Application of tomato SlbHLH36 gene in regulation and control of tomato pollen development

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of an SlbHLH36 gene in regulation and control of tomato pollen development. A transgenic tomato plant slbhlh36-cr with SlbHLH36 gene mutation is obtained by utilizing a gene editing technology based on a CRISPR-Cas9 system, protein translation is terminated in advance, the content of L-proline in anther is remarkably reduced, and pollen malformation and abortion are caused; the content of L-proline in the anther of the overexpression plant SlbHLH36-OE is increased, pollen development is not abnormal, and the key effect of the SlbHLH36 gene in regulation and control of pollen development is further verified. The invention not only provides a new thought and experimental basis for molecular mechanism research of tomato pollen development, but also provides important technical means and theoretical support for creating a tomato male sterile line by using a gene editing technology, and has important breeding application value.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and specifically relates to tomato SlbHLH36 Application of genes in regulating tomato pollen development. Background Art

[0002] tomato( Solanum lycopersicum L . ) is an annual herbaceous plant of the Solanaceae family. It is a fruit and vegetable crop that is popular worldwide. It plays an important role in the diet with its unique flavor and rich nutrition. The genome is relatively simple, and it has rich genetic variation and a mature genetic transformation system. These characteristics make it an important model plant for plant biology research. In the entire growth and development process of tomatoes, pollen development is crucial. It directly determines whether the tomato can successfully complete pollination and fertilization, and thus affects the formation and yield of the fruit. Therefore, it is of great significance to explore the genes that regulate pollen development in tomatoes and to deeply analyze the molecular mechanism of tomato pollen development regulation.

[0003] L-proline plays a key role in plant pollen development. The accumulation of L-proline in pollen is closely related to pollen fertility. L-proline is not only the energy source for pollen development, but also provides the necessary osmotic regulating substances for pollen tube elongation. It has also been found in plants such as rice and Arabidopsis that abnormal expression of L-proline metabolism-related genes (such as P5CS, ProDH, etc.) can affect pollen development and function.

[0004] In view of this, identifying genes that regulate pollen development in tomatoes can provide a new theoretical basis for analyzing the molecular mechanism of tomato pollen development, lay the foundation for further research on the effects of L-proline on plant fertility, and provide important genetic resources and technical means for the creation of tomato male sterile lines. Summary of the invention

[0005] The purpose of the present invention is to locate a gene or protein that can regulate tomato pollen development by using L-proline content as a metabolic phenotype in combination with genome-wide association analysis for application in tomato molecular breeding.

[0006] Based on the above purpose, the present invention provides the following technical solutions: The first aspect of the present invention provides the use of protein SlbHLH36 in increasing the pollen deformity rate of plants, wherein the protein is any one of the following: A1) a protein having an amino acid sequence of SEQ ID No. 2; A2) A fusion protein having the same function is obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in A1).

[0007] The second aspect of the present invention provides the use of the gene encoding the above protein SlbHLH36 in preparing plants with increased pollen deformity rate.

[0008] The third aspect of the present invention provides the use of the gene encoding the above protein SlbHLH36 in preparing male sterile plants.

[0009] In the examples, the technicians of the present invention used PCR technology to amplify the CDS sequence of the gene encoding the above protein SlbHLH36 from tomato cDNA, as shown in SEQ ID NO.1.

[0010] The fourth aspect of the present invention provides a method for cultivating plants with increased pollen deformity rate or male sterility, using gene editing means to weaken or knock out the SlbHLH36 Gene, the SlbHLH36 The CDS sequence of the gene is shown in SEQ ID NO. 1. The specific operation steps are as follows: (1) SlbHLH36 The gene was the target gene, and the sgRNA sequence based on CRISPR / Cas9 was designed. The nucleotide sequence of the sgRNA action site was 5′-CAAGCTTCCATGATGAACC-3′; (2) connecting the DNA fragment containing the sgRNA sequence to the vector carrying CRISPR / Cas9; (3) Transforming the vector into plants to obtain SlbHLH36 Plants with missing gene function.

