Preparation method and application of composite material for separating and enriching cortisol in saliva

Abstract

The invention belongs to the technical field of materials for biological analysis, and particularly discloses a preparation method and application of a composite material for separating and enriching cortisol in saliva. Firstly, an aptamer-assisted semiconductor MOF shell-core composite material is synthesized, the composite material can enrich cortisol in saliva by utilizing the specific recognition function of an aptamer, and the cortisol enriched on the material can be directly subjected to Raman spectrum analysis after efficient capture. The method is simple and low in cost, the synthesized composite material can be used for enriching and separating cortisol in saliva and can also be used as a substrate for SERS (Surface Enhanced Raman Scattering) analysis, one substance has two purposes, high-sensitivity enrichment and rapid detection analysis of cortisol in saliva are realized, high-throughput analysis of cortisol in saliva can be realized, and the method has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of materials for biological analysis, and in particular relates to a preparation method and application of a composite material for separating and enriching cortisol in saliva. Background Art

[0002] Cortisol, also known as hydrocortisone, is an important steroid hormone in the body. Its synthesis and secretion are regulated by the negative feedback mechanism of the hypothalamus-pituitary-adrenal axis. As a natural response to stress, the human body produces cortisol. Therefore, cortisol is also called a "stress hormone". The abnormal increase of cortisol will affect the normal functioning of the immune system, increase the content of fatty acids and amino acids in the blood, and may cause Cushing's syndrome and cardiovascular diseases. In recent years, with the rapid development of network technology, various advanced online games have appeared in the lives of the public and have become an important way for people to entertain themselves. Especially for teenagers, when facing the pressure of life and study, playing online games in a timely and appropriate amount can achieve the purpose of relieving stress and relaxing the body and mind. However, if you are addicted to online games for a long time, it is easy to cause emotional disorders such as depression, loneliness, and social anxiety. Therefore, the concentration of free cortisol in serum, urine and saliva can be detected to study the impact of online games on the human body and further monitor the health of the human body.

[0003] In order to accurately diagnose and treat cortisol-related diseases, it is necessary to regularly assess the cortisol concentration in biological fluids. Since the physiologically relevant concentration is very low and biological fluids have a complex matrix, it is easy to be interfered with by various components such as proteins, salts and other high-abundance small molecules in the sample during the analysis process. Therefore, cortisol monitoring still faces major challenges. At present, the main technologies for detecting cortisol include high-performance liquid chromatography-mass spectrometry (HPLC-MS), gas chromatography-mass spectrometry (GC-MS), chemiluminescent immunoassay, enzyme-linked immunosorbent assay (ELISA), colorimetry and electrochemical methods, but these methods are laborious, time-consuming and difficult to use for instant detection. In comparison, surface-enhanced Raman spectroscopy (SERS) has attracted widespread attention due to its advantages such as high sensitivity and non-destructiveness to samples, and is considered a powerful technology for analytical detection due to its excellent fingerprint recognition ability. In addition, since the intensity of the Raman peak is proportional to the number or concentration of molecules, SERS will have the potential to be used for quantitative analysis. Compared with single metal SERS substrates, core-shell composite materials can integrate multiple functions into the core and shell segments, with more regular arrangement and fewer structural defects, which is conducive to obtaining better performance in analytical detection. Metal-organic frameworks (MOFs) are a type of nanoclusters formed by metal ions and organic ligands. They have great application prospects in SERS analysis because of their large specific surface area, orderly and adjustable pore size, flexible and selectable ligands, and easy modification. Secondly, the pore structure of MOFs can block the interference of large molecules such as large proteins, thereby improving the selectivity of the method. In addition, MOFs can be used as SERS substrate materials or as functional group parts combined with other materials to form hybrid substrate materials, which can synergistically enhance the SERS effect. For example, it can be combined with semiconductor materials, which can simultaneously improve electromagnetic field enhancement and chemical enhancement through charge transfer effects, thereby improving sensitivity and specificity.

