAAACGACGGCCAGT-3`

[0048] Primer R2: 5`-CAGGAAACAGCTATGACC-3`

[0049] The sequencing results were compared and analyzed using DNAMAN. The comparison results are shown in Figure 2-5 The results showed that the recombinant plasmid A had a G / G at 1058 bp of the MdACO3 gene (SEQ ID NO.1), the recombinant plasmid B had an A / A at 1058 bp of the MdACO3 gene (SEQ ID NO.1), and the recombinant plasmids C and D had a G / A at 1058 bp of the MdACO3 gene (SEQ ID NO.1). This showed that the MdACO3 gene was transferred from seeds to flesh.

[0050] IV. Determination of the expression level of MdACO3 gene in six stages after anthesis

[0051] The day of pollination is counted as day 0 after flowering, the day after pollination is counted as day 1 after flowering, and so on. The time of S1 to S6 is as follows:

[0052] S1 period: 30 days after pollination;

[0053] S2 period: 50 days after pollination;

[0054] S3 period: 70 days after pollination;

[0055] S4 period: 90 days after pollination;

[0056] S5 period: 110 days after pollination;

[0057] S6 period: 130 days after pollination.

[0058] The expression level of MdACO3 gene was identified as follows

[0059] 1. The total RNA of the flesh of the hybrid fruit of 'Red Star' × 'Mi Cui' obtained by the method shown in step 1 was extracted at six different developmental stages, namely S1, S2, S3, S4, S5 and S6, and the first-chain cDNA was obtained by reverse transcription.

[0060] 2. Using the cDNA obtained in step 1 as a template, a primer consisting of primers F3 and R3 was used for real-time fluorescence quantitative detection.

[0061] Primer F3 (SEQ ID No. 4): 5'-AGAGGCTGACAAAAGAGCACTAC-3'

[0062] Primer R3 (SEQ ID No. 5): 5'-AGAGATGTTGGATTGAGGAAGAT-3'

[0063] Internal reference MdACTIN primer F: 5'-TGGCCCCAAGCAGCAT-3'

[0064] Internal reference MdACTIN primer R: 5'-CTGGAAGGTACTGAGGGAAGCTAAG-3`

[0065] Reaction system: 2×Taq Universal SYBR qPCR Master Mix 10μL, H 2 O 7μL, upstream primer and downstream primer 1μL each, cDNA template 1μL (template concentration has been diluted to 200ng / μL). A total of 20μL reaction system.

[0066] The reaction procedure was as follows: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 10 s, annealing at 58°C for 20 s, and extension at 72°C for 30 s, for a total of 40 cycles.

[0067] The relative expression levels of MdACO3 gene at different developmental stages are shown in Figure 2 Figure 6 As shown in the figure, the relative expression level in S6 period was the highest, which was significantly higher than that in other periods (P<0.001).

[0068] 5. Genotypic changes of MdACO3 gene in six stages after anthesis

[0069] The total RNA of the hybrid fruit of 'Red Star' × 'Mi Cui' obtained by the method shown in step 1 was extracted from the anthers of the male parent 'Mi Cui', the receptacle of the female parent 'Red Star', the flesh and seeds of the hybrid fruit of 'Red Star' × 'Mi Cui' in S1 period, the flesh and seeds of the hybrid fruit of 'Red Star' × 'Mi Cui' in S2 period, the flesh and seeds of the hybrid fruit of 'Red Star' × 'Mi Cui' in S3 period, the flesh and seeds of the hybrid fruit of 'Red Star' × 'Mi Cui' in S4 period, the flesh and seeds of the hybrid fruit of 'Red Star' × 'Mi Cui' in S5 period, and the flesh and seeds of the hybrid fruit of 'Red Star' × 'Mi Cui' in S6 period, and the first-chain cDNA was obtained by reverse transcription. Using the aforementioned cDNA as a template and F1 and R1 as primers for PCR amplification, the obtained PCR products were used to construct recombinant vectors according to the following system: 1μL pTOPO-TA / Blunt Simple Vector (Beijing Aidelai Biological, CV1701), 1μL 10×Enhancer (Beijing Aidelai Biological, CV1701), 0.5-5μL purified PCR product, and supplemented to 10μL with sterile water. The recombinant plasmids of pulp and seeds at six different developmental stages were constructed and named pulp (including S1, S2, S3, S4, S5 and S6), seeds (including S1, S2, S3, S4, S5 and S6), maternal receptacle, and paternal anther. The aforementioned recombinant plasmids (8 single clones were selected for each recombinant plasmid) were sent to Sangon Biotech Co., Ltd. for sequencing, and the primers used for sequencing were F2 and R2. The sequencing results are as follows Figure 7 As shown:

