Streptomycete N1 strain for inhibiting phytopathogen, biocontrol inoculant and application of biocontrol inoculant

Abstract

The invention discloses a streptomycete N1 strain for inhibiting phytopathogen, a biocontrol inoculant and application of the biocontrol inoculant. The classification name of the Streptomyces sp. Is Streptomyces sp., the Streptomyces sp. Is preserved in the China Center for Type Culture Collection, and the preservation number of the Streptomyces sp. Is CCTCC NO: M 20242700. Experiments prove that the streptomyces N1 strain can significantly inhibit a variety of phytopathogens such as fusarium oxysporum, botryosphaeria dothidea, fusarium graminearum, acremonium nucleatum, botrytis cinerea, sclerotinia sclerotiorum and phytophthora nicotianae. A biological control fungicide prepared from the streptomyces N1 strain can effectively control plant soil-borne diseases, has the characteristics of high efficiency, environmental protection, low cost and easiness in preparation, is an optimal scheme for agricultural sustainable development, and has a good and wide market application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a Streptomyces N1 strain for inhibiting plant pathogens, a biocontrol agent and an application thereof. Background Art

[0002] Plant production is vulnerable to the harm of plant pathogens. There are many types of plant pathogens, which seriously affect the yield and quality of crops and cause huge economic losses. Globally, pathogens pose a serious threat to agricultural crops and cash crops. Fusarium oxysporum ) is a soil-borne pathogenic fungus with a worldwide distribution and a wide host range. It can cause wilt diseases in more than 100 plant species, including melons, solanaceae, bananas, cotton, legumes, and flowers. Botryosphaeria dothidea ) is a pathogen that causes fruit tree diseases, which can cause fruit rot, leaf spots, necrosis, ulcers and gummosis. Fusarium graminearum ) is one of the main pathogens causing wheat fusarium head blight, resulting in yield loss and quality degradation. Acremonium sclerotigenum ) can cause soft rot in plants such as Lilium argentea, causing significant losses to agricultural production and stored agricultural products worldwide. Botrytis cinerea ) is a widely distributed plant gray mold pathogen that can infect more than 500 plant species, including important economic crops such as tomatoes, strawberries, and grapes. Sclerotinia sclerotiorum ) causes sclerotinia disease worldwide, affecting important crops such as rapeseed, soybean and sunflower. Phytophthora nicotianae ) causes huge economic losses to tobacco crops worldwide. Phytophthora capsici ) is a devastating disease in pepper production. When it occurs seriously, it often causes crop failure. It occurs in various parts of my country.

[0003] The difficulty in preventing and controlling these plant diseases lies in the large variety of pathogens, the increased drug resistance of pathogens caused by the use of chemical drugs, the environmental pollution and harm to human health caused by chemical pesticide residues. Therefore, biological control, as an environmentally friendly means of prevention and control, has received more and more attention. Biocontrol bacteria can effectively prevent and treat plant diseases. Compared with traditional chemical control, biocontrol bacteria have the advantages of being non-toxic, low cost, simple preparation technology, and a long lasting effect. They are not easy to develop drug resistance and are friendly to the environment and human health. These biocontrol bacteria inhibit the growth of pathogens through competition, antagonism, and the production of antibiotics, reduce the occurrence of diseases, and increase crop yields and quality, showing important application potential in the sustainable development of agriculture. Summary of the invention

[0004] The purpose of the present invention is to provide a strain of Streptomyces N1 that inhibits multiple plant pathogens, a biocontrol agent, and an application thereof. The present invention obtains a strain of Streptomyces N1 that has a significant effect of inhibiting the growth of multiple plant pathogens through screening. The strain and the fermentation liquid produced by the strain can be used to prepare a biocontrol agent, which is applied to the prevention and control of plant diseases and has a good market application development prospect.

