A detection antibody, antibody pair, application and kit for anti-chicken IFN-γ protein

Abstract

The present invention belongs to the biological field and discloses a detection antibody against chicken IFN-γ protein. The detection antibody contains a heavy chain variable region and a light chain variable region. The amino acid sequence of the heavy chain variable region of the monoclonal antibody is as shown in SEQ ID No. 3, and the amino acid sequence of the light chain variable region of the monoclonal antibody is as shown in SEQ ID No. 4. Under the same conditions of capture antibody, this detection antibody has a strong binding ability to chicken IFN-γ at different concentrations. Especially when used in combination with a specific coating antibody, it has excellent adaptability. At the same time, the present invention also provides a pair of antibodies for detecting chicken interferon or duck interferon, as well as the applications of the above-mentioned IFN-γ detection antibody and the pair of antibodies.

Description

Technical Field

[0001] The present invention relates to the field of biology, and specifically to a detection antibody, antibody pair, application and kit for chicken IFN-γ protein. Background Art

[0002] In the field of avian infectious diseases, such as avian infectious diseases with persistent infection and immunosuppression, humoral immunity is often insufficient to provide complete protection, and CD8 + cytotoxic T cells are required to participate in clearing the infection. Chicken interferon-gamma (chIFN-γ), as a key cytokine in the chicken immune system, is produced by activated T cells and NK cells. It can activate macrophages, enhance the cytotoxicity of natural killer cells, and promote the proliferation and differentiation of T cells and B cells, playing an indispensable role in processes such as immune regulation, antiviral infection, and tumor surveillance. Its abnormal expression is closely associated with various infectious diseases in chickens infected with intracellular bacteria or viruses. Therefore, in-depth research on chIFN-γ helps to clarify the action characteristics and internal mechanisms of the chicken body's immune system, which is of great significance in the prevention and treatment of avian diseases. At the same time, detecting the level of IFN-γ can reflect the cellular immune status of the body and the activation of antigen-specific T cells, which is important for aspects such as immune mechanism research, immune function analysis, and evaluation of cellular immune levels after vaccination.

[0003] Through modern immunological techniques, various detection methods such as ELISA, enzyme-linked immunospot assay (ELISPOT), and immunohistochemistry can be established for precise detection of ChIFN-γ. These immunological detections of IFN-γ rely on monoclonal antibodies (mAbs) or antibody pairs with high specificity and high affinity. Although there are many reports on chIFN-γ monoclonal antibodies, the examples of their application in immunological detection are limited, and there is a lack of high-quality detection methods and products. Compared with murine monoclonal antibodies, it is easier to screen out antibodies with high affinity from rabbits. The affinity of rabbit monoclonal antibodies for the target antigen is 100-1000 times that of murine therapeutic antibodies, and they can bind to the target protein with high specificity. At the same time, based on the specificity of the surface antigen of B lymphocytes, using flow sorting technology, through multi-channel fluorescence sorting, single B lymphocytes producing antigen specificity can be accurately obtained. These single B lymphocytes obtained by sorting have the advantage of natural heavy and light chain pairing, which is superior to the traditional mAb preparation method.

[0004] To determine monoclonal antibodies or antibody pairs in immunological detection methods, it is necessary to clarify the affinity between antibodies and antigens and the differences in binding sites, which plays a crucial role in improving the sensitivity and accuracy of immunoassays and developing new immunotherapeutic means. Biolayer interferometry (BLI) is a label-free analytical detection technique for rapid detection of biomolecules based on optical interference signals. When biomolecules form a biofilm at the end of the sensor and bind to the analyte, it will change the thickness of the biofilm, thereby affecting the optical interference signal, and thus analyzing the analyte molecule. This technique can analyze affinity in real time and label-free, with accurate results and high sensitivity, and is widely used in fields such as life sciences and drug research and development, and can be used for drug target screening, protein-protein interaction research, and epitope analysis.

[0005] In this field, it is very challenging to develop detection antibodies and coating antibodies with high adaptability and good detection effects, especially the development of detection antibodies is particularly difficult.

[0006] Related antibody development techniques can be referred to:

[0007] Literature 1: "Preparation and Identification of the Recognition Region of Monoclonal Antibodies Against Chicken IFN-γ", by Liu Yanan et al., Chinese Veterinary Science 2017, 47(06): 721 - 726;

[0008] Literature 2: "Prokaryotic Expression of Chicken γ-Interferon and Preparation and Identification of Its Monoclonal Antibodies", by Cui Jinqiang et al., China Animal Husbandry & Veterinary Medicine 2024, 51(7): 3008 - 3019;

[0009] Both of the above two literatures mention the development of antibodies suitable for chicken γ-interferon; among them, Literature 1 developed multiple monoclonal antibodies with different recognition sites, and the affinity (dissociation constant) measured by the indirect ELISA method was up to 7.35×10 -10 ; Literature 2 developed an antibody pair, and the one with the largest P / N value was 5A10 (capture antibody) and HRP-5A10 (labeled antibody), and its affinity (dissociation constant) was up to 1.04 nmol / L, which is 1.04×10-9 mol / L after conversion.

