OsLRK19 gene and application thereof in enhancing sheath blight resistance of rice

Abstract

The invention discloses an OsLRK19 gene and application thereof in enhancing rice sheath blight resistance, and belongs to the technical field of plant genetic engineering. A novel gene OsLRK19 capable of positively regulating and controlling the resistance of the rice sheath blight disease is identified, and greenhouse sheath blight disease resistance identification proves that after the gene is over-expressed in a rice plant, the rice is more resistant to the sheath blight disease, otherwise, after the gene is knocked out, the resistance of the rice to the sheath blight disease is remarkably reduced. Moreover, overexpression of the gene does not affect main agronomic traits of rice plants, which indicates that the OsLRK19 has potential breeding utilization value in the aspect of rice sheath blight resistance breeding, and an important gene resource is provided for research on a rice sheath blight resistance mechanism.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to an OsLRK19 gene and an application thereof in enhancing rice resistance to sheath blight. Background Art

[0002] Rice sheath blight is one of the main diseases in rice production, posing a significant threat to both yield and quality. In recent years, affected by global climate change and changes in agricultural farming patterns, the frequency and intensity of the disease have increased, seriously restricting the sustainable development of the rice industry. At present, the prevention and control of sheath blight mainly relies on chemical agents. This prevention and control method not only increases production costs, but also causes serious pollution to the ecological environment, which is contrary to the concept of green development of modern agriculture. Therefore, using disease-resistant genes to breed disease-resistant varieties has become the most economical and effective strategy for controlling sheath blight.

[0003] However, as a quantitative trait controlled by multiple genes, there are currently no major resistance genes available for sheath blight resistance. So far, only a very small number of sheath blight resistance QTLs have been precisely located and can be used for practical applications, which makes it very difficult to breed sheath blight-resistant varieties through marker-assisted selection. At the same time, the use of traditional genetic methods for gene cloning and functional analysis often requires a large amount of experimental materials and long-term phenotypic identification, and the research efficiency is low. In contrast, the combination of reverse genetics with omics technologies such as genomics and transcriptomics provides a new solution to this problem. By screening differentially expressed genes or gene sets related to specific traits through omics technology, and then using reverse genetics technology for systematic verification and cloning, it is possible to more comprehensively and efficiently explore gene resources related to specific biological processes. Therefore, exploring and cloning more genes involved in regulating sheath blight resistance will provide a basis for further studying the molecular mechanism of gene regulation of sheath blight resistance, which has important theoretical value. L-type Lectin Receptor-like Kinases (L-type LecRLKs) are an important class of receptor kinases in plants. Although the functions of L-type LecRLKs in plant immune regulation have been widely studied, their role in regulating rice sheath blight resistance has not been reported and needs further exploration. Summary of the invention

[0004] Purpose of the invention: In view of the deficiencies in the prior art, the present invention provides a gene OsLRK19 that can enhance the resistance of rice to sheath blight. The present invention identifies a new gene OsLRK19 that regulates resistance to rice sheath blight. The present invention uses genetic engineering to obtain plants that overexpress the OsLRK19 gene, which significantly improves the resistance to sheath blight without affecting the main agronomic traits.

[0005] The present invention also provides the application of the rice sheath blight resistance regulating gene OsLRK19.

[0006] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a gene OsLRK19 that can enhance the resistance of rice to sheath blight. The CDS sequence of the gene OsLRK19 is shown in SEQ ID NO.1.

[0007] Among them, the primer pair used to amplify the gene OsLRK19 is:

[0008] OsLRK19-F:5'-ATGGCGAAGCAAGCAACC-3',

[0009] OsLRK19-R:5'-TTATCCTTCTTCCAAGAG-3'.

[0010] The invention discloses an overexpression vector pU1301-OsLRK19 containing the gene OsLRK19 capable of enhancing the resistance of rice to sheath blight.

[0011] Among them, the construction method of the overexpression vector pU1301-OsLRK19 is to design primers OsLRK19_OE-F: CGAACGATAGCCGGTACCATGGCGAAGCAAGCAACC and OsLRK19_OE-R: GTCGACTCTAGAGGATCCTCCTTCTTCCAAGAGGC with pU1301 vector linkers, amplify the CDS sequence of the OsLRK19 gene, recombinantly connect it to the pU1301 vector, transform it into Escherichia coli and verify it by sequencing, and finally obtain the overexpression vector pU1301-OsLRK19.