[0011] In the embodiment, the present technicians constructed an overexpression vector SlbHLH36-OE and CRISPR-Cas9 vectors and were genetically transformed. SlbHLH36 Genetically modified tomato plants slbhlh36-cr , protein translation terminated prematurely, the L-proline content in anthers decreased significantly, and pollen was deformed and aborted; overexpression plants SlbHLH36-OE The L-proline content in anthers was increased, and pollen development was normal, as shown by semi-thin section observation, stamen staining, scanning electron microscopy observation of pollen, and pollen germination experiments. slbhlh36-cr The pollen grains in the material are wrinkled, their activity decreases, and their fertility weakens. SlbHLH36-OE There was no significant difference between the pollen and wild type.

[0012] The fifth aspect of the present invention provides a plant breeding method, comprising the following steps: reducing the content of the above-mentioned protein SlbHLH36 in the target plant, resulting in a significant reduction in the L-proline content in the anther, thereby increasing the pollen deformity rate of the plant or making the plant male sterile.

[0013] Any of the above plants may be a plant of the genus Tomato.

[0014] Beneficial effects of the present invention: The present invention uses L-proline content as a metabolic trait and combines genome-wide association analysis to locate the SlbHLH36 Genes were found to affect the L-proline content in tomato anthers and participate in pollen development. By studying the effect of L-proline on tomato fertility, we can provide a scientific basis for increasing tomato yield, improving fruit quality, and enhancing stress resistance, such as developing practical agricultural technologies based on L-proline foliar fertilizers or growth regulators to solve the problem of yield loss caused by low pollen fertility. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Location of L-proline (L-Pro) related genes: Figure 1 A in the figure is the GWAS result diagram associated with L-proline content, and the red dotted line indicates the significance threshold (P = 6.87E-7); Figure 1 The B in SlbHLH36 ( Solyc05g006650 ) LD linkage heat map analysis.

[0016] Figure 2 for SlbHLH36 Tissue expression profiling analysis: Figure 2 A in the display SlbHLH36 It is expressed in roots, stems, leaves, flowers and fruits, with the highest expression level in flowers; Figure 2 B shows GUS staining SlbHLH36 Tissue expression patterns in flowers, scale bar = 25 μm.

[0017] Figure 3 Overexpression plants SlbHLH36-OE and gene-edited plants slbhlh36-cr Materials Construction: Figure 3 The A in SlbHLH36 The location of the gene edited and the type of mutation caused; Figure 3 B in the figure is the wild-type plant WT, and the overexpression plant SlbHLH36-OE and gene-edited plants slbhlh36-cr middle SlbHLH36 The relative expression of t Test comparing genotypes: ****, P < 0.0001.

[0018] Figure 4 The wild-type plants are WT, and the overexpression plants are SlbHLH36-OE and gene-edited plants slbhlh36-cr L-proline content and pollen development phenotype. Figure 4 A in the figure is the L-proline content in pollen of different transgenic materials; Figure 4 BD in the figure is the wild-type plant WT, and the overexpression plant SlbHLH36-OE and gene-edited plants slbhlh36-cr Flowering phenotype in normal growth; Figure 4 EG in the wild-type plant WT, overexpression plant SlbHLH36-OE and gene-edited plants slbhlh36- cr Semi-thin section images of anthers showing anther development phenotypes, scale bar = 50 μm; Figure 4 HJ in the figure is the wild-type plant WT, and the overexpression plant SlbHLH36-OE and gene-edited plants slbhlh36-cr Scanning electron microscopy (TEM) images of pollen structural features, scale bar = 10 μm; Figure 4 KM in the figure is the wild-type plant WT, and the overexpression plant SlbHLH36-OE and gene-edited plants slbhlh36-cr Pollen germination phenotype of , scale bar = 100 μm; Student's t Test comparing genotypes: ****, P < 0.0001.

