Application of SlAAP8 protein and coding gene thereof in regulation and control of tomato pollen fertility

Abstract

The invention belongs to the technical field of plant genetic engineering and molecular breeding, and particularly relates to an application of SlAAP8 protein and a coding gene thereof in regulation and control of tomato pollen fertility. Firstly, the SlAAP8 gene is positioned through whole genome association analysis, and a yeast mutant strain complementary experiment is utilized to confirm that the SlAAP8 gene has a multi-amino acid transport function. Phenotypic analysis carried out by constructing an SlAAP8 overexpression and gene editing mutant strain finds that stamens of the overexpression strain grow normally, and metabolome detection shows that the amino acid level in anther is remarkably increased; the SlAAP8 knockout mutant (slaap8-cr) shows typical pollen abortion, and the fertility of the SlAAP8 can be completely recovered by spraying L-proline on leaf surfaces. The results not only reveal a molecular mechanism that SlAAP8 maintains pollen development by regulating and controlling the amino acid homeostasis, but also establish a male sterility line creation system based on gene editing and a chemical fertility recovery method of the male sterility line creation system.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering and molecular breeding, and specifically relates to the application of S1AAP8 protein and its encoding gene in regulating tomato pollen fertility. Background Art

[0002] The development of male fertility in plants is affected by a complex interaction of genetic factors and multiple environmental factors, which can lead to abnormal development or inactivation of anthers or pollen (male reproductive organs). Male sterile lines can be divided into three types based on the structural integrity of the anthers and the viability of the pollen grains: degenerate stamen male sterile mutants, sporogenesis-defective male sterile mutants, and functional male sterile mutants. The research and development of genetic resources related to male sterile lines has always been an important aspect of plant breeding programs. In the field of agricultural improvement, male sterile lines are often combined with hybrid vigor, and this approach is of great value for the development of new crop varieties and the implementation of large-scale hybrid breeding programs.

[0003] Tomato (Solanum lycopersicum L.) is an annual herbaceous plant of the Solanaceae family, native to South America and widely cultivated in northern and southern China. It has become a key model organism for scientific research due to its agricultural significance. Tomato is a typical self-pollinating crop. As a key male reproductive organ, the normal development of anthers plays a key role in plant sexual reproduction and the construction of hybrid breeding systems. Amino acids, as core elements of protein biosynthesis and important carriers of nitrogen metabolism, are essential nutrients for plant growth and development, and amino acid metabolism is closely related to male fertility. Studies have shown that the L-proline content in tomato pollen is positively correlated with pollen vigor.

[0004] The amino acid transporter (AAT) family is a large family of amino acid transporters in plants, including many subfamilies, such as amino acid permeases (AAPs), lysine and histidine transporters (LHTs), and vacuolar amino acid exporters (AVTs). Among these subfamilies, the AAPs family preferentially transports neutral and acidic amino acids. Existing studies have shown that plant male fertility is closely related to the accumulation of amino acids (such as L-proline) in anthers. Although AAPs family members have been found to be involved in amino acid transport in Arabidopsis, their mutants do not show significant fertility defects. As a model crop, the functional research of tomato's AAPs family is still limited to a few genes such as SlAAP2 and SlAAP6, and its molecular mechanism in anther-specific amino acid transport and male fertility has not yet been elucidated. At present, the creation of tomato male sterile lines mostly relies on natural mutations or chemical mutagenesis, which has problems such as low efficiency and unclear mechanisms. Therefore, discovering key genes that regulate anther amino acid metabolism and developing precise fertility regulation technologies are scientific issues that need to be solved urgently. Summary of the invention

[0005] The technical problem to be solved by the present invention is: to provide an amino acid permease SlAAP8 (amino acidpermease 8, AAP8) and its encoding gene and to reveal the molecular mechanism by which the encoding gene maintains pollen development by regulating amino acid homeostasis, as well as a male sterile line creation system based on gene editing and a method for chemically restoring fertility.