[0005] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The present invention provides a Streptomyces N1 strain for inhibiting plant pathogens, which is classified and named as Streptomyces N1 strain Streptomyce sp. strain N1, deposited in China Center for Type Culture Collection, with the deposit number being CCTCC NO: M20242700.

[0006] Further, the colony of the Streptomyces N1 strain is off-white, with yellow powder on the surface, small and dense colonies, dry surface, white fluffy hyphae, growing in the culture medium, not easy to pick up, consistent with the morphological characteristics of Streptomyces. Through microscopic observation, the Streptomyces has well-developed branched hyphae, which have no transverse septa, differentiate into basal hyphae and aerial hyphae, and spores are beaded with a diameter of about 1-3 μm.

[0007] Furthermore, the nucleotide sequence of 16S rDNA of the Streptomyces N1 strain is shown in SEQ ID No.3.

[0008] The present invention also provides a biocontrol agent for preventing and controlling plant phytophthora and / or plant fungal diseases. The biocontrol agent contains the Streptomyces N1 strain with a preservation number of CCTCC NO: M 20242700 or a fermentation liquid of the strain.

[0009] Furthermore, the plant phytophthora disease is a plant phytophthora disease caused by tobacco phytophthora and pepper phytophthora; the plant fungal disease is a fungal disease caused by Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum, Acremonium sclerotiorum, Botrytis cinerea, and Sclerotinia sclerotiorum.

[0010] Furthermore, the preparation step of the Streptomyces N1 strain fermentation broth is: inoculating the Streptomyces N1 strain into a potato glucose medium and shaking and culturing it at 28°C to 30°C for 3 days, and obtaining a fermentation broth without the Streptomyces N1 strain after centrifugation and filtration.

[0011] Furthermore, the biocontrol agent can inhibit the spore germination and germ tube elongation of Fusarium oxysporum and Botrytis cinerea.

[0012] The present invention also provides the use of the Streptomyces N1 strain or the biocontrol agent in preparing a plant pathogen inhibitor.

[0013] Furthermore, the plant pathogens include Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum, Acremonium sclerotiorum, Botrytis cinerea, Sclerotinia sclerotiorum, Phytophthora nicotianae, and Phytophthora capsici.

[0014] Furthermore, the Streptomyces N1 strain can significantly inhibit the mycelial growth of Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum, Acremonium sclerotiorum, Botrytis cinerea, Sclerotinia sclerotiorum, Phytophthora nicotianae, and Phytophthora capsici.

[0015] Compared with the prior art, the advantages and technical effects of the present invention are: The present invention screens out a Streptomyces N1 strain, and experiments prove that it has a significant inhibitory effect on a variety of plant pathogens. Through a plate confrontation experiment, the mycelial growth of Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum, Acremonium nucleatum, Botrytis cinerea, Sclerotinia sclerotiorum, Phytophthora nicotianae, and Phytophthora capsici was tested. At the same time, through the spore germination inhibition and germ tube elongation inhibition experiments of Botrytis cinerea and Fusarium oxysporum by fermentation broth, it is confirmed that the Streptomyces N1 strain has a broad-spectrum antibacterial property. Based on these characteristics, the Streptomyces N1 strain is expected to have good market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is a plate culture diagram of the Streptomyces N1 strain; Figure 2 is a microscopic image of the Streptomyces N1 strain; Figure 3 is a schematic diagram of 16S rDNA sequence amplification of the Streptomyces N1 strain; Figure 4 is a diagram of the phylogenetic tree of the 16S rDNA sequence of the Streptomyces N1 strain; Figure 5 The Streptomyces N1 inhibits the mycelial growth of Fusarium oxysporum; Figure 6 The Streptomyces N1 inhibits the mycelial growth of Botrytis cinerea; Figure 7 The Streptomyces N1 inhibits the mycelial growth of Fusarium graminearum; Figure 8 The Streptomyces N1 inhibits the growth of Acremonium nucleatum hyphae; Fig. 9 The Streptomyces N1 inhibits the growth of Botrytis cinerea hyphae; Fig.10 The Streptomyces N1 inhibits the growth of mycelium of Sclerotinia sclerotiorum; Fig.11 The Streptomyces N1 inhibits the growth of tobacco phytophthora hyphae; Fig.12 The Streptomyces N1 inhibits the growth of Phytophthora capsici hyphae; Fig.13 It is a statistical graph of the inhibition rate of Streptomyces N1 against all tested pathogens; Fig.14 The result of the inhibition of the germination of Botrytis cinerea spores by the Streptomyces N1 is shown in FIG. Fig.15 The result is the inhibition of the germ tube growth of Botrytis cinerea by Streptomyces N1; Fig.16 The result is that the Streptomyces N1 inhibits the germination of Fusarium oxysporum spores; Fig.17 This is the result of the inhibition of the germ tube growth of Fusarium oxysporum by the Streptomyces N1. DETAILED DESCRIPTION

