An rna interference fragment of a crustacean hyperglycemic hormone gene and use thereof

Abstract

The present application relates to the technical field of RNA interference, and particularly discloses a RNA interference fragment of a crustacean hyperglycemic hormone gene and application thereof. The RNA interference fragment is injected into the third step of a river crab in a manner of injection, and is used for interfering with mRNA expression of a crustacean hyperglycemic hormone gene CHH of the river crab. The fighting behavior of Eriocheir sinensis is effectively controlled, which is beneficial to the yield improvement of large-scale breeding of Eriocheir sinensis and reduction of economic losses caused by the incomplete Eriocheir sinensis due to fighting.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of RNA interference, in particular to a RNA interference fragment of crustacean hyperglycemic hormone gene and application thereof. BACKGROUND

[0002] Eriocheir sinensis, also known as river crab, is an important aquaculture species in China. Fighting behavior often occurs in its pond culture, which leads to limb mutilation and consumes a large amount of energy, which is harmful to the growth and survival of crustacean aquaculture, and ultimately leads to economic value loss. Current studies have confirmed that serotonin and dopamine participate in the regulation of river crab fighting behavior through related receptors. Studying the fighting behavior of Eriocheir sinensis is of great significance to the large-scale culture of this species.

[0003] RNA interference is a post-transcriptional gene silencing phenomenon, which specifically degrades its homologous mRNA in cells through in vitro artificial synthesis of double-stranded RNA or double-stranded RNA in vivo, silences the corresponding gene, and achieves the purpose of preventing gene expression, with the advantages of specificity, high efficiency, easy operation, etc. SUMMARY

[0004] The present application provides a RNA interference fragment of crustacean hyperglycemic hormone gene and application thereof, which solves the problem of fighting behavior and reduces the yield of river crab in the process of cultivation.

[0005] The present application adopts the following technical scheme: a RNA interference fragment of crustacean hyperglycemic hormone gene, the nucleotide sequence of the RNA interference fragment is shown as SEQ ID NO: 1.

[0006] A RNA interference fragment of crustacean hyperglycemic hormone gene, the nucleotide sequence of the RNA interference fragment is shown as SEQ ID NO: 2.

[0007] A RNA interference fragment of crustacean hyperglycemic hormone gene, the nucleotide sequence of the RNA interference fragment is shown as SEQ ID NO: 3.

[0008] The application of the RNA interference fragment of crustacean hyperglycemic hormone gene is used in the preparation of a drug for inhibiting the fighting behavior of Eriocheir sinensis.

[0009] The application of the RNA interference fragment of crustacean hyperglycemic hormone gene, the RNA interference fragment is injected into the third leg of river crab in the form of injection, and is used for interfering with the expression amount of mRNA of crustacean hyperglycemic hormone gene CHH of river crab.

[0010] The present application has the following beneficial effects:

[0011] 1. The present application uses RNA interference technology to silence the expression of crustacean hyperglycemic hormone gene CHH in Eriocheir sinensis, effectively controls the fighting behavior of Eriocheir sinensis, is conducive to the improvement of yield in large-scale breeding of Eriocheir sinensis, and reduces the economic loss caused by the incomplete Eriocheir sinensis due to fighting.

[0012] 2. The RNA interference fragment provided in the present application has simple preparation method, and is simple to use and easy to popularize by using the injection method. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 The present application is a schematic diagram of the results of different RNA interference fragments and in vitro culture of thoracic ganglion of Eriocheir sinensis for 16 hours in the embodiments of the present application.

[0014] Figure 2 The present application is a schematic diagram of the influence of RNA interference fragments and RNA fragments of the comparative example injected into Eriocheir sinensis for 48 hours on the expression of CHH mRNA in Example 1 of the present application.

[0015] Figure 3 The present application is a result diagram of the influence of RNA interference fragments on the fighting behavior of Eriocheir sinensis in Example 5 of the present application. DETAILED DESCRIPTION

[0016] In order for those skilled in the art to better understand the present application, the technical solutions in the embodiments of the present application will be described clearly and completely below in combination with the drawings in the embodiments of the present application.