[0006] To solve the above problems, the present invention provides the following technical solutions: The first aspect of the present invention provides an application of the protein S1AAP8, wherein the protein comprises 489 amino acid residues, and the application is any one of the following: A1) Application in regulating amino acid accumulation in plant anthers; A2) Application in regulating plant pollen fertility; A3) Application in the preparation of transgenic plants with increased pollen deformity rate; A4) Use in the preparation of male-sterile transgenic plants; The protein is any of the following: B1) a protein whose amino acid sequence is SEQ ID No. 2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the protein in B1); The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0007] The second aspect of the present invention provides the use of biological materials related to the protein S1AAP8, wherein the use is any of the following: C1) Application in regulating amino acid accumulation in plant anthers; C2) Application in regulating plant pollen fertility; C3) Application in preparing transgenic plants with increased pollen deformity rate; C4) Use in preparing male sterile transgenic plants; The biological material is any one of the following D1) to D7): D1) a nucleic acid molecule encoding the protein S1AAP8; D2) an expression cassette containing the nucleic acid molecule described in D1); D3) a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) a recombinant microorganism containing the nucleic acid molecule described in D1), or a recombinant microorganism containing the expression cassette described in D2), or a recombinant microorganism containing the recombinant vector described in D3); D5) a transgenic plant cell line containing the nucleic acid molecule described in D1), or a transgenic plant cell line containing the expression cassette described in D2), or a transgenic plant cell line containing the recombinant vector described in D3); D6) transgenic plant tissue containing the nucleic acid molecule described in D1), or transgenic plant tissue containing the expression cassette described in D2); D7) A transgenic plant organ containing the nucleic acid molecule described in D1) or a transgenic plant organ containing the expression cassette described in D2).

[0008] The nucleic acid molecule is a DNA molecule whose nucleotide sequence is shown in SEQ ID NO. 1. The nucleotide sequence shown in SEQ ID NO. 1 is the nucleotide sequence of the protein S1AAP8 coding gene (CDS), and has a length of 1467 bp.

[0009] In the above application, the amino acids include L-proline, alanine, isoleucine, leucine, phenylalanine, threonine, tyrosine and valine.

[0010] The third aspect of the present invention provides a method for preparing a transgenic plant with increased pollen deformity rate or male sterility, the method comprising reducing the content and / or activity of the protein S1AAP8 in the target plant, thereby significantly reducing the L-proline content in the pollen.

[0011] In the above method, reducing the content and / or activity of the protein S1AAP8 in the target plant is achieved by reducing the expression level of the gene encoding the protein S1AAP8 in the target plant.

[0012] In the above method, reducing the expression level of the gene encoding the protein in the target plant is to construct a gene knockout vector using gene knockout technology to reduce the expression level of the gene encoding the protein S1AAP8 in the genome of the target plant.

[0013] In the examples of the present application, the present technicians took the SlAAP8 gene as the target gene, designed the forward primer and reverse primer of the dual target sites SlAAP8-Target 1 and SlAAP8-Target 2 of the SlAAP8 gene, and then used the U6 promoter of pCBC-DT1T2 as a template to amplify the fragment to obtain the target band; used T4 ligase to connect the vector pTX41 and the PCR product at the Bsa Ⅰ restriction site; finally, the product was transferred into Escherichia coli / DH5α to construct a gene knockout vector, and the knockout vector was transformed into tomato plants to successfully construct the SlAAP8 gene knockout mutant slaap8-cr.

[0014] At the same time, the present invention technicians amplified the full-length sequence of the SlAAP8 gene from tomato genomic DNA and cDNA based on PCR technology, connected the gene to an overexpression vector driven by a strong 35S promoter, and obtained a SlAAP8 overexpression strain (SlAAP8-OE) through Agrobacterium-mediated genetic transformation.

[0015] By comparing the phenotypic and metabolic characteristics of the wild type, SlAAP8-OE and slaap8-cr materials, it was confirmed that SlAAP8 affects male fertility by regulating the amino acid content in anthers.

[0016] The fourth aspect of the present invention provides a method for restoring the fertility of a plant male sterile line created by knocking out the S1AAP8 gene: spraying a 0.1% W / V L-proline solution on the leaves of the plant male sterile line.