[0010] For those skilled in the art, it is quite difficult to screen out capture antibodies and labeled antibodies at one time, and it is even more difficult to screen out antibody pairs with particularly good detection effects; the main manifestations are as follows:

[0011] 1. The detection effect is closely related to the affinity. The better the affinity, the better the detection sensitivity;

[0012] 2. The capture antibody and the labeled antibody preferably have different recognition epitopes to improve the antigen capture ability;

[0013] 3. Antibody pairs with different recognition epitopes do not absolutely show good results, which is related to the position of the recognition epitopes of the antigen, the higher-order spatial structure of the antibody-antigen binding, etc. The differences in this matching were confirmed in the subsequent experiments of the present invention;

[0014] As can be seen from the above-mentioned Document 1 and Document 2, Document 1 only developed antibodies at different sites and did not verify antibody pairs; Document 2 developed antibody pairs. In terms of the P / N value, the same antibody pair has the best effect, and Document 2 did not conduct epitope verification;

[0015] Therefore, judging from the descriptions in Document 1 and Document 2, it is relatively difficult to develop antibody pairs with good detection effects. At the same time, from the research progress of this project, the development of detection antibodies is even more crucial. Summary of the Invention

[0016] The purpose of the present invention is to provide a detection antibody against chicken IFN-γ (chIFN-γ) protein. Under the condition of the same capture antibody, this detection antibody has a strong binding ability to different concentrations of chIFN-γ. Especially when used in combination with a specific coating antibody, it has excellent adaptability.

[0017] At the same time, the present invention also provides a group of antibody pairs for detecting chicken interferon or duck interferon, as well as the applications of the above-mentioned detection antibody and antibody pairs.

[0018] The antibody pair of the present invention is obtained by screening based on the same method, and there is no competitive relationship between the antibody pairs. Especially when detecting duck interferon, it performs far better than foreign antibodies.

[0019] To achieve the above purpose, the present invention provides the following technical solutions:

[0020] A detection antibody against chIFN-γ protein, the detection antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the monoclonal antibody is as shown in SEQ ID No.3; the amino acid sequence of the light chain variable region of the monoclonal antibody is as shown in SEQ ID No.4.

[0021] At the same time, the present invention also discloses a group of antibody pairs for detecting chicken interferon or duck interferon, the antibody pair is composed of a coating antibody and a detection antibody; the detection antibody is as described above; the coating antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the monoclonal antibody is as shown in SEQ ID No.1; the amino acid sequence of the light chain variable region of the monoclonal antibody is as shown in SEQ ID No.2.

[0022] The technical advantages of the present invention are:

[0023] 1. The antibody titer is high, and the minimum titer of the three antibodies is higher than 1:819,200;

[0024] 2. The antibody affinity is strong, and the order of magnitude of the lowest affinity has reached 10 -12 , especially the affinity of Ab-56 antibody is higher, and the KD value is less than 10 -12 ;

[0025] 3. Ab-56 of the present invention recognizes different epitopes from Ab-38 and Ab-68; the Figure 10 of the present invention proves that although the epitopes are different (Ab-56, Ab-38), it is also impossible to achieve high-precision detection, indicating that the difference in epitopes is an important factor in improving the detection effect, but not the only determining factor;

[0026] The above three factors are the reasons why the antibody pairs of the present invention show significant advantages compared with other similar antibodies or antibody pairs in the prior art;

[0027] 4. Compared with foreign antibodies, the antibody pairs of the present invention show obvious advantages in the detection of duck PBMC, which further illustrates the advantages of the detection antibody Ab-68 of the present invention.

[0028] In addition, the present invention also discloses the use of the detection antibody or the antibody pair as described above for preparing a kit for detecting chicken interferon or duck interferon.

[0029] Finally, the present invention also discloses a kit for detecting chicken interferon or duck interferon, which contains the detection antibody or the antibody pair as described above.

[0030] Compared with the prior art, the beneficial effects of the present invention are:

[0031] 1. Under the condition of the same capture antibody, the detection antibodies of the present invention have strong binding ability to different concentrations of chicken IFN-γ. Especially when used in combination with a specific coating antibody, they have excellent adaptability;

[0032] 2. The detection antibodies prepared by the present invention also have strong binding ability to duck interferon.

[0033] 3. The antibody pairs of the present invention are screened based on the same method, and there is no competitive relationship between the antibody pairs. Especially when detecting duck interferon, they perform far better than foreign antibodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 It is the plasmid map of the prokaryotic expression vector pET21b-chIFN-γ in Example 1 of the present invention;

[0035] Figure 2SDS-PAGE gel electrophoresis pattern of the prokaryotic-expressed recombinant chIFN-γ protein in Example 1 of the present invention;

[0036] Figure 3 Plasmid map of the eukaryotic expression vector pRK5-chIFN-γ plasmid in Example 2 of the present invention;

[0037] Figure 4A Plasmid map of the rabbit-derived anti-chIFN-γ monoclonal antibody expression vector carrying the antibody heavy chain constructed in Example 3 of the present invention;

[0038] Figure 4B Plasmid map of the rabbit-derived anti-chIFN-γ monoclonal antibody expression vector carrying the antibody light chain constructed in Example 3 of the present invention;