[0017] Example 1: The preparation method of the RNA interference fragment of the crustacean hyperglycemic hormone gene, comprising the following steps:

[0018] (1) dsRNA primer design

[0019] Put the CDS region of the target gene into the following website: http: / / www.detaibio.com / tools / index.php?r=transmembrane% for transmembrane region prediction, ensure that the designed dsRNA interference primer is not in the transmembrane region, design the interference fragment primer with Primer Premier 5, the primer length is about 20bp, the interference fragment length is 200-500bp, the GC content is 40%-60%, and the Tm value is 55℃-66℃. And add T7 promoter sequence (TAATACGACTCACTATAGGG) at the 5' end of the forward primer and reverse primer. In order to ensure that the final effective interference fragment is obtained, three interference fragments of dsCHH-1, dsCHH-2 and dsCHH-3 are designed. The interference fragment designed using EGFP gene is used as a control group, and the specific sequences of the upstream and downstream primers of dsCHH-1, dsCHH-2 and dsCHH-3 and EGFP gene are shown in Table 1;

[0020] (2) dsRNA template preparation

[0021] First, the target gene interference fragment is amplified, and the river crab tissue cDNA is used as the PCR amplification template, and the dsRNA primer is used to amplify the target gene interference fragment. The PCR reaction system is: 2×Taq PCR MasterMix, 10μL; forward Primer, 1μL; reverse Primer, 1μL; cDNA, 1μL; ddH2O, 7μL. The PCR reaction program is: 94℃, 5min; 94℃, 30s, 64℃, 30s, 72℃, 3min, 34 cycles; 72℃, 10min. The obtained PCR product is purified with DNA Clean & ConcentratorTM-5 (ZYMO RESEARCH, USA), and the DNA concentration is detected with Nanodrop 2000, and the high-concentration and high-quality interference fragment template DNA is obtained, and then the connection, transformation and sequencing are carried out in Sangon Company (Shanghai) to ensure that the interference fragment template sequence is correct.

[0022] (3) dsRNA interference fragment synthesis

[0023] Synthesis of dsRNA interference fragment according to Novagen T7 RNAi Transcription Kit (TR102) kit. Reaction system: 8 μL NTP Mix, 2 μL 10 x Transcription Buffer, 2 μL T7 Enzyme Mix, 1-4 μL DNA template (1 μg is added), RNase-free H2O is added to a total volume of 20 μL, and then 37°C reaction in PCR instrument for 2 h. The obtained transcription product, i.e. dsRNA, is subjected to double enzyme digestion, and the system is: Transcription Product, 20 μL; RNase-free H2O, 17 μL; DNase I, 1 μL; RAase T1 (10 U / μL), 2 μL, and the total reaction system is 40 μL. Then put into PCR instrument and incubate at 37°C for 30 min.

[0024] (4) Purification of dsRNA interference fragment

[0025] The dsRNA interference fragment is purified by phenol / chloroform extraction method. The digested dsRNA is added into an equal volume of phenol (water-saturated phenol / chloroform = 1:1), mixed at room temperature, and then centrifuged at 12000 rpm for 15 min at 4°C; the supernatant is transferred to a new 1.5 mL centrifuge tube, an equal volume of chloroform is added, and centrifuged at 12000 rpm for 15 min at 4°C; the supernatant is taken, 1 / 10 of the volume of 3M sodium acetate and 2.5 times the volume of anhydrous ethanol are added, and precipitated at -80°C for 3 h, and then centrifuged at 12000 rpm for 30 min at 4°C; the supernatant is discarded, 500 μL of 75% ethanol is added to wash the precipitate; centrifuged at 12000 rpm for 10 min at 4°C, and the ethanol is discarded; air-dried in a fume hood, and the precipitate is dissolved in an appropriate amount of DEPC water, and stored at -80°C for use.