[0017] Any of the above plants may be a plant of the genus Tomato.

[0018] Compared with the prior art, the present invention has the following effects: 1. It was confirmed that SlAAP8 is a key gene for the transport of eight amino acids including L-proline in tomato anthers. Its functional loss leads to a decrease in the L-proline content in pollen and causes pollen abortion, filling the research gap in the regulation of male fertility by amino acid transporters in Solanaceae crops.

[0019] 2. Targeted knockout of SlAAP8 through CRISPR / Cas9 resulted in pollen abortion, and fertility restoration (germination rate >85%) could be achieved by foliar spraying of 0.1% L-proline, providing a controllable technical solution for hybrid breeding.

[0020] 3. It was confirmed for the first time that the accumulation level of L-proline in anthers is the decisive factor for tomato pollen fertility, and SlAAP8 has a unidirectional regulatory effect on it (overexpression increases the amino acid content but does not affect fertility), providing a new model for analyzing the metabolic network of plant reproductive development.

[0021] Based on the above advantages, the present invention can provide key gene resources and technical support for the large-scale production of tomato hybrids and the research on the mechanism of crop male sterility, and has significant potential for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 mGWAS positioning and linkage disequilibrium analysis of SlAAP8 gene: Figure 1 A in the figure is a Manhattan plot of genome-wide association analysis (mGWAS) based on L-proline content of 422 tomato accessions (P=6.87E-07), the purple dotted line indicates the significance threshold, and the arrow indicates the significant association region on chromosome 12; Figure 1 Figure B is the SNP linkage disequilibrium (LD) heat map of the region where the SlAAP8 gene is located (63.432-63.839 Mb on chromosome 12). The color depth represents the r² value, and the blue box marks the position of the SlAAP8 gene.

[0023] Figure 2 Molecular characterization of SlAAP8 overexpression and knockout materials: Figure 2 A in the figure indicates the specific edited bases in the slaap8 mutants sorted out through sequencing results, squares are exons, lines are introns, green indicates CRISPR / Cas9 designed target sites, red underlines indicate premature termination sites of SlAAP8 protein translation, SlAAP8 overexpression (SlAAP8-OE) and mutant strains (slaap8-cr) material identification; Figure 2 B in the figure represents the relative expression level of SlAAP8 gene by qRT-PCR in the SlAAP8 overexpression line (SlAAP8-OE) (with wild type WT as control 1), error bars represent the standard deviation (SD) of three biological replicates, and * represents p < 0.01 compared with WT (t test).

[0024] Figure 3 Effects of SlAAP8 on tomato pollen development and L-proline content: Figure 3 A in the figure indicates the detection of L-proline content in anthers of WT and transgenic lines; Figure 3 BO in the figure indicates the inflorescence phenotypes (scale bar: 200 μm), pollen semi-thin sections (toluidine blue staining, scale bar: 50 μm) and scanning electron microscope images (scale bar: 10 μm) of WT, SlAAP8-OE and slaap8-cr, as well as their pollen deformity rate and germination rate. * indicates p < 0.01 compared with WT (t test).

[0025] Figure 4 SlAAP8 has a wide range of amino acid transport capabilities: Figure 4A in the figure indicates that yeast complementation experiments showed that SlAAP8 could restore the growth ability of the 22Δ10α strain in a medium with alanine (Ala), isoleucine (Ile), leucine (Leu), phenylalanine (Phe), threonine (Thr), tyrosine (Tyr), valine (Val) and L-proline (Pro) as the sole nitrogen source, and the empty vector (EV) was the negative control; Figure 4 BC in the figure indicates the quantification of L-proline, valine, phenylalanine, alanine, leucine, threonine, tyrosine, and isoleucine contents in WT and slaap8-cr anthers by LC-MS.

