Spore killing method and application

Abstract

The invention discloses a spore killing method and application, and belongs to the technical field of food microorganisms. According to the spore killing method, the spores are treated through synergistic thermal sterilization of ethylenediamine tetraacetic acid and / or ethylenediamine tetraacetic acid salt, firstly, spore coats are damaged by using the ethylenediamine tetraacetic acid and / or ethylenediamine tetraacetic acid salt to reduce the resistance of the spores, then thermal treatment is performed, and efficient killing of common spores and effective killing of heat-resistant spores are achieved through the synergistic effect of the ethylenediamine tetraacetic acid and / or ethylenediamine tetraacetic acid salt. Compared with a traditional heat treatment method, the method has the advantages that the energy consumption and the cost are remarkably reduced, the sterilization efficiency is improved, the common spore killing rate can reach 99.9997%, and the heat-resistant spore killing rate can reach 99.98%. The method is applied to the field of food processing, and a novel and effective spore control means with high adaptability and more practical application significance can be provided for food safety and quality maintenance.

Description

Technical Field

[0001] The invention belongs to the technical field of food microorganisms, and in particular, relates to a method for killing microorganisms, and specifically to a method for killing spores and an application thereof. Background Art

[0002] In the food industry, spore-forming bacteria are widely present. Their dormant spores are extremely resistant to environmental damage factors and can survive a variety of processing and preservation measures commonly used in the food industry.

[0003] Thermal sterilization technology is the most widely used sterilization method in food processing, which aims to inactivate bacteria and their spores through high temperature. However, if thermal sterilization is not done properly, bacterial spores may survive, germinate and grow under suitable conditions, and eventually cause food spoilage. However, although excessively intense heat treatment may enhance the sterilization effect, it often exceeds the heat load threshold that the food can withstand, which has an adverse effect on product quality. Therefore, effective control of spores is an urgent problem to be solved in the food industry.

[0004] Chinese invention patent CN116897951A discloses a disinfectant and a preparation method thereof, wherein the disinfectant component includes 0.02-1wt% disodium ethylenediaminetetraacetic acid, which can kill Gram-positive bacteria, Gram-negative bacteria, and fungi within 30 seconds, and can also inactivate influenza A virus within 30 seconds, but the killing rate of black variant of subtilis spores within 30 minutes is only 90%. Compared with vegetative cells, spores are more difficult to kill. Chinese invention patent CN117581958A discloses a method for effectively inactivating spores in Bacillus using chelating resin, and chelating resin is used to inactivate spores in Bacillus. Specifically, the chelating resin is used to quickly and effectively inactivate the spores in Bacillus cereus, Bacillus sabdariffa, Bacillus albus and Bacillus subtilis, and the killing rate of Bacillus subtilis spores can reach 99.87%. The mechanism of inactivating spores is that the functional group carried by the resin is a sodium-type iminodiacetic acid group (Na-IDA). After treatment, a large amount of Na in the functional group + After being released, the spore structure is damaged to a certain extent, eventually leading to the inactivation of the spore.

[0005] Although the above method has a certain killing effect on common spores, some spores can still maintain vitality even after multiple processing, leading to food corruption. Studies have shown that the resistance of spores of spore-forming bacteria isolated from corrupted food significantly exceeds that of standard spore samples used in laboratory studies. This is closely related to the mobile genetic elements of Tn1546. This type of spores carrying Tn1546 transposon has extremely high tolerance to environmental attacks such as high temperature and pressure. Ordinary spores can be inactivated by 90% after being treated at 100°C for 3 minutes. In contrast, spores carrying Tn1546 transposon can survive longer in an environment above 100°C, even up to 600 minutes, and are therefore called heat-resistant spores. The killing effect of existing technologies on ordinary spores is limited, and only a few technologies can be applied to the food field, and there is a lack of effective methods for killing heat-resistant spores in processed foods.

[0006] In summary, although the existing technology has made certain progress in the field of spore inactivation, the efficient killing technology for common spores and effective killing technology for heat-resistant spores still needs to be developed to meet the urgent needs of the food industry and other fields for efficient, safe and minimal impact on food quality spore inactivation technology. Summary of the invention

[0007] The main purpose of the present invention is to provide a spore killing method and application to overcome the deficiencies of the prior art.

[0008] To achieve the above-mentioned purpose, the present invention provides a method for killing spores, comprising killing spores by using ethylenediaminetetraacetic acid and / or ethylenediaminetetraacetic acid salt in combination with heat treatment. By contacting ethylenediaminetetraacetic acid and / or ethylenediaminetetraacetic acid salt with spores, ethylenediaminetetraacetic acid salt reacts with divalent metal ions Mg on spore coats. 2+ , Ga 2+ Chelation destroys the dense electron shell, making the spore coat structure unstable, thereby reducing the heat resistance of the spores. Spores with reduced heat resistance can then be efficiently killed by heat treatment, thereby achieving the killing of the spores.