[0004] For the analysis of cortisol in saliva, various interfering substances can enter the surface of the SERS substrate and interfere with the SERS signal, thereby weakening or masking the target signal. Therefore, it is necessary to modify the SESR substrate to selectively capture the target molecule. Among them, coupling aptamers is a very effective method. Aptamers have the ability to specifically recognize and detect target substances, and are low in price, simple in chemical modification, and have high affinity. They can efficiently capture target molecules and increase the relative abundance of target analytes. Therefore, it is necessary to construct a suitable material as the analysis matrix of SERS, and use the material for the selective separation and enrichment of cortisol in saliva before SERS analysis, so as to improve the analysis efficiency. Summary of the invention

[0005] In order to solve the above technical problems, the present invention proposes a preparation method and application of a composite material for separating and enriching cortisol in saliva. An aptamer-assisted semiconductor MOF core-shell composite material is prepared and applied to the separation and enrichment of cortisol in saliva. The core-shell composite material is then used as a SERS analysis matrix to directly perform SERS detection on the cortisol enriched on the material, making the detection process more convenient and efficient.

[0006] The method for preparing the composite material for separating and enriching cortisol in saliva of the present invention comprises the following steps:

[0007] S1, dissolving ammonium heptamolybdate and thiourea in deionized water, then adding polyvinyl pyrrolidone, stirring and mixing, and transferring to a reactor for high-temperature reaction. After the reaction is completed, washing and drying are performed to obtain MoS2@PVP solid powder;

[0008] S2. Dissolve zirconium tetrachloride, ferric chloride hexahydrate and 2-aminoterephthalic acid in N,N-dimethylformamide respectively, then mix the two solutions of zirconium tetrachloride and ferric chloride hexahydrate, add MoS2@PVP solid powder, mix by ultrasonic, then add 2-aminoterephthalic acid solution, stir and react at 130°C after ultrasonic treatment, then wash with N,N-dimethylformamide and anhydrous ethanol several times, and dry to obtain MoS2@PVP@MOF solid powder;

[0009] S3. Disperse the MoS2@PVP@MOF solid powder in phosphate buffered saline, add glutaraldehyde, stir the reaction at room temperature, centrifuge and wash with phosphate buffered saline, disperse it again in phosphate buffered saline, add the aptamer solution and rotate overnight, centrifuge and redisperse it in phosphate buffered saline to obtain MoS2@PVP@MOF-aptamer dispersion.

[0010] Preferably, the amounts of ammonium heptamolybdate, thiourea, deionized water and polyvinyl pyrrolidone in S1 are 2.33 g, 4.55 g, 70 mL and 1.0 g respectively. After stirring for 30 min to mix well, the mixture is transferred to a reactor and reacted at 200° C. for 24 hours. After the reaction is completed, the MoS2@PVP solid powder is obtained by washing with water and drying.

[0011] Preferably, the contents of zirconium tetrachloride, ferric chloride hexahydrate, 2-aminoterephthalic acid and MoS2@PVP in S2 are 190.3 mg, 220.7 mg, 145 mg and 70 mg respectively; and the contents of N,N-dimethylformamide used to dissolve zirconium tetrachloride, ferric chloride hexahydrate and 2-aminoterephthalic acid are all 20 mL.

[0012] Preferably, the concentrations of MoS2@PVP@MOF, glutaraldehyde and aptamer in S3 are 35 mg, 100 μL and 10 μL (100 μM), respectively.

[0013] The present invention also provides the use of the composite material in separating and enriching cortisol in saliva and as a SERS analysis matrix:

[0014] The composite material, cortisol and actual saliva samples were dissolved together in an enrichment buffer to form a sample solution, which was incubated at room temperature. The sample solution was dropped onto a silicon wafer, and SERS analysis was performed directly after the solvent evaporated.

[0015] Preferably, the mass ratio of the composite material, cortisol and the actual saliva sample is 5:1:1000.