[0026] Figure 5 Restoration of pollen fertility of slaap8-cr mutant by exogenous L-proline: Figure 5 A in the figure is a schematic diagram of greenhouse cultivation and anther collection after foliar spraying; Figure 5 BD in the figure represents the inflorescence phenotype of the slaap8-cr tomato mutant after exogenous application of L-proline; Figure 5 EG in the middle is anther development phenotype; Figure 5 HJ in the figure are microscopic images of pollen germination phenotype; Figure 5 KP in the figure is a microscopic image of pollen viability phenotype; Figure 5 Q in the figure indicates the comparison of pollen deformity rate of slaap8-cr mutant before and after foliar spraying; Figure 5 R in the figure indicates the comparison of pollen germination rate of slaap8-cr mutant before and after foliar spraying; Figure 5 The S in the figure indicates the comparison of L-proline content in anthers of the slaap8-cr mutant before and after foliar spraying. DETAILED DESCRIPTION

[0027] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0028] Example 1: Discovery and function prediction of S1AAP8 gene In order to analyze the genetic regulation mechanism of amino acid metabolism in tomato anthers, the applicant conducted targeted metabolomics measurement of L-proline content in anthers of 422 tomato materials collected worldwide, obtained metabolic data based on high performance liquid chromatography-mass spectrometry (HPLC-MS), and screened significant association sites using genome-wide association analysis (GWAS). Figure 1As shown in the figure, a SNP site with a very significant correlation with L-proline content was detected at 63.72 Mb on tomato chromosome 12 (P=6.87E-07). The candidate interval (63.432-63.839 Mb) was further locked by linkage disequilibrium (LD) analysis, and the only annotated amino acid transporter gene in this region was SlAAP8 (Solyc12g088190).

[0029] Example 2: Construction of S1AAP8 gene overexpression and CRISPR / Cas9 knockout vector In order to obtain the coding sequence of the SlAAP8 gene, the applicant planted the sequenced tomato variety MicroTom for one month, extracted the total RNA from the tomato leaves using TRIZOL reagent (Invitrogen) (the extraction method was in accordance with the instructions of the TRIZOL reagent), and reverse transcribed the RNA into cDNA using the reverse transcription kit Supermix (purchased from Beijing Quanshijin Company), the reaction conditions were: 42°C 30 min, 80°C 5 sec. Using the cDNA as a template, PCR amplification was performed using primers SlAAP8-F: aaaaagcaggcttaATGGCATCAGAATTTGAGAAG and SlAAP8-R: agaaagctgggtaTCAATCATGATCTTGAGGTTTG, and the full-length coding sequence of the SlAAP8 gene (1467 bp, see SEQ ID No. 1) was obtained. PCR reaction conditions: 94℃ pre-denaturation for 2 min; 98℃ 10 sec, 58℃ 30 sec, 68℃ 2 min, 35 cycles; 68℃ extension for 5 min. The amplified PCR product was connected to the pDonr207 entry vector through the BP reaction of Gateway cloning technology, and the positive clones were screened and sequenced to obtain the full-length cDNA of the SlAAP8 gene. Then, it was connected to the fruit-specific 35S promoter-driven overexpression vector pBI121 through the LR reaction of Gateway cloning technology and named PBI-SlAAP8.

[0030] The double target sites were searched in the exon region of the SlAAP8 reference genome sequence, SlAAP8-Target 1: TTGTCACTAGCATGGGCAA and SlAAP8-Target 2: TTTGTGGAATAGCTCAATA, and the forward primer for knocking out the SlAAP8 gene was designed to be ATATATGGTCTCGTTTGTTGTCACTAGCATGGGCAAGTTTTAGAGCTAGAAATAGC; the reverse primer was ATTATTGGTCTCGAAACTATTGAGCTATTCCACAAACAAACTACACTGTTAGATTC. The U6 promoter of pCBC-DT1T2 was used as a template for fragment amplification to obtain the target band; the vector pTX41 and the PCR product were connected at the Bsa Ⅰ restriction site using T4 ligase. Take 10 μL of the product and transfer it into E. coli / DH5α; use primers pTX41-F and pTX41-R for identification: the band size is 1198 bp; identify whether the vector is successfully constructed and sequence it with pTX41-F: AGCGGATAACAATTTCACACAGGA. After sequencing is correct, the CRISPR / Cas9 knockout vector of SlAAP8 is obtained.