[0009] As one of the preferred embodiments, the spores are one or a combination of common spores and heat-resistant spores, the common spores are Bacillus spores without Tn1546 transposon, and the heat-resistant spores are Bacillus spores containing Tn1546 transposon.

[0010] As one of the preferred embodiments, the Bacillus includes but is not limited to Bacillus subtilis, Bacillus cereus, Bacillus amyloliquefaciens, Bacillus velezensis and Bacillus pumilus.

[0011] As one of the preferred embodiments, the ethylenediaminetetraacetic acid salt includes any one of ethylenediaminetetraacetic acid disodium salt, ethylenediaminetetraacetic acid calcium sodium salt, and ethylenediaminetetraacetic acid iron sodium salt, or a combination of several of them.

[0012] As one of the preferred embodiments, the heat treatment condition is sterilization at 80-110° C. for 10-40 minutes.

[0013] As one of the preferred embodiments, the identification method of the Bacillus spores containing the Tn1546 transposon is as follows: PCR amplification is performed on the Bacillus to obtain a PCR product, and the amplification product is subjected to agarose electrophoresis to determine that the strain with an amplification band is the Bacillus containing the Tn1546 transposon.

[0014] Further preferably, the electrophoresis treatment includes spotting 5 to 10 μL of the PCR product into an agarose gel immersed in an electrolyte, and performing electrophoresis at a voltage of 110 to 120 V for 20 to 30 min.

[0015] Further preferably, the PCR amplification method includes: in a 20 μL PCR system, 0.8 μL each of 10 μM upstream and downstream primers, 10 μL Taq Mix premix, 5.4 μL sterile water and 3 μL template; the PCR reaction program is: 94°C 5 min pre-denaturation, 94°C 30s, 55°C 1 min and 72°C 2 min as one cycle, a total of 34 cycles, and finally continued extension at 72°C for 5 min.

[0016] Further preferably, the amplified band size is 800 bp.

[0017] Since heat-resistant spores are often detected in heat-processed foods, it is necessary to subject the spores to a heat-processing simulation of the food before sterilization.

[0018] As one of the preferred embodiments, the spore killing method specifically comprises the following steps:

[0019] S1. Pretreatment: resuspending the spore mud in a simulated system added with ethylenediaminetetraacetic acid and / or ethylenediaminetetraacetate to obtain a pretreated spore suspension;

[0020] S2. Simulated food processing heat treatment: The pretreated spore suspension obtained in S1 is subjected to heat treatment to obtain a heat-treated spore suspension;

[0021] S3. Spore heat treatment: heat-treat the heat-treated spore suspension obtained in S1 to obtain an inactivated spore suspension.

[0022] As one of the preferred embodiments, in S1, the simulation system is a 20-100 mM phosphate buffer with a pH of 4.2-6.5.

[0023] Preferably, the concentration of EDTA and / or EDTA salt is 0.01-0.3 g / L.

[0024] Preferably, the number of spores in the pretreated spore suspension is 10 3 ~10 7 CFU / mL.

[0025] As one of the preferred embodiments, in S1, the method for preparing spores comprises the following steps:

[0026] (1) providing a crude spore solution; inoculating Bacillus into a culture medium for culturing, and then washing and collecting the crude spore solution;

[0027] (2) Providing spore mud; centrifuging and washing the crude spore liquid obtained in step (1) to obtain the spore mud.

[0028] As one of the preferred implementations, in S2, the simulated food thermal processing conditions are heating in a water bath at 95-110° C. for 10-120 min, with or without cooling.

[0029] As one of the purposes of the invention, based on the above technical solution, the present invention also provides a method for killing the above spores for application in the field of food processing.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] (1) The present invention utilizes ethylenediaminetetraacetic acid and / or ethylenediaminetetraacetic acid salt to react with the divalent metal ion Mg on the spore coat. 2+ , Ga 2+ Chelation makes the spore coat structure unstable, thereby reducing the heat resistance of common spores and heat-resistant spores. Finally, heat treatment can effectively kill the spores with reduced heat resistance. This method can achieve better sterilization effect with lower energy consumption and cost. The sterilization rates of common spores and heat-resistant spores can be as high as 99.9997% and 99.98%.

[0032] (2) The spore killing method provided by the present invention can provide a new, effective, highly applicable and practical method for the storage of food and the long-term preservation of its quality, flavor and nutritional components. It can be applied to the field of food processing, has broad application prospects and great market promotion value.