[0012] The invention is based on the gene knockout vector pOs-OsLRK19 of the gene OsLRK19 capable of enhancing the resistance of rice to sheath blight.

[0013] The gene knockout vector construction method comprises the following steps: designing and synthesizing sgRNA that recognizes the target site: 5'-TCTCCGCCTCGTTCGTGTTCGG-3', adding a linker to the first 19 base sequences of CGG as follows: OsLRK19_sg-F: 5'-TGTG-G(TCTCCGCCTCGTTCGTGTT)-3', OsLRK19_sg-R: 5'-AAAC-(AACACGAACGAGGCGGAGA)C-3', obtaining an intermediate product by primer annealing to introduce the knockout target of OsLRK19, connecting the intermediate product with the enzyme-cut linear vector pOs, transforming Escherichia coli and verifying by sequencing, and finally obtaining the gene knockout vector pOs OsLRK19.

[0014] The invention discloses an application of the gene OsLRK19 capable of enhancing the resistance of rice to sheath blight, or the overexpression vector or the gene knockout vector in regulating the resistance of rice to sheath blight.

[0015] Among them, by overexpressing the OsLRK19 gene, the rice's resistance to sheath blight was increased and its susceptibility to the disease was reduced.

[0016] Among them, editing the OsLRK19 gene through CRISPR / Cas9 reduced rice resistance to sheath blight and increased its susceptibility to the disease.

[0017] The invention discloses an application of the gene OsLRK19 capable of enhancing the resistance of rice to sheath blight, or the overexpression vector or the gene knockout vector in cultivating rice germplasm with strong resistance to sheath blight.

[0018] The present invention provides a method for cultivating transgenic rice resistant to sheath blight. The specific method is to use any vector that can guide the expression of exogenous genes in plants, introduce the sheath blight resistance gene OsLRK19 provided by the present invention into plant cells, and obtain transgenic cell lines and transgenic strains with enhanced sheath blight resistance. When the gene of the present invention is constructed into a plant expression vector, any general promoter, enhanced promoter or inducible promoter can be added before its transcription start nucleotide, such as cauliflower mosaic virus (CAMV) 35S promoter, corn ubiquitin promoter (Ubiquitin), which can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.), etc. The expression vector of the gene described in the present invention can be transformed into plant cells or tissues by conventional biological methods such as Agrobacterium-mediated, Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, and conductivity, and the transformed plant tissues can be cultivated into plants.

[0019] The present invention identifies a new gene OsLRK19 that positively regulates rice sheath blight resistance. Greenhouse sheath blight resistance identification proves that after overexpressing the gene in rice plants, rice becomes more resistant to sheath blight. Conversely, after the gene is knocked out, rice resistance to sheath blight is significantly reduced. Moreover, overexpression of the gene does not affect the main agronomic traits of rice plants, indicating that OsLRK19 has potential breeding value in rice sheath blight resistance breeding.

[0020] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0021] The present invention identifies a new gene OsLRK19 for regulating rice sheath blight resistance. The sheath blight resistance gene OsLRK19 of the present invention positively regulates rice sheath blight resistance. Overexpression of the gene can significantly enhance rice resistance to sheath blight, while knocking out the gene significantly weakens rice resistance to sheath blight. After investigating the agronomic traits of the transgenic strains of the gene, it was found that the plant height, tillering number, heading date, number of grains per panicle, fruit setting rate and thousand-grain weight of the overexpression line plants were not affected, the plant height, number of grains per panicle and fruit setting rate of the knockout line plants were reduced or decreased, and there were no significant differences in other traits, indicating that the gene has potential breeding application value in molecular breeding for sheath blight resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Figure 1 is the expression pattern of the OsLRK19 gene: Figure A is the expression level of the OsLRK19 gene in different rice tissues; Figure B is the expression characteristics of the OsLRK19 gene in the wild type at different times of inoculation with sheath blight.

[0023] Figure 2 Figure 1 shows the RNA and protein level detection results of OsLRK19 gene overexpression strains: Figure A shows the protein level detection results of OsLRK19 gene T0 overexpression plants; Figure B shows the RNA level detection results of three strains of OsLRK19 gene T0 overexpression plants OsLRK19-OE#2, OsLRK19-OE#11 and OsLRK19-OE#13.

