Hippophae rhamnoides HrDof gene and application thereof

Abstract

The invention belongs to the technical field of bioengineering, and discloses a hippophae rhamnoides HrDof gene and application thereof. The invention provides a hippophae rhamnoides HrDof gene, a construction method of the hippophae rhamnoides HrDof gene and application of the hippophae rhamnoides HrDof gene in the aspect of improving the content of oil in tomato fruits. According to the invention, the HrDof gene is separated from sea-buckthorn pulp for the first time, and tomatoes are successfully transformed by constructing an overexpression vector and an agrobacterium-mediated method, so that the oil content of tomato fruits is increased by 2.34%. And a technical basis is provided for research on a grease synthesis accumulation mechanism of sea-buckthorn pulp and plant non-seed tissues.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering and relates to a seabuckthorn HrDof gene and application thereof. Background Art

[0002] Woody oil is an important source of high-quality and healthy vegetable oil. In-depth research on the mechanism of oil synthesis and accumulation will help improve the yield and quality of vegetable oil. Seabuckthorn is an important economic tree species for sand control and soil and water conservation. Its pulp oil is rich in biologically active substances that are beneficial to the human body and have high nutritional and medicinal value (such as 25-48% omega-7 fatty acids). It is widely used in daily chemicals, food and medicine, but the relatively low pulp oil content (about 20%) has always been a problem that restricts the increase of its oil production. Most vegetable oils exist in the form of triacylglycerol (TAG), and its biosynthesis mainly includes de novo synthesis of fatty acids in plastids and TAG assembly on the endoplasmic reticulum. The whole process involves multiple subcellular organelles (plastids, endoplasmic reticulum, etc.) and enzymatic reactions. It can be seen that the oil synthesis metabolic network is one of the most complex networks in nature. Studies have found that plant Dof and other transcription factors can regulate plant oil biosynthesis. For example, soybean transcription factors GmDof4 and GmDof11 can increase the oil content of Arabidopsis seeds by 4.7% to 9.1% by activating the expression of ACC genes. At present, the functional research of Dof gene is mostly based on experimental materials such as soybean, rapeseed, algae and other herbaceous plants, while the research on woody plants, especially seabuckthorn, is rare. For example, the sequence of seabuckthorn HrDof gene, vector construction, genetic transformation and functional analysis have not been reported, and there are still many unknowns in the mechanism of oil synthesis and accumulation in seabuckthorn pulp (not seeds). Summary of the invention

[0003] To make up for the deficiencies of the prior art, the present invention provides a seabuckthorn HrDof gene and its application, and successfully transforms tomatoes by constructing an overexpression vector and using the Agrobacterium-mediated method, thereby increasing the oil content of tomato fruits by 2.34%, providing a technical basis for the study of the oil synthesis and accumulation mechanism of seabuckthorn pulp and non-seed tissues of plants.

[0004] The above object of the present invention is achieved through the following technical solutions:

[0005] A seabuckthorn HrDof gene has a nucleotide sequence as shown in SEQ ID NO.1.

[0006] The present invention also provides a method for constructing the above-mentioned seabuckthorn HrDof gene, the specific steps of which are:

[0007] (1) Extracting RNA from seabuckthorn pulp and obtaining HrDof gene cDNA;

[0008] (2) Construction of H.b.bhamii HrDof gene overexpression vector;

[0009] (3) Transform Agrobacterium using the seabuckthorn HrDof gene overexpression vector.

[0010] Furthermore, in step (3): the culture medium of Agrobacterium rhizogenes (YEB) contains 25 mg / L rifampicin (Rif), 25 mg / L gentamicin (Gen) and 50 mg / L kanamycin (Kan).

[0011] The present invention also provides an application of the seabuckthorn HrDof gene in improving the oil content of tomato fruit.

[0012] The specific steps of application are:

[0013] S1. Transform Micro Tom tomatoes using the pCambia1301-HrDof recombinant expression vector;

[0014] S2. Molecular detection of transformed Micro Tom tomatoes;

[0015] S3. Determination of oil content in Micro Tom tomato fruit.

[0016] Furthermore, in step S1, the MS pre-culture solid culture medium used in the tomato transformation process has a formula of: 4.74 g / L MS culture medium powder, 30 g / L sucrose, 7 g / L agar powder, 0.5 mg / L 6-benzylaminoadenine (6-BA), 0.1 mg / L α-naphthaleneacetic acid (NAA), pH 6.0.

[0017] Furthermore, in step S1, the rooting medium used in the tomato transformation process is: 1 / 2MS+150mg / L timentin+5mg / L hygromycin.

[0018] The beneficial effects of the present invention compared with the prior art are:

[0019] (1) Seabuckthorn is a rare plant that accumulates high oil in its pulp (not seeds) tissue, with the pulp oil accounting for more than 30% of its dry weight. The present invention first discovered that a HrDof gene is significantly highly expressed during the pulp development of high-oil seabuckthorn varieties.