[0033] (3) The method for killing heat-resistant spores provided by the technical solution of the present invention has the advantages of simple operation, low cost, and green environmental protection, which enhances its safety in the field of food sterilization, can greatly reduce the number of operating steps, and is suitable for large-scale promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0035] Figure 1 The agarose electrophoresis diagram of the strains producing heat-resistant spores and ordinary spores used in the present invention is shown.

[0036] Figure 2 The counts of the heat-resistant spore suspensions prepared in Comparative Examples 2-9 are shown.

[0037] Figure 3 The logarithms of spore killing for Examples 4-11 and Comparative Examples 1 and 10 are shown.

[0038] Figure 4 The spore survival rate after hypochlorite treatment was added to the pre-treated heat-resistant spore suspension provided in Example 10 and Comparative Example 1 is shown.

[0039] Figure 5a-Figure 5b Scanning electron microscope images of the heat-resistant spores treated with sodium hypochlorite in the spore suspensions provided in Comparative Examples 2 and 9 are shown respectively.

[0040] Figure 5c-5d Scanning electron micrographs of the heat-resistant spores treated with sodium hypochlorite from the pretreated heat-resistant spore suspensions provided in Comparative Example 1 and Example 10 are shown respectively. DETAILED DESCRIPTION

[0041] The technical solution of the present invention is explained in more detail below in conjunction with several embodiments.

[0042] The present invention provides a method for killing spores, comprising killing spores by using ethylenediaminetetraacetic acid and / or ethylenediaminetetraacetic acid salt in combination with heat treatment. The ethylenediaminetetraacetic acid and / or ethylenediaminetetraacetic acid salt is contacted with the spores to allow the ethylenediaminetetraacetic acid and / or ethylenediaminetetraacetic acid salt to react with the divalent metal ion Mg on the spore coat. 2+ , Ga 2+ Chelation destroys the dense electron shell, making the spore coat structure unstable, thereby reducing the heat resistance of the spores. Spores with reduced heat resistance can then be efficiently killed by heat treatment, thereby achieving the killing of the spores.

[0043] In some specific embodiments, the spore is one of common spore and heat-resistant spore, the common spore is Bacillus spore, and the heat-resistant spore is Bacillus spore containing Tn1 546 transposon.

[0044] In some specific embodiments, the Bacillus includes Bacillus subtilis, Bacillus cereus, Bacillus amyloliquefaciens, Bacillus velezensis and Bacillus pumilus.

[0045] In some specific embodiments, the EDTA salt includes any one of EDTA disodium salt, EDTA calcium sodium salt, and EDTA iron sodium salt, or a combination of several thereof.

[0046] The sources and preparation methods of some raw materials used in the following examples and comparative examples are as follows:

[0047] (1) PCA medium: PCA medium was purchased from Guangdong Huankai Microbiological Technology Co., Ltd. and used for the counting of Bacillus.

[0048] (2) Contains 0.91 μmol / L Mn 2+ Nutrient agar medium: 0.91 μmol Mn 2+ Add to 1L of nutrient agar medium, sterilize at 121℃ for 15min, cool, and use after making a slant. Nutrient agar medium was purchased from Guangdong Huankai Microbiological Technology Co., Ltd.; Mn 2+ Derived from MnCl2·4H2O, purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.; this culture medium is used for the preparation of spores.

[0049] (3) Upstream primer: Det-hyp-2mob-F: GTGCCTGAATGGTTAGATATAGC;

[0050] Downstream primer: Det-hyp-2mob-R: TTATCCTTTTAAAATAGGGGTCACTTTATC.

[0051] (4) A method for preparing agarose gel, comprising the following steps: 30 mL of sterile water, 0.6 g of agarose and 600 μL of 50X TAE Buffer are mixed, and then sealed with a microwave oven and heated to boiling until no insoluble matter is visible. The mixture is allowed to stand at 55° C., 3 μL of 4S Green nucleic acid dye is added, mixed and poured into a plastic plate, and can be used after solidification; the electrolyte is a mixture of 5 mL of 50X TAE Buffer and 245 mL of ultrapure water.

[0052] (5) The commercially available Bacillus subtilis 168 was used to prepare the common spores, and the heat-resistant spores were prepared using Bacillus subtilis KLMM10251 containing the Tn1546 transposon, which was isolated from spoiled braised beef.

[0053] Other reagents used in the present invention are commercially available.

[0054] The technical solution of the present invention is described in detail below through specific embodiments.

[0055] Example 1

[0056] This embodiment provides a method for identifying heat-resistant spores, the steps are as follows:

[0057] (1) Screening of Bacillus containing Tn1546 transposon: PCR amplification was performed on Bacillus subtilis to obtain PCR products, 5 μL of which was spotted on an agarose gel immersed in electrolyte, and electrophoresed at 110 V for 30 min to select strains with 800 bp.