[0024] Figure 3 Figure 1 shows the gene variation types and protein sequence changes of the three knockout strains of the OsLRK19 gene: Figure A shows the gene variation types of the three knockout strains of the OsLRK19 gene; Figure B shows the protein sequence changes of the three knockout strains of the OsLRK19 gene.

[0025] Figure 4The results of greenhouse sheath blight resistance identification of three overexpression and three knockout strains of OsLRK19 gene and wild type: Figure A shows the phenotype and lesion length results of greenhouse sheath blight resistance identification of three overexpression strains of OsLRK19 gene; Figure B shows the phenotype and lesion length results of greenhouse sheath blight resistance identification of three knockout strains of OsLRK19 gene. "*" indicates a significant difference at the 5% level, i.e. p≤0.05; "**" indicates an extremely significant difference at the 1% level, i.e. P≤0.01. Scale bar = 5 cm.

[0026] Figure 5 The main agronomic traits of the three overexpression and three knockout lines of OsLRK19 gene and the wild type are investigated: Figure A shows the whole plant phenotype of the three overexpression and three knockout lines of OsLRK19 gene and the wild type, scale = 10 cm; Figure B shows the plant height, heading date, tiller number, number of grains per ear, fruiting rate and 1000-grain weight of the three overexpression and three knockout lines of OsLRK19 gene and the wild type. "*" indicates a significant difference at the 5% level, i.e., p≤0.05; "**" indicates an extremely significant difference at the 1% level, i.e., P≤0.01. DETAILED DESCRIPTION

[0027] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0028] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0029] The experimental methods without specific conditions in the examples are usually carried out under conventional conditions or conditions recommended by the manufacturers.

[0030] The rice genetic transformation material in the present invention is the japonica rice variety Nipponbare (NIP), which is provided by the rice germplasm resource bank of Yangzhou University.

[0031] The sheath blight strain used in the present invention is a moderately strong pathogenic strain YN-7 provided by Yangzhou University (Lee D Yet et al, BMC Genomics. 2021Apr 7; 22(1): 242.).

[0032] The knockout vector pOs and the overexpression vector pU1301 are both known vectors, as described in Targeted mutagenesis in rice using CRISPR-cas system (Miao et al, Cell Research. 2013 Oct; 23(10): 1233-1236) and OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling (Qiu et al, Molecular Plant-microbe Interactions. 2007 May; 20(5): 492-499). Both are preserved and provided by Yangzhou University.

[0033] Example 1

[0034] Identification and cloning of OsLRK19 gene

[0035] The method for cloning the OsLRK19 gene comprises the following steps:

[0036] Using the genome of rice variety NIP as reference sequence, PCR amplification primers for OsLRK19 gene were designed:

[0037] OsLRK19-F:5'-ATGGCGAAGCAAGCAACC-3',

[0038] OsLRK19-R:5'-TTATCCTTCTTCCAAGAG-3',

[0039] The cDNA of rice variety NIP was used as a template for PCR amplification. The PCR amplification method was referred to the instruction manual of Novizan PhantaMax Super-Fidelity DNA Polymerase. The PCR amplification product was recovered and purified (Tiangen Ordinary Agarose Gel DNA Recovery Kit DP209) and sequenced (Qingke Biotechnology Co., Ltd.) to obtain the correct CDS sequence of the OsLRK19 gene.

[0040] The CDS sequence of the rice OsLRK19 gene of the present invention is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.2.

[0041] Example 2

[0042] Analysis of expression characteristics of OsLRK19 gene

[0043] RNA samples from different tissues (roots, stems, leaves, leaf sheaths, and panicles) of rice varieties susceptible to NIP were collected during the booting period, and the total RNA of each rice sample was extracted using the Trizol method. The first-strand cDNA was synthesized by ⅢRT SuperMix for qPCR (Nanjing Novizan Biotechnology Co., Ltd.) reverse transcriptase, and the synthesis method was carried out according to the instructions of its reverse transcriptase. Using the cDNA of the above-mentioned different tissues as templates, the rice OsActin gene was used as an internal reference gene (OsActin gene quantitative primers qActin-F: 5'-CTAAGCCAAGAGGAGCTGTTAT-3' and qActin-R: 5'-ATAACAGATAGGCCGGTTGAAA-3'), and OsLRK19 gene specific quantitative primers (qLRK19-F: 5'-TTCGGTCTCGCCAGATTGTACG-3' and qLRK19-R: 5'-TCCTATTGTGCCGACGACATGC-3') were used for real-time quantitative PCR to detect the expression level of OsLRK19 gene in different rice tissues. The qRT-PCR reaction system was: qPCR Master Mix (Nanjing Novogene Biotechnology Co., Ltd.) 5μL, front and back primers 0.5μl (10μmol / L), cDNA template 5μl (100ng / μl). The qRT-PCR reaction was performed using the Bio-Rad CFX96 TouchTM fluorescent quantitative PCR instrument under the following conditions: 95°C pre-denaturation for 3min; 95° denaturation for 15s, 60° annealing extension for 30s, 40 cycles. The expression value data were converted and analyzed using the 2-△△ct method. The reaction conditions were: 95°C, 30sec, 95°C, 10sec, 60°C, 10sec, 40 cycles of reaction; 95°C, 15sec, 60°C, 60sec, 95°C, 15sec to read the melting curve.