[0017] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0018] Example 1 Isolation and screening of strains In March 2024, 2 g of decomposed manure was collected in Shandong. The manure was crushed in a mortar and placed in a beaker containing 30 mL of sterile water. The mixture was shaken and allowed to stand for 30 minutes. The supernatant was diluted in a gradient manner and 100 μL of each dilution was applied to Gao's medium No. 1 (Gao's medium No. 1 g / L: soluble starch 20 g, NaCl 0.5 g, KNO 3 1 g, K 2 HPO 4 ·3 H 2 O 0.5 g, MgSO 4 7 H 2 O 0.5 g, FeSO 4 7 H 2 O 0.01 g, agar 20 g, pH 7.2-7.4), and cultured at 28 ℃ for 3 days. The single colonies of different morphologies on the plate were purified and cultured using the three-zone streak method on Gao's medium No. 1. The purified single colonies were picked and cultured on potato dextrose agar (PDA) plates (200 g of potatoes were washed and cut into pieces, added with appropriate water and boiled for 20 minutes, the potato juice was filtered through gauze, and then 20 g of glucose and 15 g of agar were added, and the volume was adjusted to 1000 ml, natural pH) and the single colonies and various plant pathogens were inoculated on PDA plates using the plate confrontation growth method. By testing the inhibition of Streptomyces on the mycelial growth of plant pathogens, a Streptomyces strain N1 that has inhibitory effect on the growth of various plant pathogens such as Fusarium oxysporum was screened.

[0019] The plate culture photo of strain N1 is shown in Figure 1 As shown, the colonies are off-white with yellow powder on the surface. The colonies are small and dense, with a dry surface and white fluffy hyphae. They grow in the culture medium and are not easy to pick up, which is consistent with the morphological characteristics of Streptomyces. Pick a small amount of bacteria on a slide, add a drop of cedar oil, and use an oil microscope to observe the cell morphology and size, hyphae and spores of the bacteria. Figure 2 The microscopic morphology of strain N1 is shown. The diameter of the hyphae is 1-3 μm, and the spores are in the shape of beads, which is consistent with the hyphae characteristics of Streptomyces.

[0020] 2. Classification and Identification of Streptomyces N1 Strain PCR sequence determination using 16S rDNA molecular characterization method: (1) 16S rDNA sequence primer The DNA of each strain was extracted by CTAB method. ② PCR amplification: The template was the DNA extracted in the previous step, and the primers were 27F (AGAGTTTGATCCTGGCTCAG) (SEQ ID No.1) and 1492R (GGTTACCTTGTTACGACTT) (SEQ ID No.2). ③ The amplified product was sent to the company for sequencing. ④ The sequenced data was opened with DNAMAN, and Blast alignment was performed using the NCBI database to perform phylogenetic tree analysis; (2) The PCR reaction system is as follows: 2 × Rapid Taq Master Mix: 25 μL; 27F: 2.5 μL; 1492R: 2.5 μL; Template: 2 μL; ddH 2 O: 18 μL; The PCR reaction procedure was as follows: 95°C pre-denaturation for 2 min; 95°C denaturation for 20 s, 55°C annealing for 20 s, 72°C extension for 1 min; 35 cycles, 72°C renaturation; PCR product electrophoresis Figure 3 The extracted DNA was sent to a sequencing company for sequencing; (3) After sequencing, the 16S rDNA sequence of the strain Streptomyces N1 is shown in SEQ ID No. 3; (4) Conclusion: After comparison with the NCBI database, the N1 strain to be tested is similar to Streptomyces ( Streptomyces sp. strain L-12) strain 16S rDNA (GenBank: OR186223.1) sequence similarity is 99.13%; combined with phylogenetic tree analysis ( Figure 4 ), indicating that the Streptomyces N1 strain is Streptomyces ( Streptomyces sp.).