[0070] The recombinant plasmids S1, S2, S3, S4 and S5 of the fruit pulp only contained one PCR product (DNA molecule corresponding to MdACO3 mRNA), whose nucleotide sequence was SEQ ID No.1, and the 1058th nucleotide of SEQ ID No.1 was A, indicating that the fruit pulp of the 'Red Star' × 'Mi Cui' hybrid fruit of the S1, S2, S3, S4 and S5 periods contained MdACO3 mRNA with A at the 1058th nucleotide of SEQ ID No.1, and did not contain MdACO3 mRNA with G at the 1058th nucleotide of SEQ ID No.1.

[0071] There are two types of recombinant plasmid S6 in the fruit pulp. Among the eight single clones, the recombinant plasmids of four single clones contained only one PCR product (the DNA molecule corresponding to MdACO3 mRNA), whose nucleotide sequence was SEQ ID No.1, and the 1058th position of SEQ ID No.1 was A. The recombinant plasmids of the other four single clones contained only one PCR product (the DNA molecule corresponding to MdACO3 mRNA), whose nucleotide sequence was SEQ ID No.1, and the 1058th position of SEQ ID No.1 was G. This shows that the flesh of the hybrid fruit of 'Red Star' × 'Mi Cui' in the S6 period contains both MdACO3 mRNA with A at the 1058th nucleotide of SEQ ID No.1 and MdACO3 mRNA with G at the 1058th nucleotide of SEQ ID No.1.

[0072] The recombinant plasmids S1, S2, S3, S4, S5 and S6 of the seeds: each had two. Among the 8 single clones, the recombinant plasmids of 4 single clones contained only one PCR product (the DNA molecule corresponding to MdACO3 mRNA), whose nucleotide sequence was SEQ ID No.1, and the 1058th position of SEQ ID No.1 was A. The recombinant plasmids of the other 4 single clones contained only one PCR product (the DNA molecule corresponding to MdACO3 mRNA), whose nucleotide sequence was SEQ ID No.1, and the 1058th position of SEQ ID No.1 was G. This shows that the seeds of the hybrid fruits of 'Red Star' × 'Mi Cui' in the S1, S2, S3, S4, S5 and S6 periods contain both MdACO3 mRNA with A at the 1058th nucleotide of SEQ ID No.1 and MdACO3 mRNA with G at the 1058th nucleotide of SEQ ID No.1.

[0073] The recombinant plasmid of the maternal receptacle contains only one PCR product (DNA molecule corresponding to MdACO3 mRNA), whose nucleotide sequence is SEQ ID No.1, and the 1058th position of SEQ ID No.1 is A, indicating that the maternal receptacle only contains MdACO3 mRNA with the 1058th nucleotide of SEQ ID No.1 being A.

[0074] The recombinant plasmid of the male parent anther contains only one PCR product (DNA molecule corresponding to MdACO3 mRNA), whose nucleotide sequence is SEQ ID No.1, and the 1058th position of SEQ ID No.1 is G, indicating that the male parent anther contains only MdACO3 mRNA with the 1058th nucleotide of SEQ ID No.1 as G.

[0075] Depend on Figure 7It can be seen that the MdACO3 gene in the hybrid fruit of 'Red Star'×'Mi Cui' was transmitted from seeds to flesh during the S6 period (130 days after pollination).

[0076] VI. MdACO3 fluorescence in situ hybridization

[0077] Fluorescence in situ hybridization was used to identify the expression site of MdACO3 mRNA in the main vascular bundle of the sepals of fruits during the transfer period (S6). The RNA probe of MdACO3 was synthesized by Shanghai Gefan Biotechnology Co., Ltd. and labeled with 5'-5-carboxyfluorescein (FAM) and 3'-Minor Groove Binder (MGB)) fluorescent probes. The universal single-stranded negative control (NC) probe was used as a negative control. The probe sequence is as follows. The main vascular bundle of the sepals cut cross-sectioned at the S6 period was immersed in 4% RNase free polyformaldehyde fixative, and the material was placed in a vacuum at a pressure of 0.08 MPa for 30 minutes using a vacuum pump. The tissue was then stored at 4°C and cut into 4 μm slices. The cell nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI) at room temperature for 5 minutes. Finally, the slices were sealed and imaged using a fluorescence microscope (OLYMPUS). The results are shown in Figure 8 As shown, MdACO3 mRNA signal (fluorescence) was observed in the phloem of S6, and this result indicated that the transmissible MdACO3 mRNA could be expressed in the fruit phloem.