[0019] Figure 5 For use with the Gateway system SlbHLH36 Gene required entry vector pDonr207- SlbHLH36 Plasmid maps.

[0020] Figure 6 For GUS staining vector pJC029-pHGWFS7- SlbHLH36 -Pro plasmid map.

[0021] Figure 7 For the overexpression vector PBI121- SlbHLH36 Plasmid maps.

[0022] Figure 8 For CRISPR-Cas9 vector pTX041- SlbHLH36 Plasmid maps. DETAILED DESCRIPTION

[0023] The following examples define the present invention and describe the invention in isolating clones comprising SlbHLH36 The DNA fragment of the complete coding region of the gene was used to obtain gene-edited and over-expressed plants through genetic transformation and verify the SlbHLH36 Regulate the accumulation of L-proline in pollen. This was subsequently verified by amino acid content detection, anther semi-thin section observation, stamen staining, pollen scanning electron microscopy observation, and pollen germination experiments. SlbHLH36The mutation will cause a significant reduction in L-proline content, pollen shrinkage and deformity, decreased fertility, and affect pollen development. Based on the following description and these implementation examples, those skilled in the art can determine the basic characteristics of the present invention, and without departing from the spirit and scope of the present invention, various changes and modifications can be made to the present invention to make it suitable for different uses and conditions. The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples, unless otherwise specified, were purchased from commercial channels.

[0024] Through genome-wide association analysis (mGWAS), we located tomato SlbHLH36 Gene and overexpression in tomato plants SlbHLH36-OE and CRISPR-Cas9 editing expression slbhlh36-cr , found tomato SlbHLH36 After the gene mutation, the accumulation of L-proline in the anthers was significantly reduced, the pollen was wrinkled, and the fertility decreased, confirming the application of this gene in regulating tomato pollen development.

[0025] Embodiment 1: SlbHLH36 Discovery and positioning The present invention technicians measured the metabolic profiles of 398 tomato materials from all over the world, performed statistical analysis on the measured data, and selected varieties with significant differences in L-proline biosynthesis for genome-wide association analysis. The results showed that there was a significant correlation between L-proline content and a loci on chromosome 5 ( Figure 1 A in the figure), and the SNPs near the leadSNP site are in a highly linked disequilibrium region (LD) ( Figure 1 B in FIG), indicating that there are candidate genes regulating L-proline in this region. Among these genes, the present invention technicians have found SlbHLH36 ( Solyc05g006650 ), speculated SlbHLH36 Genes may affect L-proline content ( Figure 1 A in ).

[0026] Embodiment 2: SlbHLH36 Isolation and expression pattern analysis right SlbHLH36Tissue expression profiling analysis required the use of TRIZOL reagent (purchased from Invitrogen) to extract total RNA from roots, stems, leaves, flowers, green-ripe fruits, and red-ripe fruits of normally grown tomatoes, reverse transcription of RNA into cDNA using the reverse transcription kit ToloScript All-in-one RT EasyMix for qPCR (purchased from Shanghai Tolo Biotechnology Co., Ltd.), and qPCR detection using 2xQ3 SYBR qPCR Master mix (Universal) (purchased from Shanghai Tolo Biotechnology Co., Ltd.) SlbHLH36 Expression level, using primers SlbHLH36 -qF:AGTTTCCACTAGCGGCAATG and SlbHLH36 -qR:AGGCTTTGCAGGTTGTTCTG, found SlbHLH36 It is expressed in roots, stems, leaves, flowers and fruits, with the highest expression level in flowers ( Figure 2 A in ).

[0027] SlbHLH36 The promoter sequence uses tomato DNA as a template. SlbHLH36 The gene promoter sequence is shown in SEQ ID NO.3. The DNA extraction method is to take 1 cm 2 The DNA was extracted from the leaves of about 1.5 × CTAB by heating and extracting. Chloroform and isoamyl alcohol were added to separate the organic phase. The DNA was precipitated with anhydrous ethanol and then washed with 75% ethanol. The DNA solution was obtained after dissolving with ddH2O. The primers were used. SlbHLH36 -Pro-F:AAAAAGCAGGCTTATGAATTCATATTCGTTCGATGTG, SlbHLH36 -Pro-R: AGAAAGCTGGGTACGGAGGGTCCAGTTACAGCT for PCR amplification. PCR reaction conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 1 min, 35 cycles; 72℃ final extension for 5 min. Fragments were recovered after agarose gel electrophoresis.