[0020] (2) The present invention is the first to isolate the HrDof gene from seabuckthorn pulp and successfully transform tomatoes by constructing an overexpression vector and Agrobacterium-mediated method, increasing the oil content of tomato fruit by 2.34%. This provides a technical basis for the study of the oil synthesis and accumulation mechanism of seabuckthorn pulp and non-seed tissues of plants.

[0021] (2) During the transformation of Agrobacterium with the overexpression vector, the Agrobacterium rhizogenes culture medium (YEB) used contained 25 mg / L rifampicin (Rif), 25 mg / L gentamicin (Gen), and 50 mg / L kanamycin (Kan), which effectively inhibited other bacteria, reduced contamination, and improved transformation efficiency.

[0022] (3) During the tomato transformation process, the improved MS medium used in leaf pre-culture, co-culture, screening differentiation culture and subculture rooting culture was used to improve the differentiation and rooting efficiency of the transformed tomatoes. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the plasmid map of pCambia1301-JC;

[0024] Figure 2 This is the regeneration system of seabuckthorn HrDof gene transformed tomato of the present invention; in the figure: Figure A is co-cultivation of infected leaves, Figure B is screening and differentiation of resistant seedlings, Figure C is germination of resistant seedlings, and Figure D is positive transformation plants. DETAILED DESCRIPTION

[0025] The present invention is described in detail below by specific examples, but the protection scope of the present invention is not limited. Unless otherwise specified, the experimental methods used in the present invention are all conventional methods, and the experimental equipment, materials, reagents, etc. used can be obtained from commercial channels.

[0026] Example 1

[0027] Extraction of RNA from seabuckthorn pulp and acquisition of HrDof gene cDNA

[0028] The mature fruits of the seabuckthorn variety "Gaoyou No. 1" were collected in Suihua City, Heilongjiang Province, and were quickly frozen in liquid nitrogen after picking. The seeds of the intact fruits were removed and ground with liquid nitrogen. The total RNA of seabuckthorn pulp was extracted and purified according to the recommended method of the column-type plant total RNA extraction and purification kit of Shanghai Shenggong Company. The cDNA was synthesized by reverse transcription using Oligo (dT) as the primer according to the method of the HiScript 1st Strand cDNA Synthesis Kit of Vazyme Company.

[0029] Using the above cDNA as a template, PCR amplification was performed using an upstream primer having a nucleotide sequence ATGTTCAATAACCCTTTTGA as shown in SEQ ID NO.2 and a downstream primer having a nucleotide sequence TCAAGATCTAGAGAACACCTGAA as shown in SEQ ID NO.3 as the upstream and downstream primers respectively.

[0030] The PCR reaction system is as follows:

[0031]

[0032] The reaction procedure was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min; and storage at 4°C.

[0033] The PCR product was detected by 1% agarose gel electrophoresis, and the target fragment was cut out on an ultraviolet gel imager to recover the purified DNA fragment, and then sequenced to verify the ORF sequence of H. buckthorn HrDof (size 843 bp), which has the nucleotide sequence shown in SEQ ID NO.1.

[0034] Example 2

[0035] Construction of HrDof gene overexpression vector of seabuckthorn

[0036] According to the HrDof gene sequence of seabuckthorn, an upstream primer (having the nucleotide sequence shown in SEQ ID NO.4) GCGGGTCGACGGTACCATGTTCAATAACCCTTTTGACG and a downstream primer (having the nucleotide sequence shown in SEQ ID NO.5) TAGACATATGGGTACCTCAAGATCTAGAGAACACCTG with a KpnI restriction enzyme site were designed. The above reverse transcribed cDNA was used as a template to amplify the target fragment containing the restriction enzyme site. The pCambia1301-KY linearized vector plasmid was subjected to restriction enzyme digestion, and the restriction enzyme digestion reaction system was as follows:

[0037]

[0038] After the enzyme digestion product is purified, a recombination reaction is carried out with the above PCR product (the recombination reaction kit is ClonExpress-II One Step Cloning Kit from Vazyme). The reaction system is as follows:

[0039]

[0040] The reaction solution was gently pipetted and mixed, and the reaction solution was collected at the bottom of the tube by brief centrifugation. Incubate at 37°C for 30 min, and then immediately cool on ice. The ligation product was transformed into E. coli DH5α, and transformants were screened on Kan resistance medium. Positive clones were selected to extract plasmids for restriction digestion identification. The vector map is shown in Figure 1 shown.

[0041] Example 3

[0042] Transformation of Agrobacterium with HrDof Gene Overexpression Vector of Seabuckthorn

[0043] Thaw 1 tube of GV3101 Agrobacterium on ice, add 5uL plasmid and mix well, freeze in liquid nitrogen for 1min, and place in a 37℃ water bath for 15min; add 800uL YEP medium, culture at 28℃ for 2-4h, centrifuge at 5000rpm for 3min, discard the supernatant, and resuspend the cells with 100uL YEP medium; spread the resuspended material on 25mg / LRif+50mg / L Kan+25mg / L Gen YEP plates and culture at 28℃ for 3 days. Pick a single colony and inoculate it in 25mg / L Rif+50mg / L Kan+25mg / L Gen YEP medium and culture overnight. Using the bacterial solution of a positive single colony as a template, PCR detection was performed using HrDof gene-specific primers. The product fragment was consistent with the size of the target gene, indicating that the Agrobacterium strain containing the recombinant expression vector pCambia1301-HrDof was successfully obtained.