[0016] Preferably, the enrichment buffer is an aqueous solution containing 0.05% acetic acid by volume, and the mass ratio of the enrichment buffer solution to the actual saliva sample is 50:1.

[0017] Preferably, the sample solution is incubated at 25°C for 45 minutes.

[0018] The beneficial effects of the present invention are:

[0019] First, the aptamer-assisted semiconductor MOF core-shell composite material prepared by the present invention has the ability to specifically identify and detect target substances due to the coupled aptamer, and can efficiently capture target molecules and improve the relative abundance of target analytes. Secondly, MoS2 semiconductor materials can simultaneously improve electromagnetic field enhancement and chemical enhancement through charge transfer effect, thereby improving sensitivity and specificity. Thirdly, the porous structure of the MOF shell layer can block the interference of substances such as bulky proteins through the volume exclusion effect, thereby improving the selectivity of the method. In addition, the aptamer-assisted semiconductor MOF core-shell composite material is used as the analysis matrix of SERS, which effectively improves the SERS signal intensity of cortisol, and compared with liquid colloidal nanoparticles, the stability of solid SERS substrates is much better, and the core-shell structure helps to protect the core from oxidation and corrosion, thereby improving the chemical stability of nanoparticles, and the core-shell structure has a highly complementary advantage for various applications, so that the SERS technology can overcome its shortcomings in substrate stability. Finally, the aptamer-assisted semiconductor MOF core-shell composite material acts as an adsorption stationary phase for separation and enrichment to selectively enrich cortisol in saliva on its surface, and then acts as a SERS analysis matrix to directly perform SERS analysis on the cortisol enriched on the material, making the detection process more convenient and efficient. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for describing the embodiments are briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0021] Figure 1 This is a scanning electron microscope image of the aptamer-assisted semiconductor MOF core-shell composite material of Example 1.

[0022] Figure 2 This is a transmission electron microscopy image of the aptamer-assisted semiconductor MOF core-shell composite material of Example 1.

[0023] Figure 3 This is the infrared spectrum of the aptamer-assisted semiconductor MOF core-shell composite material of Example 1.

[0024] Figure 4 This is the X-ray diffraction spectrum of the aptamer-assisted semiconductor MOF core-shell composite material of Example 1.

[0025] Figure 5 The signal spectrum of the aptamer-assisted semiconductor MOF core-shell composite material and MOF and MoS2@MOF for the separation and enrichment of cortisol in Example 2, wherein Figure a is a SERS spectrum diagram, and Figure b is an average signal intensity diagram (with the signal intensity at 1643 cm -1 The peak at is represented by , n = 3).

[0026] Figure 6 The signal spectra of the aptamer-assisted semiconductor MOF core-shell composite material in Example 3 for separation and enrichment of cortisol under different sodium chloride (NaCl) interference concentrations, wherein Figure a is a SERS spectrum diagram, and Figure b is an average signal intensity diagram (with the signal intensity at 1643 cm -1 The peak at is represented by , n = 3).

[0027] Figure 7 The signal spectra of the aptamer-assisted semiconductor MOF core-shell composite material in Example 3 for separation and enrichment of cortisol under different bovine serum albumin (BSA) interference concentrations, wherein Figure a is a SERS spectrum diagram, and Figure b is an average signal intensity diagram (with the signal intensity at 1643 cm -1 The peak at is represented by , n = 3).

[0028] Figure 8 This is the working curve of the aptamer-assisted semiconductor MOF core-shell composite material for cortisol analysis in Example 4.

[0029] Fig. 9The average SERS signal intensity of the semiconductor MOF core-shell composite material assisted by the aptamer in Example 5 for the separation and enrichment of cortisol in the saliva of 15 college students before and after playing games (with the signal intensity at 1643 cm -1 The peak at is represented by , n = 3). DETAILED DESCRIPTION

[0030] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0031] Example 1

[0032] Aptamer-assisted synthesis of semiconductor MOF core-shell composites:

[0033] (1) Dissolve 2.33 g of ammonium heptamolybdate and 4.55 g of thiourea in 70 mL of deionized water, then add 1.0 g of polyvinyl pyrrolidone and stir for 30 minutes to fully mix. Transfer the reaction system to a reactor and react at 200 °C for 24 hours. Wash the product with deionized water three times and then dry it to obtain MoS2@PVP solid powder.