[0058] like Figure 1 As shown, under ultraviolet conditions, the strain has an obvious band at 800 bp, indicating that the strain is Bacillus subtilis KLMM10251 containing the Tn1546 transposon, and the spores prepared by it are heat-resistant spores; while Bacillus subtilis 168 has no band, and the spores prepared by it are ordinary spores.

[0059] The PCR amplification method comprises the following steps: in a 20 μL PCR system, 0.8 μL of a 10 μM upstream primer, 0.8 μL of a 10 μM downstream primer, 10 μL of a Taq Mix premix, 5.4 μL of sterile water and 3 μL of a template; the PCR reaction program is: pre-denaturation at 94°C for 5 minutes, 94°C for 30 seconds, 55°C for 1 minute and 72°C for 2 minutes as one cycle, a total of 34 cycles, and finally continuing to extend at 72°C for 5 minutes.

[0060] Example 2

[0061] This embodiment provides a method for preparing heat-resistant spores, the steps are as follows:

[0062] (1) Providing a spore crude solution; inoculating 10 mL of Bacillus subtilis containing the Tn1546 transposon into 0.5 μmol / LMn 2+ The spores were cultured in a nutrient agar medium at 37° C. for 7 days, shaken, washed and collected with 5 mL of sterile deionized water to obtain the spore crude liquid;

[0063] (2) Providing spore mud; washing the crude spore liquid obtained in step (1) by centrifugation, washing with 10 mL of sterile deionized water at 8000 r / min for 15 min, repeating 5 times to obtain the extremely heat-resistant spore mud.

[0064] Example 3

[0065] This example provides a method for preparing common spores, which is basically the same as that of Example 2, except that the strain used in step (1) is Bacillus subtilis 168 that does not contain the Tn1546 transposon.

[0066] Example 4

[0067] This embodiment provides a method for killing heat-resistant spores, and the specific steps are as follows:

[0068] S1. Pretreatment: The heat-resistant spore mud prepared in Example 2 was resuspended in 100 mM potassium phosphate buffer containing 0.05 g / L disodium ethylenediaminetetraacetate iron and pH 6.2 to make the spore count 10 7 CFU / mL, the pretreated heat-resistant spore suspension was obtained, and the spore count was 10 7 CFU / mL

[0069] S2 simulated food processing heat treatment: the pre-treated spore suspension obtained in S1 simulated food heat processing, in a 100 ° C water bath for 30min, cooled to 15 ° C, to obtain a heat-treated spore suspension;

[0070] S3. Heat treatment of heat-resistant spores: The heat-processed spore suspension obtained in S1 is subjected to sterilization heat treatment at 95° C. for 30 min to obtain an inactivated spore suspension.

[0071] This embodiment can kill 96.78% of heat-resistant spores.

[0072] Example 5

[0073] This embodiment provides a method for killing heat-resistant spores, which is basically the same as that in embodiment 4, except that in step S1, the heat-resistant spore mud prepared in embodiment 2 is resuspended in a 100 mM potassium phosphate buffer containing 0.05 g / L calcium disodium ethylenediaminetetraacetate and a pH of 6.2 to obtain a pretreated heat-resistant spore suspension. The number of spores is 10 7 CFU / mL.

[0074] This embodiment can kill 97.58% of heat-resistant spores.

[0075] Example 6

[0076] This embodiment provides a method for killing heat-resistant spores, which is basically the same as that of embodiment 4, except that, in step S1, the heat-resistant spore mud prepared in embodiment 2 is resuspended in a 100 mM potassium phosphate buffer containing 0.05 g / L disodium ethylenediaminetetraacetic acid and a pH of 6.2 to obtain a pretreated heat-resistant spore suspension, and the number of spores is 10 7 CFU / mL.

[0077] This embodiment can kill 96.95% of heat-resistant spores.

[0078] Example 7

[0079] This embodiment provides a method for killing heat-resistant spores, which is basically the same as that of embodiment 4, except that, in step S1, the heat-resistant spore mud prepared in embodiment 2 is resuspended in a 100 mM potassium phosphate buffer containing 0.15 g / L disodium ethylenediaminetetraacetic acid and a pH of 6.2 to obtain a pretreated heat-resistant spore suspension. The number of spores is 10 7 CFU / mL.

[0080] This embodiment can kill 98.64% of heat-resistant spores.