[0031] Example 3: Genetic transformation and identification of S1AAP8 gene overexpression and CRISPR / Cas9 knockout vectors The steps of leaf disc transformation method are as follows: (1) Seed disinfection and germination: soak several seeds of tomato variety MicroTom in water for 3-4 h in advance, add 0.5% (w / v) sodium dichloroisocyanurate (NaDCC) to disinfect for 12 min in a sterile environment (protect from light), then pour out the water and add 75% ethanol to disinfect for 45 s. After rinsing with sterile water five times, transfer to germination medium ½ MS (containing 3% sucrose, pH 5.8) and culture in the dark at 25℃ for 7 days; (2) Explant preparation and pre-culture: select seedlings with two unfolded cotyledons, cut off the leaf tips and bases, inoculate with the back of the cotyledons facing up in the pre-culture medium, and culture in the dark at 25℃ for 48 h. (3) Agrobacterium infection and co-cultivation: Pick a single colony and inoculate it in YEB liquid medium (containing 50 mg / L kanamycin + 50 mg / L rifampicin), shake and culture at 28℃ and 200 rpm until OD600=0.6, centrifuge and resuspend in MS liquid medium (OD600=0.25); immerse the explant in the bacterial solution for 10 min, dry it with sterile filter paper and transfer it to co-culture medium (MS + 200 μM acetosyringone), and culture it in the dark at 25℃ for 48 h. (4) After co-cultivation, transfer the explant to the screening medium, and change the medium every 14 days until the callus differentiates into adventitious buds; cut 2-3 cm adventitious buds and inoculate them in rooting medium (½ MS + 0.1 mg / L IAA), and transplant them to nutrient soil after obtaining complete plants.

[0032] Molecular identification of transgenic plants: 1. DNA level verification: CTAB method was used to extract genomic DNA. First, 1.5×CTAB extraction solution was used to incubate in a 65℃ water bath for 30 min, then chloroform and isoamyl alcohol were added to separate the organic phase for extraction. Then, DNA was precipitated with anhydrous ethanol, washed with 75% ethanol, and dissolved in sterile water to obtain a DNA solution. (2) Vector-specific primers OJX487: 5'-CGCAAGACCCTTCCTCTATATAAG-3' and OJX488: 5'-TAAAACGACGGCCAGTGAATTCCC-3' were used for PCR amplification and identification. The PCR reaction conditions were: 94℃ pre-denaturation for 5 min; 94℃ 30 s, 60℃ 30 s, 72℃ 1 min, 35 cycles; 72℃ extension for 5 min. Then, agarose gel electrophoresis was performed to detect the presence of the target band.

[0033] 2. Verification of RNA level: The RNA extraction and reverse transcription method in Example 2 was used to extract total RNA from the leaves of the vector-transfected plants and the wild-type leaves to obtain cDNA; qPCR was used to determine the change in expression level: SYBR qPCR quantitative PCR detection kit (purchased from Vazyme) was used for qPCR detection (the method of use was according to the instructions of the above kit), and the real-time fluorescence quantitative PCR software Thermo Fisher Scientific QuantStudioTM 7 Pro Real-Time PCRSystem was used. The tomato Actin2 gene SlACT was used as the internal reference, and the detection primer sequences were SlAAP8-qRT-F: GTGCAACTTTGTGGAATAGCTCA; SlAAP8-qRT-R: CCGCGACTTTGGCTATTGAA; The 2-(∆∆Ct) method was used to calculate the relative expression level of SlAAP8 in the transgenic plants.

[0034] Preparation of reagents and culture media used in transformation: 1. Preparation of MS (Murashige & Skoog) liquid medium: 2.2 g MS powder, 30 g sucrose, dissolve in water, adjust pH to 5.8, dilute to 1 L, add 6 g L-1 agar powder. Autoclave at 121°C for 15 min.

[0035] 2. YEB medium: 1 g yeast powder, 5 g peptone, 5 g beef extract, 5 g sucrose, 4 g MgSO4·7H2O, dissolve in water, adjust pH to 7.4, and make up to 1 L. Add 15 g L-1 agar powder to the solid medium. Autoclave at 121°C for 15 min.