[0039] Figure 5 Result diagram of detecting anti-chIFN-γ rabbit-derived monoclonal antibody by ELISA in Example 3 of the present invention;

[0040] Figure 6 SDS-PAGE gel electrophoresis pattern of the anti-chIFN-γ rabbit-derived monoclonal antibody expressed in Example 3 of the present invention;

[0041] Figure 7A Titration test results of 3 monoclonal antibodies and foreign antibodies;

[0042] Figure 7B Test results of the affinity of 3 monoclonal antibodies and foreign antibodies determined by ELISA method;

[0043] Figure 8 Determination of the affinity of monoclonal antibody and chIFN-γ by BLI method in Example 5 of the present invention;

[0044] Figure 9 Result diagram of determining the steric hindrance between different monoclonal antibodies by BLI method in Example 5 of the present invention;

[0045] Figure 10 Result diagram of screening monoclonal antibody combinations in Example 7 of the present invention;

[0046] Figure 11 Result diagram of screening the optimal coating antibody concentration and chromogenic solution in Example 7 of the present invention;

[0047] Figure 12 Result diagram of screening the optimal concentration of biotin-labeled detection antibody in Example 7 of the present invention;

[0048] Figure 13 Result diagram of screening the optimal concentration of HRP-labeled streptavidin in Example 7 of the present invention;

[0049] Figure 14 This is the result graph of detecting duck interferon by ELISPOT in Example 8 of the present invention. Detailed implementation manners

[0050] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0051] Example 1

[0052] A method for prokaryotic expression of recombinant chIFN-γ protein is operated as follows:

[0053] Take the spleen of 6-8-week-old chickens, extract RNA from chicken spleen cells using the RNA extraction kit (product number R411102) of Magen Company, and then use the Solebao reverse transcription kit (M-MLV, product number 2641Q) with oligo-dT primers to reverse transcribe to generate cDNA for PCR amplification of the chIFN-γ gene. The PCR amplification primer sequences are:

[0054] chIFN-γ-F (GCGCCATATGCTAAATCTTGTTC, SEQ ID NO.14);

[0055] chIFN-γ-R (GGCCTCGAGGCAATTGCATCTCCTCTG, SEQ ID NO.15);

[0056] The PCR reaction system contains 4 μL of cDNA, 1 μL of forward primer (10 mM), 1 μL of reverse primer (10 mM), 6.5 μL of ddH2O, and 12.5 μL of 2 × Phanta Max Master Mix (Dye Plus) (Novoprotein, product number P525). The PCR program is pre-denaturation at 95°C for 5 min, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 60 s, 30 cycles, extension at 72°C for 5 min and then maintained at 4°C. The amplified band size is 450 bp, which is the chIFN-γ protein sequence without the signal peptide, and the sequencing result is consistent with the chIFN-γ gene (X99774.1) registered in GenBank.

[0057] Using Nde I (product number R0111V) purchased from NEB Company and XhoI (Catalog No. R0146V) was used to double-digest the PCR-amplified chIFN-γ gene and the pET21b(+) vector stored in the laboratory, and then ligated with the T4 ligase (Catalog No. M0202V) from NEB to construct the prokaryotic expression plasmid pET21b-chIFN-γ. This plasmid has a 6×His tag at the C-terminus of the chIFN-γ gene for protein purification (the plasmid map is shown in Figure 1).

[0058] The pET21b-chIFN-γ plasmid was added to an EP tube containing BL21DE3 competent cells (Beyotime, Catalog No. C1400), gently mixed, and then incubated on ice for 30 min, heat-shocked in a 42°C water bath for 45 s, and then incubated on ice for 2 min. 500 μL of LB antibiotic-free solution was added, and the cells were cultured in a shaker at 37°C and 220 rpm for 45 min. 150 μL of the bacterial solution was taken and spread on an ampicillin LB solid medium, and then cultured upside down at 37°C overnight. Five single colonies were picked and inoculated into 1 mL of ampicillin LB culture medium, and cultured in a shaker at 37°C for 4 - 6 h. Using the bacterial solution as a template, bacterial solution PCR was performed with the chIFN-γ gene amplification primers, and the positive bacterial solution was sent for sequencing.

[0059] The bacterial solution with correct sequencing was inoculated into 10 mL of ampicillin LB culture medium at a ratio of 1:100 for overnight activation. The next day, it was transferred to 200 mL of ampicillin LB culture medium at a ratio of 1:50 and cultured at 37°C and 200 rpm until the OD 600 nm was approximately 0.6 - 0.8. IPTG was added to a final concentration of 0.5 mM, and the cells were induced at 37°C and 200 rpm for 8 h. The bacterial solution was collected and centrifuged, resuspended in PBS, sonicated to release the protein, and the supernatant was taken by centrifugation. It was purified according to the instructions of the GenScript NI affinity chromatography column (Catalog No. L00250), impurities were removed with 100 mM imidazole, and elution was performed with 200 mM imidazole. A total of 10 mg of prokaryotically expressed soluble chIFN-γ protein was obtained (the SDS-PAGE gel electrophoresis pattern is shown in Figure 2 )

[0060] Example 2

[0061] A eukaryotic expression method for preparing recombinant chIFN-γ protein is as follows:

[0062] Insert the amplified chIFN-γ gene in Specific Example 1 into the commercial vector pRK5 stored in the laboratory, and construct the eukaryotic expression plasmid pRK5-chIFN-γ according to the method in Example 1 (refer to Figure 3). Transform the constructed plasmid into Trans5α Escherichia coli competent cells (purchased from Beijing TransGen Biotech Co., Ltd.), and identify positive monoclonal clones with correct sequences through colony PCR and sequencing. Inoculate the positive monoclonal clones into a test tube containing 20 mL of ampicillin LB culture medium at a ratio of 1:100, and culture overnight at 37°C and 200 rpm. Collect the bacterial solution and extract the plasmid using an endotoxin-free plasmid extraction kit (OMEGA, product number D694302).