[0034] (2) Dissolve 190.3 mg zirconium tetrachloride, 220.7 mg ferric chloride hexahydrate and 145 mg 2-aminoterephthalic acid in 20 mL N, N-dimethylformamide, then mix the two solutions of zirconium tetrachloride and ferric chloride hexahydrate, add 70 mg MoS2@PVP solid powder, and mix them thoroughly by ultrasonication for 30 minutes. Then add 2-aminoterephthalic acid solution and continue ultrasonication for 15 minutes. Stir the reaction system at 130 ° C for 7 hours, wash the product with N, N-dimethylformamide and anhydrous ethanol for 3 times, and dry it to obtain MoS2@PVP@MOF solid powder. The synthesis of pure MOF is the same as the above steps, but MoS2@PVP solid powder is not added during the process.

[0035] (3) 35 mg MoS2@PVP@MOF solid powder was dispersed in 20 mL phosphate buffered saline solution, 100 μL glutaraldehyde was added, stirred at room temperature for 2 h, centrifuged and washed twice with phosphate buffered saline solution, then dispersed again in 2 mL phosphate buffered saline solution, and 10 μL (100 μM) aptamer (amino-modified cortisol aptamer, sequence: 5′

[0036] -NH2-(CH2)6-GGAATGGATCCACATCCATGGATGGGCAATG

[0037] CGGGGTGGAGAATGGTTGCCGCACTTCGGCTTCACTGCAGACTTGACGAAGCTT-3′) solution and rotate overnight. After centrifugation, it was redispersed in 35 mL of phosphate buffered saline to obtain MoS2@PVP@MOF-aptamer

[0038] The dispersion was stored at 4°C until use.

[0039] Figure 1 Scanning electron microscopy image of aptamer-assisted semiconductor MOF core-shell composite material; Figure 2 Transmission electron microscopy image of aptamer-assisted semiconductor MOF core-shell composite material; Figure 3 The infrared spectrum of the aptamer-assisted semiconductor MOF core-shell composite material;

[0040] Figure 4 X-ray diffraction spectrum of aptamer-assisted semiconductor MOF core-shell composite material.

[0041] Example 2

[0042] The aptamer-assisted semiconductor MOF core-shell composite material obtained in Example 1, MoS2@PVP@MOF solid powder and pure MOF material were used as enrichment and adsorption stationary phases for the enrichment and SERS detection of cortisol.

[0043] (1) 10 μg of MoS2@PVP@MOF-aptamer, 10 μg of MoS2@PVP@MOF, and 10 μg of MOF were dispersed in 100 μL of an aqueous solution containing 0.1 g / L cortisol and incubated at 25 °C for 45 min.

[0044] (2) SERS analysis: 5 μL of the cortisol-loaded material dispersion enriched in step (1) was added dropwise onto a silicon wafer and subjected to SERS analysis after natural drying. The SERS image is shown in FIG. Figure 5 shown.

[0045] Analysis results: Figure 5The results show that due to the hydrophobicity of MOF, it can bind to the cortisol molecule through hydrophobic-hydrophobic interaction, so it has a certain capture effect on cortisol, and MOF also has SERS activity for cortisol, and can present the SERS signal of cortisol. MoS2@PVP@MOF forms a hybrid substrate material, which has a synergistic effect of enhancing SERS, so a stronger cortisol signal is detected relative to pure MOF. Compared with MoS2@PVP@MOF, MoS2@PVP@MOF-aptamer has specific recognition and affinity for cortisol due to the modification of the aptamer, and the capture ability is enhanced. The SERS signal intensity of cortisol is significantly enhanced compared with the other two nano-substrates.