[0021] The strain of Streptomyces N1 screened by the present invention is deposited in the China Center for Type Culture Collection; address: Wuhan University, Wuhan, China; deposit date: December 3, 2024. Streptomyces The deposit number of sp. N1 is CCTCC NO: M 20242700.

[0022] 3. Plate confrontation experiment to test the inhibitory effect of Streptomyces N1 strain on the mycelial growth of various plant pathogens Experimental method: The Streptomyces N1 strain was activated and cultured on a PDA plate at 26 ℃ for 2 days for use; 8 plant pathogens (Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum, Acremonium sclerotiorum, Botrytis cinerea, Sclerotinia sclerotiorum, Phytophthora nicotianae, and Phytophthora capsici) were activated and cultured on PDA plates at 26-28 ℃ for 3-6 days, respectively. Then, a round cake (0.60 cm in diameter) was punched at the edge of the activated mycelium of the strain (the growth conditions were as consistent as possible) with a sterilized yellow gun tip. Then, the Streptomyces N1 strain and the pathogen cake were picked up to a new plate with an inoculation needle, and the blank cake was used as a control. Then, the culture dish was inverted in an incubator (26-28 ℃) for culture for 3-6 days. When the blank group grew full of the plate, the growth of the mycelium was measured, and the inhibition rate of the Streptomyces N1 strain on the growth of the 8 plant pathogens was calculated.

[0023] The test found that the Streptomyces N1 strain had a significant inhibitory effect on the mycelial growth of 8 plant pathogens. Figure 5-Figure 12 The inhibitory effect of Streptomyces N1 strain on 8 plant pathogens is shown (pathogens are in the middle of the figure, and Streptomyces N1 strains are around). Further analysis showed that the inhibition rates of Streptomyces N1 strain on the mycelial growth of Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum, Acremonium sclerotiorum, Botrytis cinerea, Sclerotinia sclerotiorum, Phytophthora nicotianae, and Phytophthora capsici were 29.1%, 73.3%, 32.3%, 44.8%, 30.6%, 29.1%, 36.6%, and 33.1%, respectively (e.g. Fig.13 ).

[0024] Example 2 1. Inhibitory effect of fermentation filtrate of Streptomyces N1 strain on spore germination and germ tube elongation 1. Obtaining the fermentation filtrate of the N1 strain: The selected N1 strain was inoculated into a potato glucose liquid medium, cultured at 28°C for 3 days, then centrifuged at 12,000 rpm for 10 min, filtered, and the supernatant was filtered with a bacterial filter with a diameter of 0.22 μm to obtain the fermentation filtrate containing the N1 strain. The fermentation filtrate was diluted to different concentrations and diluted with spores of Botrytis cinerea and Fusarium oxysporum (the spore concentration of Botrytis cinerea was 1.0 × 10 6 / ml, the culture medium was 10% YEPD (10 g yeast extract, 20 g peptone, added H 2 O (diluted to 1 L) and mixed, and immediately dripped into a sterilized glass slide, and cultured in the dark at 26 ℃ to detect the spore germination rate and measure the length of the germ tube in the treatment of different concentrations of fermentation filtrate.