[0063] Two to three hours before transfection, inoculate 200 mL of HEK293F cells into a sterile shake flask at a density of 2×10 6 / mL. Add 300 μg of plasmid DNA to 20 mL of fresh medium, mix well, then add 900 μL of PEI transfection reagent (Qihang Liye, product number BYPS-24765), mix well and let stand for 10 - 20 minutes to form a DNA-PEI complex, and then evenly add it to the transfection shake flask. Detect protein expression 60 - 72 hours after transfection.

[0064] Since the chIFN-γ protein is well-expressed in the cell supernatant, purify it according to the instructions of the NI affinity chromatography column (GenScript, product number L00250) to obtain 2 mg of protein. Then label the purified chIFN-γ according to the FITC labeling kit (Beyotime, product number P0639M) and use it as an antigen for sorting chIFN-γ-specific single B cells.

[0065] Example 3

[0066] The preparation of chIFN-γ-specific monoclonal antibodies using flow cytometry sorting technology is as follows:

[0067] Select healthy adult New Zealand white rabbits weighing more than 2 kg. Mix 1 mL of the recombinant chIFN-γ protein expressed prokaryotically containing 500 μg with an equal volume of Freund's complete adjuvant (Sigma), emulsify it, and immunize the rabbits subcutaneously at multiple points on both sides of the spine. Immunize for the second time two weeks later, and use incomplete Freund's adjuvant (Sigma) subsequently, with the same method and dosage as the first time. Eight days after each immunization, collect 1 mL of blood from the marginal ear vein to separate the serum, and detect the antibody titer by ELISA until the antibody titer is greater than 10 6 when the immunization ends.

[0068] For flow cytometry sorting of rabbit spleen B lymphocytes to screen out chIFN-γ-specific single B cells, rabbit spleen lymphocytes were isolated using a PBMC isolation kit (Solarbio, catalog number P8760), resuspended in ice-cold FACS buffer, and the cell concentration was adjusted to 10 6 cells / mL. 10 µg of phycoerythrin (PE)-labeled goat anti-rabbit secondary antibody (abcom, catalog number ab72465) and 20 µg of the eukaryotic-expressed recombinant chIFN-γ protein prepared in Example 2 labeled with BV421 were added sequentially, and incubated on ice for 30 minutes to allow the markers to fully bind to the cell surface antigen receptors.

[0069] After labeling was completed, the cells were centrifuged at 400 g for 10 minutes, resuspended in ice-cold FACS buffer, and washed 3 times, and the volume was adjusted to 500 µL of FACS buffer, then transferred to a sterile flow cytometry tube and placed on ice. The conditions were optimized on a flow cytometer, the sorting gate and flow rate were set, and with the aid of the sorting system, the PE + BV421 + -positive cells were sorted into a 96-well PCR plate containing reverse transcriptase and lysis buffer. Such cells are chIFN-γ-specific single B lymphocytes.

[0070] The single specific single B cells in the 96-well PCR plate were lysed at room temperature, and the heavy and light chain variable region mRNAs were reverse transcribed into cDNA templates using oligo-dT primers. Two rounds of nested PCR were performed using primers provided by Yantai Teke Biotechnology Co., Ltd. to obtain the heavy and light chain variable region DNA genes of the antibody. The VH and VL amino acid sequences were obtained by sequencing the amplification products. The selected VH and VL genes were respectively cloned into plasmid expression vectors (pTT5CH, pTT5CL) with heavy and light chain constant regions, inserted upstream of the CH and CL genes, to obtain light and heavy chain gene expression vectors. The vectors contain elements such as an IL-2 secretion signal peptide (SEQ ID No.7: MYRMQLLSCIALSLALVTNS), a leader sequence, a promoter sequence, a poly(A) sequence, the heavy chain constant region (CH) and light chain constant region (CL) genes of a rabbit monoclonal antibody, etc. The vector maps are shown in Figure 4A and Figure 4B . The constructed vectors were transformed into Trans5α Escherichia coli competent cells to prepare sufficient plasmids for subsequent transfection and expression.