[0046] Example 3

[0047] The aptamer-assisted semiconductor MOF core-shell composite material obtained in Example 1 was used as an enrichment and adsorption stationary phase for the enrichment and SERS detection of cortisol in the presence of sodium chloride (NaCl) and bovine serum albumin (BSA) interference.

[0048] (1) 10 μg of MoS2@PVP@MOF-aptamer was dispersed in 100 μL of enrichment buffer (the enrichment buffer is a buffer solution containing 0.05% acetic acid by volume) containing 0.1 g / L cortisol and different concentrations of NaCl or BSA, where the concentrations of NaCl were 0.2, 1, 5, and 15 mg / mL, and the concentrations of BSA were 0.05, 0.08, 0.2, and 0.5 mg / mL, and incubated at 25 °C for 45 min.

[0049] (2) SERS analysis: 5 μL of the cortisol-loaded material dispersion enriched in step (1) was added dropwise onto a silicon wafer and subjected to SERS analysis after natural drying. The SERS image is shown in FIG. Figure 6 and Figure 7 shown.

[0050] Analysis results: Figure 6 and Figure 7 It can be seen from the results that when the salt concentration is as high as 15 mg / mL and the BSA concentration is as high as 0.5 mg / mL, obvious cortisol SERS signals can still be obtained, indicating that the material has strong resistance to salt and protein interference.

[0051] Example 4

[0052] The aptamer-assisted semiconductor MOF core-shell composite material obtained in Example 1 was used as an enrichment and adsorption stationary phase for the enrichment and SERS detection of a series of different concentrations of cortisol.

[0053] (1) Disperse 10 μg of MoS2@PVP@MOF-aptamer in 100 μL of enrichment buffer (the enrichment buffer is a buffer solution containing 0.05% acetic acid by volume) containing cortisol at concentrations of 0.5, 0.8, 3, 5, 10, 20, 30, and 50 μg / mL, respectively, and incubate at 25°C for 45 min.

[0054] (2) SERS analysis: 5 μL of the cortisol-loaded material dispersion enriched in step (1) was added dropwise to a silicon wafer, and after natural drying, SERS analysis was performed to collect the SERS signal intensity and plot a curve of signal intensity versus concentration. Figure 8 shown.

[0055] Analysis results: Figure 8 It can be seen that the SERS signal intensity obtained by SERS analysis after cortisol is enriched by the aptamer-assisted semiconductor MOF core-shell composite material is linearly correlated with the concentration, and the correlation coefficient R 2 Greater than 0.99.

[0056] Example 5

[0057] The aptamer-assisted semiconductor MOF core-shell composite material obtained in Example 1 was used as an enrichment and adsorption stationary phase for the separation, enrichment and SERS detection of cortisol in saliva.

[0058] (1) Collection of saliva samples: Saliva samples were provided by college student volunteers. Saliva samples were collected before and after different gaming time periods. The collected samples were centrifuged at 3600 rpm for 3 minutes to separate them from the saliva collector and then stored at 4°C for later use.

[0059] (2) Disperse 10 μg of MoS2@PVP@MOF-aptamer in 100 μL of enrichment buffer (the enrichment buffer is a buffer solution containing 0.05% acetic acid by volume) containing 2 μL of actual sample and 2 μg of cortisol, and incubate at 25°C for 45 min.

[0060] (3) SERS analysis: 5 μL of the cortisol-loaded material dispersion enriched in step (1) was added dropwise to a silicon wafer and subjected to SERS analysis after natural drying. The mass spectrum obtained is shown in FIG. Fig. 9 shown.

[0061] Analysis results: Fig. 9 It can be seen that the method for specific separation, enrichment and rapid detection of cortisol proposed in the present invention can enrich, separate and detect the SERS signal of cortisol from a small amount of saliva sample by the spike method. The analysis results are listed in Table 1.