[0026] Table 1 Sequence list of primers of dsCHH-1, dsCHH-2 and dsCHH-3 and EGFP gene

[0027]

[0028] The nucleotide sequences of the primers in the above Table 1 are shown in SEQ ID NO: 5-SEQ ID NO: 12, respectively.

[0029] Example 2: RNA interference fragment of crustacean hyperglycemic hormone gene, the nucleotide sequence of RNA interference fragment dsCHH-1 is: (SEQ ID NO: 1)

[0030] GCCTCGATTCTCATCCTCCCCCATGCACACGCCCGCTCAGCAGAAGGGTTCGGGCGCATGGAGAGGTTGCTGAGTCAACTGAGAGACGGTGCAGACTCCTCAGCAGCGTTGGGAGAGCTGAGTGTAGCCGGGGAGGGACCAGCCGGCCACCCTCTGGAGAAACGCCAGGCCTACGACCGCTCCCGCAAGGGCATCTACGACAGGTCCCTCTTCAGCAAGCTGGAACACGTGTGCGACGACTGCTTCAACCTCTACCGCTCGTCCCATGTCGCTAGTGGCTGCAGGAGAGACTGTTTCGACAATGATATGTTTGAGTACTGTGTGGAGGGCCTTCTGCTGGAAAACCCCGACCAGTT (SEQ ID NO: 2)

[0031] GCCTCGATTCTCATCCTCCCCCATGCACACGCCCGCTCAGCAGAAGGGTTCGGGCGCATGGAGAGGTTGCTGAGTCAACTGAGAGACGGTGCAGACTCCTCAGCAGCGTTGGGAGAGCTGAGTGTAGCCGGGGAGGGACCAGCCGGCCACCCTCTGGAGAAACGCCAGGCCTACGACCGCTCCCGCAAGGGCATCTACGACAGGTCCCTCTTCAGCAAGCTGGAACACGTGTGCGACGACTGCTTCAACCTCTACCGCTCGTCCCATGTCGCTAGTGGCTGCAGGAGAGACTGTTTCGACAATGATATGTTTGAGTACTGTGTGGAGGGCCTTCTGCTGGAAAACCCCGACCAGTT (SEQ ID NO: 3)

[0032] GGTGGTGGTGGTAGCTCTTGGCGCCTCGATTCTCATCCTCCCCCATGCACACGCCCGCTCAGCAGAAGGGTTCGGGCGCATGGAGAGGTTGCTGAGTCAACTGAGAGACGGTGCAGACTCCTCAGCAGCGTTGGGAGAGCTGAGTGTAGCCGGGGAGGGACCAGCCGGCCACCCTCTGGAGAAACGCCAGGCCTACGACCGCTCCCGCAAGGGCATCTACGACAGGTCCCTCTTCAGCAAGCTGGAACACGTGTGCGACGACTGCTTCA

[0033] Example 1: dsEGFP double-stranded RNA of enhanced green fluorescent protein, nucleotide sequence is: (SEQ ID NO: 4)

[0034] ACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGC

[0035] Example 3:

[0036] Healthy crabs were selected, and their thoracic ganglia were taken after being anesthetized on ice, and were added with 1 μg of interference fragments (dsEGFP, dsCHH-1, dsCHH-2, dsCHH-3), respectively, with dsEGFP as a control group, 6 repeats in each group. 200 μL of M199 culture medium containing 1% double antibody was added to each well, and the sample was taken and analyzed for CHH mRNA expression after being cultured in a 28°C constant temperature incubator for 16 hours.

[0037] In order to further determine the effective time of dsRNA in the body of river crab, the interference fragments were injected into the body of river crab at a dose of 1 μg / g from the third leg of river crab, and the thoracic ganglion was taken after 48 hours, quickly placed in liquid nitrogen and stored in a-80°C refrigerator. qRT-PCR was used to analyze the expression of CHH mRNA, and the specific sequence of CHH primer is shown in Table 2.