[0071] 1 μg of the plasmid containing the heavy and light chain genes was transferred into HEK293T cells in a 24-well plate at a ratio of 1:1. The cells expressed the heavy and light chains and assembled into a complete antibody structure and were released into the culture medium. After culturing for 60 - 72 hours, the supernatant contained the recombinant rabbit monoclonal antibody that could recognize chIFN-γ. By Figure 5It can be seen that 27 out of the supernatants of 96 cells were chIFN-γ positive. After removing non-specific reactive B lymphocytes, 8 chIFN-γ-specific single B lymphocytes were obtained, and the antibodies produced by them were named Ab-6, Ab-24, Ab-38, Ab-48, Ab-56, Ab-66, Ab-68, and Ab-75 respectively. The three strains with the highest affinity (Ab-38, Ab-56, and Ab-68 antibodies) were selected for subsequent experiments, and their variable region amino acid sequences are as follows:

[0072] For the Ab-56 antibody, the amino acids in the heavy chain variable region are as shown in SEQ ID No.1, and the amino acids in the light chain variable region are as shown in SEQ ID No.2. The full-length amino acid sequence of its heavy chain is as shown in SEQ ID No.8, and the full-length amino acid sequence of its light chain is as shown in SEQ ID No.9;

[0073] For the Ab-68 antibody, the heavy chain variable region is as shown in SEQ ID No.3, and the light chain variable region is as shown in SEQ ID No.4. The full-length amino acid sequence of its heavy chain is as shown in SEQ ID No.10, and the full-length amino acid sequence of its light chain is as shown in SEQ ID No.11;

[0074] For the Ab-38 antibody, the heavy chain variable region is as shown in SEQ ID No.5, and the light chain variable region is as shown in SEQ ID No.6. The full-length amino acid sequence of its heavy chain is as shown in SEQ ID No.12, and the full-length amino acid sequence of its light chain is as shown in SEQ ID No.13.

[0075] Referring to the method in Example 2, the above three monoclonal antibodies were highly expressed using HEK293F cells. The monoclonal antibodies were purified from the supernatant using protein A affinity gel resin, and the antibody expression was identified by SDS-PAGE gel electrophoresis. The results are as Figure 6 shown. Obvious bands were observed at 55KDa and 25KDa for all antibodies, indicating successful antibody expression. The antibodies were concentrated to 1 mg / mL using a 30 kDa concentrator tube and aliquoted and stored frozen at -20°C in the refrigerator for later use.

[0076] Example 4

[0077] The binding ability of the prepared monoclonal antibodies to chIFN-γ was measured by ELISA, and the operation was as follows:

[0078] The prokaryotically expressed chIFN-γ protein was diluted to 1 μg / ml with PBS and coated on a 96-well ELISA plate at 100 μL / well overnight at 4°C. The plate was washed 3 times with 200 μL of PBST for 3 minutes each time. Then, 200 μL of PBS containing 5% skim milk was added to each well and incubated at 37°C for 2 h for blocking. The plate was washed again 3 times with 200 μL of PBST for 3 minutes each time. The antibody to be tested was added at 100 μL / well in a 2-fold gradient (starting from 1:400) and incubated at 37°C for 1 h. The plate was washed 3 times with 200 μL of PBST for 3 minutes each time. The HRP-labeled goat anti-rabbit IgG antibody was diluted 1:5000 with PBS containing 2.5 wt% skim milk powder, and 100 μL was added to each well and incubated at 37°C for 1 h. The plate was washed 3 times with 200 μL of PBST for 3 minutes each time. 100 μL of commercial TMB chromogenic solution was added to each well, and after reacting in the dark at room temperature for 15 min, 50 μL of 2M H2SO4 was added to terminate the reaction, and the OD 450nm absorbance value was read with an enzyme-linked immunosorbent assay reader.

[0079] The foreign antibody (MT7C10) was used as a positive control and operated according to the same steps, but the secondary antibody was HRP-labeled goat anti-mouse IgG antibody.

[0080] Taking 2.1 times the OD of the negative control 450nm value as the CUT OFF value, the results are shown in Figure 7A Figure. The titers of Ab-38, Ab-56, and Ab-68 antibodies were all greater than 1:819200, higher than that of the foreign antibody (MT7C10).

[0081] The affinity dissociation constant (KD value) of an antibody is an important indicator to measure the binding affinity between the antibody and the antigen. Its value varies for different antibody-antigen pairs and is generally between 10 -6 - 10 -12 mol / L. The smaller the KD value, the higher the affinity. A scatter plot was drawn with the OD 450nm absorbance value as the ordinate and the antibody concentration as the abscissa, and a logarithmic trend line and the corresponding formula were generated. Half of the maximum absorbance value (this value is regarded as the absorbance when the antigen-antibody binding rate is 50%) was substituted into the above formula to calculate the antibody concentration, and this concentration value is the antibody affinity dissociation constant (KD).

[0082] The results are shown in Figure 7B Figure. After calculation, the KD values of the 4 monoclonal antibodies are as follows:

[0083] Clone Ab-38: 8.08×10 −11 mol / L;

[0084] Clone Ab-56: 6.49×10 −11mol / L;

[0085] Strain Ab-68: 7.16×10 −11 mol / L;

[0086] Foreign antibody (MT7C10): 2.05×10 −10 mol / L.

[0087] The KD values of the above 4 monoclonal antibodies are all within the high-affinity range, so they all belong to high-affinity antibodies.

[0088] Among them, the KD values of strains Ab-38, Ab-56 and Ab-68 are relatively close, and their affinity levels are comparable; the KD value of the foreign antibody is relatively large. Although it is within the category of high-affinity antibodies, its affinity is slightly lower than that of the 3 antibodies provided by the present invention.