[0081] Example 8

[0082] This embodiment provides a method for killing heat-resistant spores, which is basically the same as that of embodiment 4, except that, in step S1, the heat-resistant spore mud prepared in embodiment 2 is resuspended in a 100 mM potassium phosphate buffer containing 0.25 g / L disodium ethylenediaminetetraacetic acid and a pH of 6.2 to obtain a pretreated heat-resistant spore suspension. The number of spores is 10 7 CFU / mL.

[0083] This embodiment can kill 99.26% of heat-resistant spores.

[0084] Example 9

[0085] This embodiment provides a method for killing heat-resistant spores, which is basically the same as that of embodiment 4, except that, in step S1, the heat-resistant spore mud prepared in embodiment 2 is resuspended in a 100 mM potassium phosphate buffer containing 0.05 g / L ethylenediaminetetraacetic acid and a pH of 6.2 to obtain a pretreated heat-resistant spore suspension, and the number of spores is 10 7 CFU / mL.

[0086] This embodiment can kill 93.91% of heat-resistant spores.

[0087] Example 10

[0088] This embodiment provides a method for killing heat-resistant spores, which is basically the same as that of embodiment 4, except that, in step S1, the heat-resistant spore mud prepared in embodiment 2 is resuspended in a 100 mM potassium phosphate buffer containing 0.05 g / L ethylenediaminetetraacetic acid and a pH of 5.4 to obtain a pretreated heat-resistant spore suspension. The number of spores is 10 7 CFU / mL.

[0089] This embodiment can kill 99.98% of heat-resistant spores.

[0090] Embodiment 11

[0091] This embodiment provides a method for killing common spores, which is basically the same as that in embodiment 4, the difference is that the spores used in step S1 are the common spore mud prepared in embodiment 3, and the spores are resuspended in a 100 mM potassium phosphate buffer containing 0.05 g / L ethylenediaminetetraacetic acid and a pH of 6.2 to obtain a pretreated common spore suspension. The number of spores is 10 7 CFU / mL.

[0092] This embodiment can kill 99.9997% of common spores.

[0093] Example 12

[0094] This embodiment provides a method for killing common spores, which is basically the same as that in embodiment 4, the difference is that the spores used in step S1 are the heat-resistant spore mud prepared in embodiment 3, and the spores are resuspended in a 100 mM potassium phosphate buffer containing 0.05 g / L ethylenediaminetetraacetic acid and a pH of 6.2 to obtain a pretreated heat-resistant spore suspension. The number of spores is 10 3 CFU / mL.

[0095] After the treatment in this example, no microorganisms were detected.

[0096] Embodiment 13

[0097] This embodiment provides a method for killing common spores which is basically the same as that of Embodiment 4, except that, in step S2, the pretreated spore suspension obtained in S1 is subjected to simulated food thermal processing by being placed in a 100° C. water bath for 30 minutes without cooling to obtain a thermally processed spore suspension.

[0098] This example can kill 96.15% of heat-resistant spores.

[0099] Embodiment 14

[0100] This embodiment provides a method for simulating heat treatment of food processing with heat-resistant spores, and the specific steps are as follows:

[0101] S1. Pretreatment: The heat-resistant spore mud prepared in Example 2 was resuspended in 100 mM potassium phosphate buffer containing 0.05 g / L ethylenediaminetetraacetic acid and pH 6.2, and the spore count was 10 7 CFU / mL, the pretreated heat-resistant spore suspension was obtained, and the spore count was 10 7 CFU / mL

[0102] S2. Simulated food processing heat treatment: The pretreated spore suspension obtained in S1 is subjected to simulated food heat processing, placed in a 100° C. water bath for 30 min, and cooled to 15° C. to obtain a heat-processed spore suspension.

[0103] This embodiment can kill 88.71% of heat-resistant spores.

[0104] Comparative Example 1

[0105] This comparative example provides a method for killing heat-resistant spores, which is basically the same as Example 4, except that in step S1, the heat-resistant spore mud prepared in Example 2 is resuspended in 100 mM potassium phosphate buffer with a pH of 6.2 to obtain a pretreated heat-resistant spore suspension, and the number of spores is 10 7 CFU / mL.

[0106] This comparative example can kill 24.73% of heat-resistant spores.

[0107] Comparative Example 2

[0108] This comparative example provides a spore suspension. The preparation method of the spore suspension is to resuspend the heat-resistant spore mud prepared in Example 2 in a 100 mM potassium phosphate buffer with a pH of 6.2 to obtain a pretreated heat-resistant spore suspension. The number of spores is 10 7 CFU / mL.

[0109] Comparative Example 3

[0110] This comparative example provides a spore suspension. The preparation method of the spore suspension is to resuspend the heat-resistant spore mud prepared in Example 2 in a 100 mM potassium phosphate buffer containing 0.05 g / L disodium ethylenediaminetetraacetate iron and a pH of 6.2, so that the number of spores is 10 7 CFU / mL.