[0044] NIP was cultured in a normal field environment until the end of tillering and inoculated with Rhizoctonia solani YN-7. The embedding method was used for inoculation (Pan Xuebiao, Journal of Jiangsu Agricultural College, 1997, (03): 28-33). The 1 cm long and 2 mm wide wood bark (covered with hyphae) attached with Rhizoctonia solani YN-7 hyphae was carefully embedded into the leaf sheath 1 cm-2 cm below the second leaf of the rice. The rice leaf sheath tissues of the 1 cm section above and below the inoculum were cut before inoculation (0 h) and 6 h, 9 h, 12 h, 24 h and 48 h after inoculation, and stored in liquid nitrogen. The experimental process of RNA extraction, reverse transcription and qRT-PCR was the same as the above steps for determining the expression level of rice tissue.

[0045] like Figure 1As shown in A, the OsLRK19 gene has high expression levels mainly in roots, leaves and leaf sheaths, among which the expression level in roots is the highest; Figure 1 As shown in B, the OsLRK19 gene showed a characteristic of continuous up-regulation after infection by sheath blight.

[0046] Example 3

[0047] Vector construction, genetic transformation and detection

[0048] 1. Steps for constructing CRISPR / Cas9 knockout vector for rice OsLRK19 gene:

[0049] (1) Select a target site with high knockout efficiency, design and synthesize sgRNA that recognizes the target site, and the sequence is sgRNA: 5'-TCTCCGCCTCGTTCGTGTTCGG-3'. Add a linker to the first 19 base sequences of CGG as follows: OsLRK19_sg-F: 5'-TGTG-G(TCTCCGCCTCGTTCGTGTT)-3', OsLRK19_sg-R: 5'-AAAC-(AACACGAACGAGGCGGAGA)C-3'.

[0050] (2) The intermediate product was obtained by primer annealing to introduce the knockout target of OsLRK19. The reaction system and conditions were as follows: 1 μL of the front primer OsLRK19_sg-F (10 μM), 1 μL of the rear primer OsLRK19_sg-R (10 μM), 8 μL of Anneal Buffer (1xTE buffer, 50 mM NaCl), 95°C for 10 min, and then decreased to 20°C at 0.1°C / sec.

[0051] (3) The restriction endonuclease BsaI (Takara) was used to cut the specific restriction site on the pOs vector to make it linear. The restriction endonuclease reaction system and conditions were as follows: 1 μg of plasmid, 5 μL of 10x buffer, 1 μL of BsaI, 50 μL of ddH2O, 37°C for 2-3 h, and recovered according to the DNA purification kit (Tiangen Ordinary Agarose Gel DNA Recovery Kit DP209).

[0052] (4) The annealed intermediate product was connected to the pOs linear vector after enzyme digestion. The connection reaction system and conditions were as follows: 2 μL of annealed product, 2 μL of linear vector, 0.5 μL of 10x T4 DNA Ligase Buffer, 0.5 μL of T4 DNA Ligase, and room temperature for 15 min.

[0053] (5) Transform E. coli DH5α. After the DH5α competent cells melt, add the ligation product from the previous step, place on ice for 30 min, heat shock at 42°C for 90 sec, place on ice for 2 min, add 700 μL of LB liquid medium without antibiotics, culture at 37°C at 200 rpm for 1 h, centrifuge at 5000 rpm for 1 min, discard most of the supernatant, retain 100 μL of the liquid, pipette and mix, spread on an LB solid medium plate containing kanamycin, and culture at 37°C for 12 h.