[0025] (1) Effect of fermentation filtrate of Streptomyces N1 strain on spore germination and germ tube elongation of Botrytis cinerea After 6 hours of culture, the germination rate and germ tube length of the spores were determined, and the results were as follows: Fig.14 and Fig.15 As shown in the figure, the germination rate of the control was 90.4% and the germ tube length was 65 μm. 5% fermentation filtrate could inhibit the germination of Botrytis cinerea, with a germination rate of 32.4% and a germ tube length of 12 μm. When the content exceeded 15%, the spores did not germinate, indicating that N1 fermentation broth can effectively inhibit the spore germination and germ tube elongation of Botrytis cinerea at a low concentration.

[0026] (2) Effect of fermentation filtrate of Streptomyces N1 strain on spore germination and germ tube elongation of Fusarium oxysporum After 4 hours of incubation, the germination rate and germ tube length of the spores were determined, and the results were as follows: Fig.16 and Fig.17 As shown in the results, the inhibitory effect of N1 fermentation broth has a dose effect, that is, with the increase of the fermentation filtrate content, the inhibitory effect on the germination rate and germ tube elongation length of Fusarium oxysporum increases. When the content is 30%, the inhibition rate of Fusarium oxysporum spore germination is 18.0%, indicating that the fermentation product of N1 strain has a strong inhibitory effect on the germination of Fusarium oxysporum spores, and the spore germination length at this time is 7 μm.

[0027] The above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A Streptomyces N1 strain for inhibiting plant pathogens, characterized in that: Streptomyces Streptomyces sp., deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: M20242700.

2. The Streptomyces N1 strain according to claim 1, characterized in that: The Streptomyces N1 strain has an off-white colony with yellow powder on the surface. The colony is small and dense, with a dry surface and produces white fluffy hyphae. It grows in a culture medium and is not easy to pick up. It has well-developed branched hyphae without transverse septa, differentiated into basal hyphae and aerial hyphae, and spores are in the form of beads with a diameter of about 1-3 μm.

3. The Streptomyces N1 strain according to claim 1, characterized in that: The nucleotide sequence of 16S rDNA of the Streptomyces N1 strain is shown in SEQ ID No.

3.

4. A biocontrol agent for preventing and controlling plant phytophthora and / or plant fungal diseases, characterized in that: The biocontrol agent contains the Streptomyces N1 strain with a preservation number of CCTCC NO: M 20242700 or its fermentation liquid.

5. The biocontrol agent according to claim 4, characterized in that: The plant phytophthora disease is caused by tobacco phytophthora and pepper phytophthora; the plant fungal disease is caused by Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum, Acremonium sclerotiorum, Botrytis cinerea, and Sclerotinia sclerotiorum.

6. The biocontrol agent according to claim 4, characterized in that: The preparation steps of the Streptomyces N1 strain fermentation broth are as follows: inoculating the Streptomyces N1 strain into a potato glucose medium and shaking and culturing it at 28°C to 30°C for 3 days, and obtaining a fermentation broth without the Streptomyces N1 strain through centrifugation and filtration.

7. The biocontrol agent according to claim 4, characterized in that: The biocontrol agent can inhibit the spore germination and germ tube elongation of Fusarium oxysporum and Botrytis cinerea.

8. Use of the Streptomyces N1 strain according to claim 1 or the biocontrol agent according to claim 4 in the preparation of a plant pathogen inhibitor.

9. The use according to claim 8, characterized in that: The plant pathogens include Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum, Acremonium sclerotiorum, Botrytis cinerea, Sclerotinia sclerotiorum, Phytophthora nicotianae, and Phytophthora capsici.

10. The use according to claim 8, characterized in that: The Streptomyces N1 can significantly inhibit the hyphae growth of Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum, Acremonium sclerotiorum, Botrytis cinerea, Sclerotinia sclerotiorum, Phytophthora nicotianae, and Phytophthora capsici.

Images