[0028] Through the Gateway system SlbHLH36 Promoter sequence construction pJC29-pHGWFS7 ( Figure 6), GUS transgenic materials were constructed by Agrobacterium-mediated leaf disc transformation, x-Gluc staining solution (Solarbio, G3061) was prepared according to the instructions, and appropriate amount of staining solution was added to the leaves and other tissues to be stained, so that the GUS staining solution completely immersed the tissue, and incubated at 37°C for 24 h. The sites or sites of GUS activity showed blue or blue spots. Then 70% ethanol was used to remove the chlorophyll of the sample, and the sample was stored in ethanol and observed with the naked eye or ordinary optical microscope. GUS staining analysis, SlbHLH36 The highest expression level is in flowers ( Figure 2 B in the figure).

[0029] Example 3: Construction SlbHLH36 Overexpression and gene editing vectors Using the cDNA in Example 2 as a template, primers SlbHLH36 -F: AAAAAGCAGGCTTAATGGATCCACAAGCTTCCATGATG and SlbHLH36 -R: AGAAAGCTGGGTATTATGTTGTTCTTTCAAAGCCTCCACC was amplified by PCR to obtain SlbHLH36 CDS sequence of the gene. PCR reaction conditions: 94℃ pre-denaturation for 5 min; 98℃ denaturation for 10 sec, 60℃ annealing for 30 sec, 68℃ extension for 2 min, 35 cycles; 68℃ final extension for 5 min. The amplified PCR product was connected to the pDonr207 entry vector through the BP reaction of Gateway cloning technology, transformed into Escherichia coli DH5α competent cells, and colony PCR was verified to obtain positive clones. The correct clones without mutations containing the candidate gene were obtained by sequencing (Haikou Qingke Biological Company). Subsequently, pDonr207- SlbHLH36 ( Figure 5 ) into the final vector PBI121 ( Figure 7 ).

[0030] At the same time, constructing gene editing slbhlh36-cr Vector ( Figure 8). First, the target site was found in the exon region of the reference genome sequence, and the target site sequence was: 5'-CAAGCTTCCATGATGAACC-3'; the primers for the selected target site were designed, the forward primer was the 19-nt N sequence before PAM (NGG), and the reverse primer was the reverse complement of the 19-nt N before the target site; then pCBC-DT1T2 was used as a template for fragment amplification, and the target gene identification band was 568 bp; the obtained 100 ng PCR product and 50 ng pTX041 were digested and ligated by enzyme (Golden Gate method) using Bsa Ⅰ-HFv2 and T4 ligase, and the total reaction system was 15 μL; then the reaction product was transferred into Escherichia coli DH5α; finally, pTX41-F: AGCGGATAACAATTTCACACAGGA and pTX41-R: GCAGGCATGCAAGCTTATTGG primers were used for identification: the band size was 1198 bp and sequenced using pTX41-F.

[0031] Embodiment 4: SlbHLH36 Genetic transformation with gene editing vectors and overexpression vectors The transgenic plants were obtained by Agrobacterium-mediated tomato genetic transformation system, which was introduced into the tomato variety MicroTom, and then pre-cultured, infected, co-cultured, screened for callus with kanamycin resistance, differentiated, rooted, transplanted, and identified. The genetic transformation was carried out by Wuhan Boyuan Biotechnology Co., Ltd.