[0111] Comparative Example 4

[0112] This comparative example provides a spore suspension. The preparation method of the spore suspension is to resuspend the heat-resistant spore mud prepared in Example 2 in a 100 mM potassium phosphate buffer containing 0.05 g / L calcium disodium ethylenediaminetetraacetate and a pH of 6.2, so that the number of spores is 10 7 CFU / mL.

[0113] Comparative Example 5

[0114] This comparative example provides a spore suspension. The preparation method of the spore suspension is to resuspend the heat-resistant spore mud prepared in Example 2 in a 100 mM potassium phosphate buffer containing 0.05 g / L disodium ethylenediaminetetraacetic acid and a pH of 6.2, so that the number of spores is 10 7 CFU / mL.

[0115] Comparative Example 6

[0116] This comparative example provides a spore suspension. The preparation method of the spore suspension is to resuspend the heat-resistant spore mud prepared in Example 2 in a 100 mM potassium phosphate buffer containing 0.15 g / L disodium ethylenediaminetetraacetic acid and a pH of 6.2, so that the number of spores is 10 7 CFU / mL.

[0117] Comparative Example 7

[0118] This comparative example provides a spore suspension. The preparation method of the spore suspension is to resuspend the heat-resistant spore mud prepared in Example 2 in a 100 mM potassium phosphate buffer containing 0.25 g / L disodium ethylenediaminetetraacetic acid and a pH of 6.2, so that the number of spores is 10 7 CFU / mL.

[0119] Comparative Example 8

[0120] This comparative example provides a spore suspension. The preparation method of the spore suspension is to resuspend the heat-resistant spore mud prepared in Example 2 in a 100 mM potassium phosphate buffer containing 0.05 g / L ethylenediaminetetraacetic acid and a pH of 6.2, so that the number of spores is 10 7 CFU / mL.

[0121] Comparative Example 9

[0122] This comparative example provides a spore suspension. The preparation method of the spore suspension is to resuspend the heat-resistant spore mud prepared in Example 2 in a 100 mM potassium phosphate buffer containing 0.05 g / L ethylenediaminetetraacetic acid and a pH of 5.4, so that the number of spores is 10 7 CFU / mL.

[0123] Comparative Example 10

[0124] This comparative example provides a spore suspension, and the preparation method of the spore suspension is basically the same as that of Example 4, except that in step S1, the common spore mud prepared in Example 3 is resuspended in a 100 mM potassium phosphate buffer with a pH of 5.4 to obtain a pretreated common spore suspension with a spore count of 10 7 CFU / mL.

[0125] This comparative example can kill 99.975% of common spores.

[0126] Comparative Example 11

[0127] This comparative example provides a method for simulating heat treatment of food processing with heat-resistant spores. The method for preparing the spore suspension is basically the same as that in Example 4, except that in step S1, the heat-resistant spore mud prepared in Example 2 is resuspended in 100 mM potassium phosphate buffer with a pH of 6.2 to obtain a heat-treated spore suspension.

[0128] This comparative example can kill 0.98% of heat-resistant spores.

[0129] Test Case

[0130] Spore count: Take 1 mL of the samples prepared in Examples 4-11 and Comparative Examples 1-10, respectively, and dilute them in 9 mL of 0.9% NaCl solution, and select the appropriate gradient to apply to PCA medium. Take the samples of Example 10 and Comparative Example 1, treat them with 0.15% hypochlorite for 30 minutes, and then apply them to PCA medium according to the above method. After the applied medium is cultured at 37°C for 12 hours, count to determine the number of spores.

[0131] The spore count results of Example 4-Example 11 and Comparative Example 1 and Example 10 are as follows: Figure 2 shown.

[0132] The spore count results of Comparative Examples 2 to 9 are as follows: Figure 3 shown.

[0133] The spore count results of Example 10 and Comparative Example 1 treated with hypochlorite are as follows: Figure 4 shown.

[0134] Scanning electron microscopy: The microstructures of Example 10, Comparative Example 1, Comparative Example 2 and Comparative Example 9 were observed using a SU8020 scanning electron microscope. The treated samples were centrifuged at 8000g for 2 min, and the precipitate was resuspended in 100 μL 2.5% glutaraldehyde fixative and fixed for 12 h. Subsequently, the samples were dehydrated by centrifugation at 8000g for 2 min in increasing concentrations of ethanol (30%, 50%, 70%, 90% and 100%), with a dehydration interval of 10 min. The dehydrated samples were finally resuspended in 100 μL pure ethanol, and 10 μL was spotted on a cell slide and dried for 4 h, then gold-plated and observed using a scanning electron microscope. The results are shown in Figure 5.