[0089] Example 5

[0090] Considering that the relatively large KD value of the foreign antibody (MT7C10) measured in the ELISA results may be due to the use of different secondary antibodies (the antibodies provided by the present invention use HRP-labeled goat anti-rabbit antibody, and the foreign antibody (MT7C10) uses HRP-labeled goat anti-mouse antibody), in order to exclude the interference of secondary antibodies on the experimental results, the Biolayer Interferometry (BLI) technology was used to directly measure the KD values of antibodies Ab-38, Ab-56 and Ab-68 with recombinant chIFN-γ protein. The specific operation is as follows:

[0091] Immerse the His1K biosensor in a solution containing purified chIFN-γ (5 μg / mL) for antigen immobilization, then combine a 10 nM two-fold serial dilution of the antibody solution with the sensor immobilized with antigen for 180 s, and then perform a dissociation reaction for 180 s. The results show that all three antibodies bind to chIFN-γ and the binding is tight ( Figure 8 ).

[0092] The affinity of antibody Ab-38 is 2.615×10 -12 , the KD value of antibody Ab-56 is <1.0×10 -12 , the KD value of antibody Ab-68 is 1.659×10 -12 , and the KD value of the foreign antibody (MT7C10) is 4.926×10 -12 (Table 1), indicating that all three antibodies have extremely high affinity for recombinant chIFN-γ protein and are all superior to the foreign antibody. The affinity of Ab-56 for recombinant chIFN-γ protein is relatively the strongest.

[0093] Table 1: Binding kinetic parameters of Ab-38, Ab-56, Ab-68 and chIFN-γ

[0094] Sample ID KD(M) ka(1 / Ms) kdis(1 / s) <![CDATA[R 2 > Ab-38 2.615E-12 1.601E05 4.186E-07 0.9995 Ab-68 1.659E-12 1.768E05 2.934E-07 0.9994 Ab-56 <1.0E-12 6.985E05 4.550E-07 0.9995 Foreign antibody 4.926E-12 7.034E04 3.465E-07 0.9967

[0095] In the competitive binding experiment, after immobilizing the recombinant chIFN-γ protein (200 nM) on the His1K biosensor, it was first reacted with one antibody (200 nM) for 180 s, and then another antibody (200 nM) was added to continue the reaction for 180 s. A control group for single binding was set up. As Figure 9 shown, when Ab-38 was used as the first-binding antibody, a positive signal appeared for Ab-56, and no positive signals were observed for Ab-38 and Ab-68, indicating that Ab-38 and Ab-68 bind to the same epitope and recognize a different epitope from Ab-56. This result was further confirmed when Ab-68 was used as the first-binding antibody, and again, a positive signal appeared for Ab-56, and no positive signals were detected for Ab-68 and Ab-38. When Ab-56 was used as the first-binding antibody, positive signals appeared for Ab-38 and Ab-68, but no positive signal was detected for Ab-56 itself, further demonstrating that there is no steric hindrance between Ab-56 and Ab-38, Ab-68.

[0096] The signal changes during the competitive binding process of different antibody combinations were recorded, and the inhibition rate was calculated. An inhibition rate greater than 0.7 indicates no competition, between 0.3 - 0.7 indicates medium competition, and less than 0.3 indicates strong competition. The inhibition rate between Ab-38 and Ab 68 was 0.1 or 0.17, less than 0.3, showing a strong competitive relationship; the inhibition rate between Ab-56 and Ab-38 was 0.83 or 0.72, and the inhibition rate between Ab-56 and Ab-68 antibodies was 0.72 or 0.74, both greater than 0.7, showing no competitive relationship (Table 2). These data indicate that the antigenic epitopes recognized by Ab-38 and Ab-68 may be the same or similar, resulting in steric hindrance, while there is no steric hindrance between Ab-56 and Ab-38, Ab-68.

[0097] Table 2: Competitive relationship between Ab-38, Ab-56, Ab-68 antibodies determined by BLA

[0098]

[0099] From the perspective of antibody competition relationship and binding site differences, there is no competition or weak competition between Ab-56 antibody and Ab-38 and Ab-68 antibodies, indicating that the antigen epitopes they recognize are quite different from those of the other two antibodies. Antibody recognition of antigen epitopes mainly depends on the amino acid sequence and spatial conformation of the complementarity-determining region (CDR). Through comparison, it is found that there are differences in the amino acid sequences of the CDR regions of Ab-38 and Ab-68 antibodies, but the two show a strong competition relationship. It is speculated that this may be because their binding sites are close in spatial position, resulting in an inter-blocking effect.

[0100] When developing immunological detection methods such as double-antibody sandwich ELISA or ELISPOT, combining Ab-56 antibody with Ab-38 or Ab-68 antibody as an antibody pair, and utilizing their characteristics of recognizing different antigen epitopes, "two-site" recognition of chIFN-γ can be achieved, effectively improving the specificity and sensitivity of the detection, reducing the interference caused by non-specific binding, and providing a better antibody combination scheme for accurately detecting the content of chIFN-γ in chickens.