[0032] The specific steps for positive identification of gene-edited transgenic materials are as follows: (1) DNA extraction: cut 1 cm 2 The DNA was extracted from leaves of about 1.5-2.5 mm in diameter by the CTAB method in Example 2. Then, agarose gel electrophoresis was performed, and the bands were sent to Haikou Qingke Biological Company for sequencing. The sequencing results were compared with the reference genome. If there was an insertion, deletion or mutation at the target site, it was successfully edited ( Figure 3 A in ).

[0033] Identification of overexpressing transgenic material: Extracted DNA, using screening marker genes NPTⅡ The primers NPTⅡ-F: GGTGCCCTGAATGAACTCC, NPTⅡ-R: AATATCACGGGTAGCCAACG were used to amplify the fragment. The presence of a band on agarose gel electrophoresis indicated that the vector had been transferred. The transcription level was then detected, and the total RNA of the plant was extracted and reverse transcribed. The RNA extraction, reverse transcription and qPCR in Example 1 were used to determine the expression level changes. The real-time fluorescence quantitative PCR software Quant studio TM was used to measure the expression level of tomato. Ubiquitin3 The gene was used as the internal reference, and the detection primer sequence was SUB-qRT-F: GCCAAAGAAGATCAAGCACA, SUB -qRT-R: TCAGCATTAGGGCACTCCTT, using the ΔΔCt method to calculate the expression of SlbHLH36 The relative expression level of the overexpression plant was obtained, and the identification was completed ( Figure 3 B in the figure).

[0034] Embodiment 5: slbhlh36-cr and SlbHLH36-OE Metabolite detection and pollen phenotype analysis of transgenic materials For wild type (WT), bHLH36-OE , bhlh36-cr LC-MS targeted metabolite analysis was performed on the anthers of the mutants, and it was found that the L-proline content was significantly increased in the overexpression strain, but significantly decreased in the mutant ( Figure 4 A in ). SlbHLH36 The expression of is crucial for tomato pollen morphogenesis and male fertility development, and it may be involved in regulating the accumulation of L-proline in tomato anthers. The extraction and detection of amino acids were carried out according to the following scheme: Extraction and detection of amino acids from tomato anthers: 0.5 g of tomato anthers were ground with liquid nitrogen and extracted with 70% methanol (1:5, w / v) at 4°C for 12 h. The extract was centrifuged at 4°C and 12,000 g for 10 min, and the supernatant was filtered through a 0.2 μm filter membrane. The amino acid content in the filtrate was determined using an Agilent 6495C triple quadrupole liquid chromatography-mass spectrometer (LC-MS) (Table S3). Chromatographic separation was performed on a 100 × 2.1 mm, 1.8 μm UPLC HSS T3 C18 column (Waters Acquity), with a mobile phase of 0.1% formic acid in water (phase A) and 5 mmol ammonium formate in acetonitrile (phase B), and a gradient elution program of 100% A at 0 min, 95% A at 2 min, 5% A at 12 min, 5% A at 13 min, 100% A at 13.1 min, and 100% A at 17 min; injection volume 2 μL, flow rate 0.35 mL / min, column temperature 40°C. Mass spectrometry detection was performed in dynamic multiple reaction monitoring (dMRM) mode with positive ion scanning. The main parameters were as follows: gas temperature 200°C, gas flow rate 14 L / min; nebulizer pressure 35 psi; sheath gas temperature 250°C, sheath gas flow rate 11 L / min; capillary voltage 4000 V; nozzle voltage 500 V; high RF voltage 150 V; and low RF voltage 60 V.

[0035] The phenotypes of transgenic and wild-type pollen were observed by semi-thin section observation and stamen staining, scanning electron microscopy observation of pollen, and pollen germination analysis. slbhlh36-cr The anthers of the mutant were significantly smaller ( Figure 4 B in Figure 4 C in Figure 4 Semi-thin sections show a large number of pollen grains collapsed (D). Figure 4 E in Figure 4 F in Figure 4 G), scanning electron microscopy further confirmed slbhlh36-cr The mutants had higher frequencies of deformed and / or collapsed pollen grains ( Figure 4 H in Figure 4 I in Figure 4 J in the figure), pollen germination experiments showed that these deformed pollen grains were sterile and their germination rate was significantly lower than that of the wild type ( Figure 4 K in Figure 4 L in Figure 4 The pollen of M showed significant sterility, while SlbHLH36-OE There is no significant difference with the wild type, indicating SlbHLH36 Gene mutations affect pollen fertility.