[0135] Data statistical analysis: All experiments were repeated three times, and the results were expressed as mean value v standard deviation. The experimental data were analyzed using the Linear Models program in the Statistix8.1 software package, and the difference significance (P<0.05) was analyzed using the TukeyHSD program. Figure 2-Figure 4 Middle and lowercase letters (a, b, c, d) indicate significant differences among different treatment groups (P < 0.05).

[0136] Result analysis:

[0137] like Figure 2 As shown, there is no significant difference (P>0.05) in the spore counts of Comparative Examples 3 to 9 with the addition of EDTA compared with Comparative Example 2, indicating that the use of EDTA alone does not inactivate the spores.

[0138] like Figure 3 As shown, compared with the comparative example 1 which was heat-treated alone, the heat-resistant spores treated in examples 4-10 were significantly inactivated, while the heat-resistant spore inactivation effect of comparative example 1 which only used the heat treatment method was not good, indicating that EDTA can cooperate with heat treatment to effectively inactivate heat-resistant spores. Compared with comparative example 1, comparative example 10 can kill 99.975% of common spores even if it is heat-treated alone, but after being treated with EDTA, the killing rate of common spores in example 11 can be further improved to 99.9997%.

[0139] Example 14 and Comparative Example 11 were only subjected to heat treatment. From the results of Comparative Example 12, it can be seen that heat treatment can only kill a very small part of the spores, but the heat-resistant spore killing rate of Comparative Example 11 with the addition of EDTA can reach 94.36%. It can be seen that the addition of EDTA effectively inactivates most of the heat-resistant spores during the food heat processing stage.

[0140] Example 4-Example 14 respectively used different ethylenediaminetetraacetic acids or ethylenediaminetetraacetic acid salts, as well as different concentrations and pH conditions. After heat-treating the spores under different conditions, efficient killing of ordinary spores and heat-resistant spores was achieved. The killing results obtained were similar and will not be repeated here.

[0141] Furthermore, the present invention is described by taking Bacillus subtilis as an example in the above preferred embodiments. It can be inferred that the present invention can also achieve the same or similar results by using other bacteria of the genus Bacillus.

[0142] Therefore, EDTA and / or EDTA salts can cooperate with heat treatment to efficiently kill common spores, and can more effectively kill common spores and / or heat-resistant spores.

[0143] Verification test:

[0144] The spore coat plays an important role in protecting spores from external attacks and has an important impact on the resistance and germination of spores. Studies have found that the resistance of spores to hypochlorite is significantly reduced after the spore coat is destroyed. Therefore, the present invention further investigates the spore resistance to 0.15% sodium hypochlorite to determine the damage of the spore coat.

[0145] Specifically:

[0146] 1. Sodium hypochlorite is added to the pretreated heat-resistant spore suspension obtained in Example 10, comprising: in step S1, the heat-resistant spore mud prepared in Example 2 is resuspended in a 100 mM potassium phosphate buffer containing 0.05 g / L ethylenediaminetetraacetic acid and a pH of 5.4, and then sodium hypochlorite is added at a concentration of 0.15%.

[0147] 2. Sodium hypochlorite is added to the pretreated heat-resistant spore suspension of Comparative Example 1, comprising: in step S1, the heat-resistant spore mud prepared in Example 2 is resuspended in 100 mM potassium phosphate buffer with a pH of 6.2, and then sodium hypochlorite is added at a concentration of 0.15%.

[0148] 3. In the spore suspension provided in Comparative Example 2, the spore suspension is prepared by resuspending the heat-resistant spore mud prepared in Example 2 in a 100 mM potassium phosphate buffer having a pH of 6.2, so that the number of spores is 10 7 CFU / mL; then sodium hypochlorite was added to the spore suspension at a concentration of 0.15%.

[0149] 4. In the spore suspension provided in Comparative Example 9, the spore suspension is prepared by resuspending the heat-resistant spore mud prepared in Example 2 in a 100 mM potassium phosphate buffer containing 0.05 g / L ethylenediaminetetraacetic acid and a pH of 5.4, so that the number of spores is 10 7CFU / mL; then sodium hypochlorite was added to the spore suspension at a concentration of 0.15%.

[0150] like Figure 4 As shown, the resistance of the spores in Example 10 with the addition of EDTA to sodium hypochlorite was significantly lower than that in Comparative Example 1 (with the addition of sodium hypochlorite) (P < 0.05), indicating that EDTA affects the spore coat and reduces the resistance of the spores to sodium hypochlorite.