[0101] It is worth mentioning that as a dimer protein, the unique structure of chIFN-γ has a special impact on the detection method. When using methods such as double-antibody sandwich ELISA and ELISPOT for detection, even when using antibody pairs with strong competition relationships, such as the combination of Ab-38 and Ab-68 antibodies, or even using the same antibody as the capture antibody and detection antibody respectively, chIFN-γ still has a high probability of being successfully detected. This is because when an antigen epitope of a monomer in the chIFN-γ dimer complex is bound by an antibody, the antigen epitope at the same position of the other monomer can still provide an opportunity for the antibody to bind, thus ensuring the effective detection of chIFN-γ by the same antibody. However, obviously, when using paired antibodies without steric hindrance, there are 2 binding sites for each antibody pair on the chIFN-γ dimer complex, without mutual interference, and the detection signal will be stronger and the non-specific binding situation will be less.

[0102] Example 6

[0103] Evaluate the applicability and sensitivity of Ab-38, Ab-56, and Ab-68 as detection antibodies by ELISA method, and the operation is as follows:

[0104] The Ab-38, Ab-56, and Ab-68 antibodies expressed in Example 4 were labeled with HRP to obtain HRP-Ab-38, HRP-Ab-56, and HRP-Ab-68.

[0105] Purify chIFN-γ at 1000 ng / mL and dilute it 3-fold with PBS. Add 100 μL per well to a 96-well ELISA plate and incubate overnight at 4°C. Wash 3 times with 200 μL of PBST, add 200 μL of PBST containing 5 wt% skim milk to each well, and block at 37°C for 1 h. Wash again 3 times with 200 μL of PBST, add 100 μL of HRP-Ab-38, HRP-Ab-56, and HRP-Ab-68 diluted 1:2000 to each well respectively, and incubate at 37°C for 1 h. Wash 3 times with 200 μL of PBST, add 100 μL of TMB chromogenic solution to each well, develop color in the dark at room temperature for 15 min, add 50 μL of 2M H2SO4 to terminate the reaction, and read the OD 450nm reading.

[0106] The results are shown in Table 3. All three antibodies have strong binding ability to interferons at different coating concentrations. However, when there is no chIFN-γ coating, the background value of the HRP-Ab-38 antibody is relatively high and it is not recommended for detection; Ab-56 and Ab-68 can be used as detection antibodies.

[0107] Table 3 Test results of chIFN-γ binding ability of different antibodies

[0108] Antigen concentration ng / mL HRP-Ab-38 HRP-Ab-56 HRP-Ab-68 0.00 0.2341 0.0542 0.0681 1.37 0.3899 0.3958 0.2158 4.12 0.6129 0.6744 0.4555 12.35 1.0928 1.0406 0.9684 37.04 1.7857 1.8456 1.7416 111.11 2.2614 2.2647 2.1620 333.33 2.3880 2.3554 2.3115 1000 2.6134 2.6843 2.4130

[0109] Example 7

[0110] Explore the best antibody pair for ELISPOT detection method and determine relevant conditions. The operation is as follows:

[0111] 1. Screening of the best antibody pair

[0112] Select Ab-38, Ab-56, and Ab-68 as coating antibodies, at a concentration of 5 μg / mL, and coat the ELISPOT filter membrane plate with 100 μL per well. Wash 3 times with 200 μL of sterile PBS each time. Then, add 10 μL of phytohemagglutinin (PHA) stimulator to the positive wells, and add 10 μL of PBS to the control group. Subsequently, inoculate 1×10 6 chicken peripheral blood mononuclear cells (PBMC) per well and culture at 37°C in a 5% CO2 environment for 48 hours.

[0113] Wash three times with PBS again, 200 μL each time. Use bio-Ab-56 (biotin-labeled Ab-56 detection antibody) and bio-Ab-68 (biotin-labeled Ab-68 detection antibody) with a concentration of 1 μg / mL as detection antibodies respectively, add 100 μL to each well, and incubate at 37 °C for 1 hour. Then, wash three times with PBS, 200 μL each time, add 100 μL of streptavidin labeled with HRP diluted 1:2000 to each well, and incubate at 37 °C for 1 hour. Wash three times with PBS again, 200 μL each time, develop color at room temperature with TMB chromogenic solution for 15 minutes, and then rinse four times with deionized water. After discarding the liquid, dry it in a ventilated place away from light, and take pictures of the corresponding wells using a microplate reader.

[0114] The results are as Figure 10 shown. When using Ab-56 as the coating antibody and bio-Ab-68 as the detection antibody, the number of spots is the largest and clear, the staining background color is light, and there are no obvious spots in the control group. This combination is the best antibody pair.

[0115] 2. Determination of the optimal concentration of coating antibody and chromogenic solution

[0116] Dilute the Ab-56 antibody protein with PBS buffer to six concentrations of 10 μg / mL, 5 μg / mL, 2.5 μg / mL, 1.25 μg / mL, 0.625 μg / mL, and 0.3125 μg / mL respectively, coat the ELISPOT well plate with 100 μL per well, and then continue with the relevant steps of ELISPOT. Finally, develop color with different chromogenic solutions.