[0078] FAM-labeled MdACO3 RNA probe: 5`-GGAAGTTAAGGCCAGTTTTGGTTTGAGTCCAGTTAAAACTACTGCTTGAGAGTGATTAAGTATTTATACTAGAAGCTGCTGGAAAAAGGGTATTTAGCTT-3`

[0079] NC(-):5`-UUGUACUACACAAAAGUACUG-3`

[0080] 7. Repeat the experiment

[0081] Obtaining hybrid fruit: In 2020, in the Beijing Nankou Experimental Field (Laohou Picking Garden), with 'Red Star' as the female parent, after granting pollen from the male parent 'Mi Cui', the hybrid fruit of 'Red Star' × 'Mi Cui' was obtained. Then the anthers of the male parent 'Mi Cui', the receptacle of the female parent 'Red Star', the flesh of the hybrid fruit of 'Red Star' × 'Mi Cui', and the seeds of the hybrid fruit of 'Red Star' × 'Mi Cui' were collected, and the method shown in steps 2 to 6 was used to verify whether there was transmission from seeds to flesh in the flesh of the hybrid fruit of 'Red Star' × 'Mi Cui' in different years. The results showed that the hybrid fruit of 'Red Star' × 'Mi Cui' in 2020 was the same as that of 2019, and its MdACO3 gene was also transmitted from seeds to flesh in the S6 period (130 days after pollination).

[0082] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A method for identifying the transfer of ACO3 mRNA molecules from seeds to flesh of apple plants, characterized in that: The method comprises the following steps: detecting the type of the 1058th nucleotide of SEQ ID No.1 of ACO3 mRNA of the apple plant to be identified, and identifying or assisting in identifying whether the ACO3 mRNA molecule is transferred from seeds to the flesh according to the type of the nucleotide; if the apple plant to be identified contains the ACO3 mRNA whose 1058th nucleotide of SEQ ID No.1 is G, the ACO3 mRNA molecule in the apple plant to be identified is transferred from seeds to the flesh; The Malus plant to be identified is a hybrid fruit of a male parent and a female parent, the anther of the male parent contains only ACO3 mRNA whose nucleotide at position 1058 is G in SEQ ID No.1, the receptacle of the female parent contains only ACO3 mRNA whose nucleotide at position 1058 is A in SEQ ID No.1, and the seeds contain both ACO3 mRNA whose nucleotide at position 1058 is A in SEQ ID No.1 and ACO3 mRNA whose nucleotide at position 1058 is G in SEQ ID No.

1.

2. According to the method of claim 1, the method for detecting the type of the 1058th nucleotide of SEQ ID No.1 of ACO3 mRNA of the flesh of the apple plant to be identified comprises using the cDNA obtained by reverse transcription of the total RNA of the flesh of the apple plant to be identified as a template, performing PCR amplification using PCR primers to obtain a PCR product, sequencing the PCR product, and determining the type of the 1058th nucleotide of SEQ ID No.1 of ACO3 mRNA of the flesh of the apple plant to be identified; The PCR primers include a forward primer and a reverse primer, the forward primer is a single-stranded DNA with a nucleotide sequence of SEQ ID No.2, and the reverse primer is a single-stranded DNA with a nucleotide sequence of SEQ ID No.

3.

3. The method according to claim 1, characterized in that The total RNA of the pulp of the apple plant to be identified is extracted from the pulp of the apple plant in the S6 period after flowering, and the S6 period after flowering is 130 days after pollination.

4. The method according to any one of claims 1 to 3, characterized in that: The Malus plant to be identified may be apple.

5. The method according to claim 4, characterized in that The apple may be a hybrid of 'Red Star' apple and 'Honeycrisp' apple.

6. The method according to claim 5, characterized in that In the hybrid combination of 'Red Star' apple x 'Honey Crisp' apple, the receptacle of the 'Red Star' apple is the female parent, and the anther of the 'Honey Crisp' apple is the male parent.

7. Use of the DNA with the nucleotide sequence of SEQ ID No. 1 or the primers as claimed in claim 2 in identifying the transfer of ACO3 mRNA molecules from seeds to flesh of Malus plants.

Images