[0036] Test results: Figure 2 As shown, qRT-PCR showed that the expression level of SlAAP8 increased in the fruits of the two overexpressed plants, and the knockout of SlAAP8 in the mutant gDNA was identified by sequencing. The second target site of slaap8-cr-2 was missing; the first target site and the second target of slaap8-cr-13 were completely missing, and both mutant lines eventually led to the premature termination of SlAAP8 translation. Thus, positive plants with SlAAP8 overexpression (SlAAP8-OE) and mutation (slaap8-cr) were obtained, and the applicant named these two transgenic plants SlAAP8-OE and slaap8-cr.

[0037] Example 4: Amino Acid Detection and Pollen Phenotype Analysis of S1AAP8-OE and slaap8-cr Transgenic Materials 1. GUS staining: The 2,000 bp promoter of the SlAAP8 gene was cloned and integrated into the GUS vector, which was then transformed into Agrobacterium GV3101. Inflorescence and seedling tissues of ProAAP8::GUS plants were stained for β-glucuronidase (GUS). They were immersed in a staining solution containing 2% Triton X-100, 0.5 mol L-1 K4Fe(CN)6, 1 mMol L-1EDTA, 1 mMol L-1 K3Fe(CN)6, and 1 mg / mL X-gluc and incubated overnight at 37°C. Subsequently, the inflorescence tissues were immersed in anhydrous ethanol for 24 h at 4°C. The stained samples were then examined and photographed using a stereomicroscope and a high-power optical microscope (Zeiss, Germany).

[0038] 2. Semi-thin section examination: Inflorescences of WT, SlAAP8-OE-5,8, slaap8-cr-2,13, and proAAP8::GUS transgenic plants were preserved in FAA solution consisting of 50% ethanol, 38% formaldehyde, and acetic acid in a ratio of 18:1:1. The samples were dehydrated in graded concentrations from 70%, 95%, to 100% ethanol. After dehydration, the samples were embedded in resin and sectioned to a thickness of 0.2 to 0.6 μm. These sections were then examined microscopically using toluidine blue (GUS). Images of the stained sections were captured using an Axio Scope A1 microscope (Zeiss, Germany).

[0039] 3. SEM: Pollen grains were collected from WT plants and homozygous mutant plants slaap8-cr-2,13, SlAAP8-OE-5,8. High-resolution images were captured using a Verios G4 UC scanning electron microscope (Thermo Scientific, USA).

[0040] 4. Pollen germination analysis: Pollen grains of WT and SlAAP8-OE-5,8, slaap8-cr-2,13 transgenic plants were spotted on agar medium containing 5 mM Ca2+ and incubated at 25°C for 6 h and observed for statistical analysis of germination rate.

[0041] 5. Detection of amino acid content in tomato anthers: 0.5 g of tomato anther samples were harvested and crushed with liquid nitrogen. The material was then extracted with 70% methanol at 4°C, using a ratio of 1 fresh weight to 5 volumes of extraction solution for 12 hours. Subsequently, the mixture was centrifuged at 12,000 g and 4°C for 10 minutes. The supernatant was carefully collected using a syringe and filtered through a 0.2 μm filter. Finally, the amino acid content of the filtered extract was accurately determined using an Agilent 6495C triple quadrupole liquid chromatography-mass spectrometry (LC-MS). Samples were analyzed using low resolution. Metabolites were separated on a 100×2.1 mmi.d., 1.8 μm UPLC HSS T3 C18 column. The mobile phase consisted of 0.1% formic acid in water (phase A) and 5 mmol ammonium formate in acetonitrile (phase B). The gradient of solvent A:solvent B was 100−0, 0 min, 95:5, 2 min, 5:95, 12 min, 5:95, 13 min, 100:0, 13.1 min, 100:0 17.0 min. The injection volume was 2 μL, the flow rate was 0.35 mL / min, and the temperature was 40 °C.