[0117] As Figure 11 can be seen, at the dilution of 5 μg / mL (500 ng / well), the number of spots is appropriate and clear, the staining background color is light, and there are no obvious spots in the control group. At different concentrations, the number of spots of AEC chromogenic solution (solarbio, product number A2010) is less than that of TMB chromogenic solution (Mabtech, product number 3651-10), indicating that TMB chromogenic solution has higher sensitivity. Therefore, TMB chromogenic solution is selected as the final chromogenic solution.

[0118] 3. Determination of the optimal concentration of biotin-labeled antibody

[0119] Dilute bio-Ab-68 with PBS containing 0.5% fetal bovine serum (FBS) to five working concentrations of 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL, 0.125 μg / mL, and 0.0625 μg / mL respectively, and continue with the relevant steps of ELISPOT. Take the appropriate number of spots in the experimental group, light staining background color and no obvious spots in the control group as the judgment criteria. Refer to Figure 12As a result, the optimal concentration of the detection antibody bio-Ab-68 was finally determined to be 0.5 µg / mL.

[0120] 4. Determination of the optimal concentration of streptavidin-labeled HRP

[0121] Perform ELISPOT-related operations according to the conditions explored above. After incubating with bio-Ab-68 for 1 hour, wash three times with PBS, 200 μL each time. Dilute HRP-labeled streptavidin (Mabtech, catalog number 3310-9-1000) with PBS containing 0.5% FBS at ratios of 1:1000, 1:2000, 1:4000, 1:8000, and 1:16000 respectively, add 100 μL to each well, and incubate at 37°C for 1 hour. Subsequently, continue with the color development and termination operations of ELISPOT, and use the criteria that the number of spots in the experimental group is appropriate, the staining background color is light, and there are no obvious spots in the control group for judgment. Refer to Figure 13 As a result, the optimal dilution ratio of HRP-labeled streptavidin was finally determined to be 1:1000.

[0122] Example 8

[0123] Use ELISPOT to detect the interferon secretion of duck PBMCs, and the operation is as follows:

[0124] Perform ELISPOT-related operations according to the conditions explored in Example 7 above. In this example, an antibody pair of Ab-56 and bio-Ab-68 and an antibody pair composed of Ab-56 and a foreign antibody (MT7C10) were used to detect duck PBMCs. The detection results are as Figure 14 shown. When using the antibody pair of Ab-56 and bio-Ab-68, more spots were detected. When using the pairing of Ab-56 and a foreign antibody, only a few spots were detected, and there was an obvious background color. Therefore, these results fully demonstrate that the antibody pairs we screened not only have the ability to bind chicken PBMC interferon, but also have a strong binding ability to duck PBMCs secreting DuIFN-γ, and can be used as an IFN-γ ELISPOT detection kit that is common for chickens and ducks.

[0125] Summary:

[0126] The following conclusions can be drawn from the above examples:

[0127] 1. It can be proved by Example 4 that the antibody titer of the present invention is high, and its titer is greater than 1:819200;

[0128] 2. It can be proved by Example 4 that the antibody affinity of the present invention is strong, and the order of magnitude of the KD value has reached 10 -12, especially the Ab-56 antibody, with a KD value less than 10 -12 ;

[0129] 3. It can be demonstrated through Example 5 that there is no steric hindrance between Ab-56 and Ab-38, Ab-68 of the present invention; the Figure 10 It is proved that although the epitopes are different (Ab-56, Ab-38), high-precision detection cannot be achieved either, indicating that the difference in epitopes is an important factor for the improvement of the detection effect, but not the only determining factor;

[0130] The above three factors are the reasons why the antibody pairs of the present invention show significant advantages compared with other similar antibodies or antibody pairs in the prior art.

[0131] 4. It can be demonstrated through Example 8 that compared with foreign antibodies, the antibody pairs of the present invention show obvious advantages in the detection of duck PBMC, further illustrating the advantages of the detection antibody Ab-68 of the present invention.

[0132] In summary, the detection antibodies of the present invention have excellent performance in all aspects; the present invention also develops a coating antibody adapted to the detection antibody, and through several experiments, it is proved that the two have different recognition epitopes, excellent affinity and titer, achieving the best detection effect.

[0133] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be included in the present invention. Any reference signs in the claims should not be regarded as limiting the claimed claims.

Claims

1. A detection antibody against chicken IFN-γ protein, characterized in that, The detection antibody is a monoclonal antibody, and the monoclonal antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region is as shown in SEQ ID No. 3; the amino acid sequence of the light chain variable region is as shown in SEQ ID No.

4.

2. A pair of antibodies for detecting chicken interferon or duck interferon, characterized in that, The antibody pair consists of a coating antibody and a detection antibody; the detection antibody is as described in claim 1; the coating antibody is a monoclonal antibody, and the coating antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the coating antibody is as shown in SEQ ID No. 1; the amino acid sequence of the light chain variable region of the coating antibody is as shown in SEQ ID No.

2.

3. Use of the detection antibody according to claim 1 or the antibody pair according to claim 2 for preparing a kit for detecting chicken interferon or duck interferon.

4. A kit for detecting chicken interferon or duck interferon, characterized in that, Containing the detection antibody according to claim 1 or the antibody pair according to claim 2.

Images