[0044] Application Example 1

[0045] Example 3: Transformation of tobacco with the pCambia1301-HrDof recombinant expression vector prepared

[0046] Sow the sterilized tomato seeds on MS solid culture medium, culture them in the dark at 25°C overnight, and culture them in the light for 7 days. After the cotyledons unfold, take the explants and pre-culture them for 2 days (culture medium: MS+ZT+IAA) ( Figure 2 Figure A), Agrobacterium strain transformation, OD value was 0.6, infection for 10 min, co-culture for 2 days (medium: MS+ZT+IAA+AS) ( Figure 2 Figure B), dark culture. After about 2 months of screening and culture, seedlings will grow (culture medium: MS+ZT+IAA+300mg / L Timentin+10mg / L Hygromycin) Figure 2 C), removed and entered into rooting culture (22°C, culture medium: 1 / 2MS + 150mg / L timentin + 5mg / L hygromycin) Figure 2 Figure D).

[0047] Application Example 2

[0048] Molecular Detection of Transformed Tomato

[0049] The genomic DNA of the leaves of untransformed tomatoes and transformed tomatoes after Kan screening was extracted according to the genomic DNA extraction kit method of Tiangen Biochemical Technology Co., Ltd., and the genomic DNA was used as a template and PCR amplification was performed using seabuckthorn HrDof-specific primers. The reaction system and amplification conditions were as described in Example 1. The size of the target band was verified by 1% agarose gel electrophoresis. Three transgenic strains amplified bands with the same size as the target gene, while the WT plant had no amplified band, indicating that the HrDof gene had been successfully transferred into the tomato.

[0050] Application Example 3

[0051] Determination of oil content in tomato fruit

[0052] Using the chloroform-methanol method, the freeze-dried fruit powder was transferred to a glass test tube, methanol and chloroform (volume concentration percentage 2:1) were added, vortexed and ultrasonicated for 30 minutes, the supernatant was transferred to a new test tube, the residue was extracted again with chloroform-methanol solution, and the combined supernatant was added with 1 / 4 volume of potassium chloride solution (mass concentration 0.88%), the lower layer was collected into a glass sample bottle, and evaporated to constant weight. Oil content (%) = (m1-m2) / m×100; m1 is the mass of oil and glass sample bottle (g); m2 is the mass of glass sample bottle (g); m is the mass of dry sample powder (g), repeated 3 times.

[0053] 14 days after flowering, the oil content of untransformed tomato fruit was about 3.37%, while that of tomato fruit transformed with HrDof gene was 5.71%. It can be seen that transformation of seabuckthorn HrDof gene can increase the oil content of tomato fruit by 2.34%.

[0054] The above-described embodiments are only preferred embodiments of the present invention, but not all feasible embodiments of the present invention. For those skilled in the art, any obvious changes made thereto without departing from the principles and spirit of the present invention should be considered to be included in the scope of protection of the claims of the present invention.

Claims

1. A seabuckthorn HrDof gene, characterized in that It has the nucleotide sequence shown in SEQ ID NO.

1.

2. The method for constructing the HrDof gene of seabuckthorn as claimed in claim 1, characterized in that: The specific steps are: (1) Extracting RNA from seabuckthorn pulp and obtaining HrDof gene cDNA; (2) Construction of H.b.bhamii HrDof gene overexpression vector; (3) Transform Agrobacterium using the seabuckthorn HrDof gene overexpression vector.

3. Use of the Hippophae rhamnoides HrDof gene as claimed in claim 1 in increasing the oil content of tomato fruit.

4. The method for constructing the HrDof gene of seabuckthorn as claimed in claim 2, characterized in that: In step (3): the culture medium of Agrobacterium rhizogenes contains 25 mg / L rifampicin, 25 mg / L gentamicin and 50 mg / L kanamycin.

5. The use according to claim 3, characterized in that: The specific steps are: S1. Transform Micro Tom tomatoes using the pCambia1301-HrDof recombinant expression vector; S2. Molecular detection of transformed Micro Tom tomatoes; S3. Determination of oil content in Micro Tom tomato fruit.

6. The use according to claim 5, characterized in that: In step S1, the MS pre-culture solid culture medium used in the tomato transformation process has the following formula: 4.74 g / L MS culture medium powder, 30 g / L sucrose, 7 g / L agar powder, 0.5 mg / L 6-benzylaminoadenine, 0.1 mg / L α-naphthaleneacetic acid, pH 6.

0.

7. The use according to claim 5, characterized in that: In step S1, the rooting medium used in the tomato transformation process is: 1 / 2MS+150mg / L timentin+5mg / L hygromycin.

Images