[0062] Table 1 Test results of cortisol concentration in actual saliva samples (n=3)

[0063]

[0064]

[0065] The preferred embodiments of the present invention disclosed above are only used to help illustrate the present invention. The preferred embodiments do not describe all details in detail, nor do they limit the invention to only the specific embodiments described. Obviously, many modifications and changes can be made according to the content of this specification.

Claims

1. A method for preparing a composite material for separating and enriching cortisol in saliva, characterized in that: The following steps are involved: S1, dissolving ammonium heptamolybdate and thiourea in deionized water, then adding polyvinyl pyrrolidone, stirring and mixing, and transferring to a reactor for high-temperature reaction. After the reaction is completed, washing and drying are performed to obtain MoS2@PVP solid powder; S2. Dissolve zirconium tetrachloride, ferric chloride hexahydrate and 2-aminoterephthalic acid in N,N-dimethylformamide respectively, then mix the two solutions of zirconium tetrachloride and ferric chloride hexahydrate, add MoS2@PVP solid powder, mix by ultrasonic, then add 2-aminoterephthalic acid solution, stir and react at 130°C after ultrasonic treatment, then wash with N,N-dimethylformamide and anhydrous ethanol several times, and dry to obtain MoS2@PVP@MOF solid powder; S3. Disperse the MoS2@PVP@MOF solid powder in phosphate buffered saline, add glutaraldehyde, stir the reaction at room temperature, centrifuge and wash with phosphate buffered saline, disperse it again in phosphate buffered saline, add the aptamer solution and rotate overnight, centrifuge and redisperse it in phosphate buffered saline to obtain MoS2@PVP@MOF-aptamer dispersion.

2. The method for preparing a composite material for separating and enriching cortisol in saliva according to claim 1, characterized in that: The ammonium heptamolybdate, thiourea, deionized water and polyvinyl pyrrolidone in S1 are 2.33 g, 4.55 g, 70 mL and 1.0 g respectively. After stirring for 30 min to mix well, the mixture is transferred to a reactor and reacted at 200° C. for 24 hours. After the reaction is completed, the MoS2@PVP solid powder is obtained by washing with water and drying.

3. The method for preparing a composite material for separating and enriching cortisol in saliva according to claim 1, characterized in that: The contents of zirconium tetrachloride, ferric chloride hexahydrate, 2-aminoterephthalic acid and MoS2@PVP in S2 are 190.3 mg, 220.7 mg, 145 mg and 70 mg respectively; the contents of N,N-dimethylformamide used to dissolve zirconium tetrachloride, ferric chloride hexahydrate and 2-aminoterephthalic acid are all 20 mL.

4. The method for preparing a composite material for separating and enriching cortisol in saliva according to claim 1, characterized in that: The concentrations of MoS2@PVP@MOF, glutaraldehyde and aptamer in S3 are 35 mg, 100 μL and 10 μL (100 μM), respectively.

5. Use of the composite material for separating and enriching cortisol in saliva prepared according to any one of claims 1 to 4 in separating and enriching cortisol in saliva and as an analysis matrix for SERS, characterized in that: The composite material, cortisol and actual saliva samples were dissolved together in an enrichment buffer to form a sample solution, which was incubated at room temperature. The sample solution was dropped onto a silicon wafer, and SERS analysis was performed directly after the solvent evaporated.

6. The use of the composite material according to claim 5 in separating and enriching cortisol in saliva and as a SERS analysis matrix, characterized in that: The mass ratio of the composite material, cortisol and the actual saliva sample is 5:1:1000.

7. The use of the composite material according to claim 5 in separating and enriching cortisol in saliva and as an analysis matrix for SERS, characterized in that: The enrichment buffer solution is an aqueous solution containing 0.05% acetic acid by volume, and the mass ratio of the enrichment buffer solution to the actual saliva sample is 50:

1.

8. The use of the composite material according to claim 5 in separating and enriching cortisol in saliva and as a SERS analysis matrix, characterized in that: The sample solution was incubated at 25°C for 45 minutes.

Images