[0036] The specific experimental operations are as follows: Semi-thin section observation and stamen staining: wild type (WT), bHLH36-OE , bhlh36-cr The inflorescences of transgenic plants were fixed in FAA solution (50% ethanol: 38% formaldehyde: acetic acid = 18:1:1). After dehydration in 70%, 95% and 100% ethanol gradient, the samples were embedded in Technovit resin and the slice thickness was 0.2-0.6 μm. After the slices were stained with toluidine blue, they were observed and photographed using an AxioScope A1 microscope (Zeiss, Germany).

[0037] Scanning electron microscopy observation: wild type (WT), bHLH36-OE , bhlh36-cr -4 The pollen of transgenic plants was evenly adhered to the conductive tape, and high-resolution images were taken using a Verios G4 UC scanning electron microscope (Thermo Scientific, USA).

[0038] Pollen germination analysis: wild type (WT), bHLH36-OE , bhlh36-cr The pollen of transgenic plants was inoculated on a low melting point agar medium containing 5 mM Ca²⁺ and cultured at 25°C for 6 h. The pollen germination was observed and the germination rate was statistically analyzed.

[0039] The present invention is described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0040] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0041] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0042] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0043] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principle of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departing from the disclosed scope in the application, and the changes made with conventional techniques known in the art.

Claims

1. The application of protein SlbHLH36 in increasing the pollen deformity rate of plants, characterized in that: The protein meets the following conditions: A1) a protein having an amino acid sequence of SEQ ID No. 2; A2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in A1); The plant is a tomato plant.

2. Use of a gene encoding protein SlbHLH36 in preparing transgenic plants with increased pollen deformity rate; the protein SlbHLH36 is the protein SlbHLH36 described in claim 1; the plant is a tomato plant.

3. The use according to claim 2, characterized in that: The CDS sequence of the gene encoding the protein SlbHLH36 is shown in SEQ ID NO.

1.

4. Use of a gene encoding protein SlbHLH36 in preparing male-sterile transgenic plants; the protein SlbHLH36 is the protein SlbHLH36 described in claim 1; and the plant is a tomato plant.

5. The use according to claim 4, characterized in that: The CDS sequence of the gene encoding the protein SlbHLH36 is shown in SEQ ID NO.

1.

6. A method for cultivating transgenic plants with increased pollen deformity rate or male sterility, characterized in that: Using gene editing to weaken or knock out SlbHLH36 Gene, to obtain plants with increased pollen deformity rate or male sterility; SlbHLH36 The CDS sequence of the gene is shown in SEQ ID NO. 1; the plant is a tomato plant.

7. The method according to claim 6, characterized in that The method comprises the following steps: by SlbHLH36 The gene is the target gene, and the sgRNA sequence based on CRISPR / Cas9 is designed; Connecting the DNA fragment containing the sgRNA sequence to the vector carrying CRISPR / Cas9; The vector is introduced into plants to obtain SlbHLH36 Plants with missing gene function.

8. The method according to claim 7, characterized in that The nucleotide sequence of the sgRNA action site is 5'-CAAGCTTCCATGATGAACC-3'.

9. A plant breeding method, characterized in that: The method comprises the following steps: reducing the content of protein SlbHLH36 in target plants, thereby increasing the pollen deformity rate of the plants; the protein SlbHLH36 is the protein SlbHLH36 described in claim 1; and the plants are plants of the genus Tomato.

10. A plant breeding method, characterized in that: The method comprises the following steps: reducing the content of protein SlbHLH36 in target plants, thereby making the plants male sterile; the protein SlbHLH36 is the protein SlbHLH36 described in claim 1; and the plant is a tomato plant.

Images