[0042] Test results: Figure 3 As shown, compared with the WT male reproductive phenotype, the SlAAP8-OE-5,8 overexpression line showed no differences in anther development, anther size, pollen germination or pollen morphology. The anthers of the slaap8-cr-2,13 mutant line were significantly smaller; semi-thin section analysis revealed a large number of deformed pollen in the slaap8-cr-2,13 mutant line; scanning electron microscopy (SEM) confirmed that the frequency of pollen grain deformities in the slaap8-cr-2,13 mutant was significantly increased compared with the wild type, about 62% and 64%, respectively. Pollen germination experiments showed that the germination rate of wild-type pollen grains was as high as about 88%, while about 70% of the pollen grains of slaap8-cr-2 and slaap8-cr-13 did not germinate. LC-MS targeted metabolite analysis showed that the SlAAP8-OE-5,8 overexpression line contained more L-proline compared with the wild type, while the slaap8-cr-2,13 mutant line showed lower L-proline content levels.

[0043] Example 5: Yeast amino acid transport experiment Growth complementation assay was performed on yeast cells expressing the SlAAP8 gene. The 22Δ10α strain lacks the amino acid transporter and was transformed with the pESC-URA vector containing the SlAAP8-cDNA. The parental yeast strain 23344c (the wild-type counterpart of 22Δ10α) was used as a positive control. The 22Δ10α strain transformed with the empty pESC-URA (empty vector, EV) plasmid was used as a negative control. When the culture reached an optical density (OD) of 2.0 at 600 nm, the yeast cells were washed three times with ddH2O and diluted to OD values ​​of 1, 0.1, 0.01, and 0.001. Then, each 3 μL of yeast cells was spotted in yeast (YNB) medium with a single N source and the growth pattern was recorded after incubation at 30°C for 48 h.

[0044] Test results: Figure 4 As shown in the results, SlAAP8 has a wide range of amino acid transport capabilities. In addition to L-proline, it can also transport other amino acids, such as alanine (Ala), isoleucine (Ile), leucine (Leu), phenylalanine (Phe), threonine (Thr), tyrosine (Tyr) and valine (Val). Using LC-MS targeted metabolite analysis, by measuring the threonine content in the anthers of SlAAP8-OE-5,8 and slaap8-cr-2,13, it was found that the threonine content of SlAAP8-OE-5,8 was significantly increased, while slaap8-cr-2,13 showed the opposite phenotype; in addition, in addition to the significant decrease in the content of alanine, L-proline and threonine in the anthers of slaap8-cr-2,13, a decrease in the accumulation of isoleucine, leucine, phenylalanine, tyrosine and valine was also observed. In summary, SlAAP8 is a broad-spectrum amino acid permease that can transport a variety of amino acids in anthers.

[0045] Example 6: Spraying test of exogenous L-proline solution At the flowering stage of tomatoes, the flowers that have opened were removed. L-proline was dissolved in deionized water to prepare a 0.1% W / V L-proline solution. It was evenly sprayed on the adaxial and abaxial surfaces of tomato leaves. The tomatoes were cultured under greenhouse conditions for 7 days, the growth phenotypes of tomatoes were observed, and anther tissue samples were collected. The anther tissue was ground into fine powder in liquid nitrogen, and the amino acid content was extracted using a mixture of methanol and acetonitrile. Liquid chromatography-mass spectrometry (LC-MS) was used to quantify the content of each amino acid in pollen.

[0046] Test results: Figure 5As shown in the results, after exogenous L-proline treatment, the anther development phenotype of the slaap8-cr-2,13 mutant was significantly improved, as shown by the restoration of its anther volume to the wild-type level and a significant reduction in the incidence of deformed anthers. These morphological evidences indicate that L-proline treatment can effectively restore the male fertility of the slaap8-cr-2,13 mutant.

[0047] The present invention is described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0048] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0049] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0050] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0051] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principle of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departing from the disclosed scope in the application, and the changes made with conventional techniques known in the art.

Claims

1. Application of protein S1AAP8, characterized in that: The application is any of the following: A1) Application in regulating amino acid accumulation in plant anthers; A2) Application in regulating plant pollen fertility; A3) Application in the preparation of transgenic plants with increased pollen deformity rate; A4) Use in the preparation of male-sterile transgenic plants; The protein is any of the following: B1) a protein whose amino acid sequence is SEQ ID No. 2; B2) A fusion protein having the same function obtained by connecting a tag protein to the N-terminus and / or C-terminus of the protein in B1); The plant is a tomato plant.