[0151] See also Figure 5d This is a scanning electron microscope photo of the spores after inactivation using the technical solution of Example 10 (adding sodium hypochlorite). The results are similar to Figure 4 The results shown are consistent. Figure 5d The spores treated in Example 10 (with sodium hypochlorite) were deformed, damaged and lysed. Figure 5a , Figure 5b and Figure 5c , respectively, are scanning electron microscope photos of spores after inactivation of Comparative Example 2, Comparative Example 9 and Comparative Example 1. The results show that Comparative Example 1, Comparative Example 2 and Comparative Example 9 do not have this phenomenon. The above test results show that EDTA and / or EDTA salt contact with spores, so that EDTA and / or EDTA salt react with the divalent metal ion Mg on the spore coat. 2+ , Ga 2+ Chelation destroys the dense electron shell, making the spore coat structure unstable and reducing the heat resistance of the spores. Heat treatment further destroys the spore coat and effectively kills the spores with reduced heat resistance.

[0152] The method provided by the present invention can achieve better sterilization effect with lower energy consumption and cost, and provides a new spore control method with great practical significance for the storage period of food and the maintenance of its quality, flavor and nutritional components.

[0153] In addition, the inventors of this case also referred to the aforementioned embodiments and conducted experiments with other raw materials, process operations, and process conditions described in this specification, and obtained relatively ideal results.

[0154] It should be understood that the technical solution of the present invention is not limited to the above-mentioned specific implementation cases. Any technical deformation made according to the technical solution of the present invention without departing from the scope of protection of the purpose of the present invention and the claims shall fall within the protection scope of the present invention.

Claims

1. A method for killing spores, comprising killing spores by using ethylenediaminetetraacetic acid and / or ethylenediaminetetraacetic acid salt in combination with heat treatment.

2. The method for killing spores according to claim 1, characterized in that: The spores are one or a combination of common spores and heat-resistant spores, and the common spores are Bacillus without Tn1546 transposon ( Bacillus ) spores, wherein the heat-resistant spores are Bacillus spores containing the Tn1546 transposon.

3. The method for killing spores according to claim 2, characterized in that: The Bacillus includes Bacillus subtilis ( Bacillus subtilis ), Bacillus cereus ( Bacillus cereus )、Bacillus amyloliquefaciens( Bacillus amyloliquefaciens ), Bacillus Velez Bacillus velezensis ) and Bacillus pumilus ( Bacillus pumilus )wait.

4. The method for killing spores according to claim 1, characterized in that: The ethylenediaminetetraacetic acid salt includes any one or a combination of several of ethylenediaminetetraacetic acid disodium salt, ethylenediaminetetraacetic acid calcium sodium salt, and ethylenediaminetetraacetic acid iron sodium salt.

5. The method for killing spores according to claim 1, characterized in that: The heat treatment condition is 80-110° C. for sterilization for 10-40 min.

6. The method for killing spores according to claim 2, characterized in that: The identification method of the Bacillus containing the Tn1546 transposon is as follows: PCR amplification is performed on the Bacillus to obtain a product, and the amplification product is subjected to agarose electrophoresis to determine that the strain with an amplification band is the Bacillus containing the Tn1546 transposon; The electrophoresis treatment includes taking 5-10 μL of the PCR product and spotting it on an agarose gel immersed in an electrolyte, and performing electrophoresis at a voltage of 110-120 V for 20-30 min; The PCR amplification method includes: a 20 µL PCR system consisting of: 0.8 µL of each 10 µM upstream and downstream primers, 10 µL Taq Mix premix, 5.4 µL sterile water and 3 µL template; the PCR reaction program is: 94°C 5 min pre-denaturation, 94°C 30s, 55°C 1 min and 72°C 2 min as one cycle, a total of 34 cycles, and finally continued extension at 72°C for 5 min.

7. The method for killing spores according to claim 1, characterized in that: The specific steps include: S1. Pretreatment: resuspending the spore mud in a simulated system to which ethylenediaminetetraacetic acid and / or ethylenediaminetetraacetate is added to obtain a pretreated spore suspension; S2 simulated food heat processing: the pre-treated spore suspension obtained in S1 was subjected to simulated food heat processing, heat processing spore suspension; S3. Spore heat treatment: heat-treating the heat-treated spore suspension obtained in S2 to obtain an inactivated spore suspension.

8. The method for killing spores according to claim 7, characterized in that: In S1, the pH of the simulation system is 4.2-6.5; The concentration of EDTA and / or EDTA salt is 0.01-0.3 g / L; The number of spores in the pretreated spore suspension is 10 3 ~10 7 CFU / mL.

9. The method for killing spores according to claim 7, characterized in that: In S2, the simulated food thermal processing conditions are heating in a 95-110°C water bath for 10-120 min.

10. Use of the spore killing method according to any one of claims 1 to 9 in the field of food processing.

Images