[0038] Table 2 CHH primer sequence

[0039] Name Nucleotide sequence (5'-3') CHH-F GTGGTTGGCAGGAAGAAGTAGA (SEQ ID NO: 13) CHH-R GCTGTGACGGAGATGGCTAAAA (SEQ ID NO: 14)

[0040] After the interference fragments were cultured with the Eriocheir sinensis thoracic ganglion for 16 hours, it was found that the three dsCHH interference fragments all reduced the expression level of CHH mRNA. Figure 1 As shown in FIG. 6, the dsCHH-1 and dsCHH-2 interference fragments were significantly lower than the dsEGFP group, and the dsCHH-3 interference fragment was extremely significantly lower than the dsEGFP group, which indicated that the dsCHH-1, dsCHH-2 and dsCHH-3 interference fragments could effectively inhibit the expression of CHH mRNA in the thoracic ganglion, and the interference effect of the dsCHH-3 was the best.

[0041] In order to further explore the effective time of the dsCHH interference fragment in the body, the brain ganglion and thoracic ganglion of the Eriocheir sinensis were taken after the dsCHH-3 interference fragment was injected into the body of the Eriocheir sinensis for 48 hours, and the results are shown in FIG. 7. Figure 2 As shown in FIG. 7, Figure 2 the CHH mRNA expression amount of the dsCHH-3 group in the brain ganglion (A) and Figure 2 the thoracic ganglion (B) was extremely significantly reduced compared with the dsEGFP group.

[0042] Example Four

[0043] Behavioral experiment

[0044] After the Eriocheir sinensis was individually cultured in a single culture system for 7 days, two crabs with a weight difference of not more than 4% were randomly selected to ensure that the appendages were complete and had no obvious damage. The dsEGFP and dsCHH-3 interference fragments were injected from the third walking leg of the Eriocheir sinensis at a dose of 1 μg / g, and then the Eriocheir sinensis was put back into the single culture system. After 48 hours, the Eriocheir sinensis was put into a circular barrel with an opaque partition. After the Eriocheir sinensis was adapted for 10 minutes, the fighting behavior was recorded for 1 hour by using a camera.

[0045] As shown in FIG. 8, Figure 3 the approaching times of the Eriocheir sinensis (A), Figure 3 the contact times (B) and Figure 3 the fighting times (C) were all significantly reduced, Figure 3 and the total fighting duration (D) was shortened but not significantly. These results all indicated that CHH could promote the fighting behavior of the Eriocheir sinensis, and the RNA interference fragment prepared by the present application could significantly reduce the fighting behavior of the Eriocheir sinensis. This provided a basis for the Eriocheir sinensis to be used for preparing a drug for preventing fighting behavior in large-scale culture. Figure 3

[0046] ​The above shows and describes the basic principles and main features of the present application and the advantages of the present application. Those skilled in the art should understand that the present application is not limited to the above embodiments, and the above embodiments and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application. The scope of protection of the present application is defined by the appended claims and their equivalents.

Claims

1. An RNA interference fragment of a hyperglycemic hormone gene in crustaceans, characterized in that: The nucleotide sequence of the RNA interference fragment is shown in SEQ ID NO:

1.

2. An RNA interference fragment of a hyperglycemic hormone gene in crustaceans, characterized in that: The nucleotide sequence of the RNA interference fragment is shown in SEQ ID NO:

2.

3. An RNA interference fragment of a hyperglycemic hormone gene in crustaceans, characterized in that: The nucleotide sequence of the RNA interference fragment is shown in SEQ ID NO:

3.

4. The application of the RNA interference fragment of the crustacean hyperglycemic hormone gene according to any one of claims 1-3 in the preparation of a drug for inhibiting fighting behavior in Chinese mitten crabs.

5. The application of the RNA interference fragment of the crustacean hyperglycemia hormone gene according to claim 4, characterized in that: RNA interference fragments were injected into the third walking leg of the crab to interfere with the mRNA expression of the high glycemic hormone gene CHH in the crab crustacean.

Images