2. The use according to claim 1, characterized in that: The amino acids include L-proline, alanine, isoleucine, leucine, phenylalanine, threonine, tyrosine and valine.

3. The use according to claim 2, characterized in that: The CDS sequence of the gene encoding the protein is shown in SEQ ID NO.

1.

4. Use of a biomaterial related to the protein of claim 1, characterized in that: The application is any of the following: C1) Application in regulating amino acid accumulation in plant anthers; C2) Application in regulating plant pollen fertility; C3) Application in preparing transgenic plants with increased pollen deformity rate; C4) Use in preparing male sterile transgenic plants; The biological material is any one of the following D1) to D7): D1) A nucleic acid molecule encoding the protein S1AAP8 according to claim 1; D2) an expression cassette containing the nucleic acid molecule described in D1); D3) a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) a recombinant microorganism containing the nucleic acid molecule described in D1), or a recombinant microorganism containing the expression cassette described in D2), or a recombinant microorganism containing the recombinant vector described in D3); D5) a transgenic plant cell line containing the nucleic acid molecule described in D1), or a transgenic plant cell line containing the expression cassette described in D2), or a transgenic plant cell line containing the recombinant vector described in D3); D6) transgenic plant tissue containing the nucleic acid molecule described in D1), or transgenic plant tissue containing the expression cassette described in D2); D7) a transgenic plant organ containing the nucleic acid molecule described in D1) or a transgenic plant organ containing the expression cassette described in D2); The plant is a tomato plant.

5. The use according to claim 4, characterized in that: The amino acids include L-proline, alanine, isoleucine, leucine, phenylalanine, threonine, tyrosine and valine.

6. A method for preparing a transgenic plant with increased pollen deformity rate or male sterility, characterized in that: The method comprises reducing the content and / or activity of the protein in claim 1 in the target plant, so that the L-proline content in the pollen is significantly reduced; the plant is a tomato plant.

7. The method according to claim 6, characterized in that The reduction of the content and / or activity of the protein of claim 1 in the target plant is achieved by reducing the expression level of the gene encoding the protein in the target plant.

8. The method according to claim 7, characterized in that The reducing the expression level of the gene encoding the protein in the target plant is to use gene knockout technology to reduce the expression level of the gene encoding the protein in claim 1 in the genome of the target plant.

9. The method according to claim 8, characterized in that The method of using gene knockout technology to reduce the expression level of the gene encoding the protein in claim 1 in the genome of the target plant is carried out using a gene knockout vector, and the method for constructing the gene knockout vector is as follows: S1 takes the coding gene as the target gene and designs the double target sites of the coding gene SlAAP8 -Target 1: TTGTCACTAGCATGGGCAA and SlAAP8 -Target 2: forward primer and reverse primer of TTTGTGGAATAGCTCAATA, use the forward primer and reverse primer to perform PCR amplification to obtain the target fragment; The base sequence of the forward primer is ATATATGGTCTCGTTTGTTGTCACTAGCATGGGCAAGTTTTAGAGCTAGAAATAGC; The base sequence of the reverse primer is ATTATTGGTCTCGAAACTATTGAGCTATTCCACAAACAAACTACACTGTTAGATTC; S2 connects the target fragment obtained in S1 to the plasmid to obtain a recombinant vector for gene knockout; S3: The recombinant vector obtained in step S2 is transferred into competent cells to obtain Escherichia coli containing the recombinant vector, namely, the gene knockout vector.

10. A method for restoring fertility of a male sterile plant line, characterized in that: The plant male sterile line is achieved by knocking out SlAAP8 Gene or silence SlAAP8 The expression activity of the gene is increased, so that the pollen is aborted during the development process; wherein the SlAAP8 The amino acid sequence of the gene is shown in SEQ ID NO.2; the method comprises: spraying 0.1% W / V L-proline solution on the leaves of the male sterile line of the plant; and the plant is a tomato plant.

Images