[0054] (6) Pick a single clone and place it in liquid LB medium containing kanamycin, culture it at 37°C for 6 h, and perform a PCR reaction on the bacterial solution. The PCR reaction is performed according to the conventional PCR amplification instructions of Novizan 2× Taq Master Mix (Dye Plus), where the primer sequences of the PCR reaction are:

[0055] M13F: 5'-TGTAAAACGAGCGGCCAGT-3',

[0056] OsLRK19_sg-R: 5'-AAACAACACGAACGAGCGGAGAC-3',

[0057] The positive monoclonal bacterial solution was propagated, the plasmid was extracted and sequenced to obtain the gene knockout vector pOs-OsLRK19. The plasmid extraction kit was (NoviZan Plasmid Mini Kit), and the sequencing company was Qingke Biotechnology Co., Ltd.

[0058] (7) The recombinant positive plasmid was transformed into Agrobacterium EHA105. The reaction system and conditions were as follows: 50 μL EHA105 competent cells, 1 μL recombinant plasmid, ice bath for 5 min, liquid nitrogen quick freezing for 5 min, 37°C water bath for 5 min, ice bath for 5 min. Add 700 μL LB liquid medium without antibiotics, culture at 28°C 200 rpm for 2 h, centrifuge at 5000 rpm for 1 min, discard most of the supernatant, keep 100 μL of liquid, pipette and mix, spread on LB solid medium plate containing kanamycin and rifampicin antibiotics, and culture at 28°C for two days.

[0059] (8) Pick a single clone and place it in a liquid LB medium containing kanamycin and rifampicin, culture it at 28°C for two days, and perform a PCR reaction on the bacterial solution, where the PCR reaction is the same as step (6). The positive single clone bacterial solution can be used for subsequent rice genetic transformation experiments.

[0060] 2. The steps for constructing the overexpression vector are as follows:

[0061] (1) Using the CDS of the OsLRK19 gene as a reference sequence, primers with pU1301 vector adapters were designed and synthesized. The primer sequences were: OsLRK19_OE-F: CGAACGATAGCCGGTACCATGGCGAAGCAAGCAACC and OsLRK19_OE-R: GTCGACTCTAGAGGATCCTCCTTCTTCCAAGAGGC. Then, the CDS of the OsLRK19 gene was used as a template and amplified using a high-fidelity enzyme (PhantaMax Super-Fidelity DNA Polymerase) to obtain the CDS fragment of the OsLRK19 gene with the pU1301 vector adapter.

[0062] (2) The overexpression vector pU1301 was linearized by restriction endonucleases KpnI and BamHI (Takara). The restriction endonucleases and reaction conditions were the same as those in step 1 (3).

[0063] (3) Through homologous recombination enzyme (NoviZan IIOne Step Cloning Kit) was used to connect the OsLRK19 gene CDS with the linearized vector pU1301 to obtain the recombinant plasmid pU1301-OsLRK19.

[0064] (4) The subsequent experimental operations are the same as steps 1(5)-1(8) to obtain the overexpression vector Agrobacterium culture, where the culture PCR detection primers are:

[0065] OsLRK19-JCF: CCAGGTTATGCTGGTTGAC,

[0066] pU1301-R:GGACACGCTGAACTTGTG.

[0067] 3. The constructed knockout and overexpression vector Agrobacterium culture liquid was sent to Weimi Biotechnology Co., Ltd. for rice genetic transformation. The recipient rice variety was Nipponbare (NIP). After the rice genetic transformation was completed, the knockout lines (oslrk19-ko1, oslrk19-ko2 and oslrk19-ko3) and overexpression lines (OsLRK19-OE#2, OsLRK19-OE#11 and OsLRK19-OE#13) were obtained for plant testing.

[0068] 4. Detection of genetically modified rice plants

[0069] (1) For the knockout plants, primers were designed and synthesized on both sides of the knockout target site, and the obtained T0 transgenic plants were sequenced. The sequencing primer sequences were:

[0070] OsLRK19-CXF: CCTAGTGCTCTGCGTGGTCG,

[0071] OsLRK19-CXR:GATGTCGCGGAACTCGTCC.

[0072] like Figure 2 As shown in A, there are three types of mutations in the transgenic knockout lines, among which oslrk19-ko1 has base C inserted, oslrk19-ko2 has two bases missing, and oslrk19-ko3 has base A inserted. All three mutations lead to changes in the amino acid sequence and premature termination of protein translation ( Figure 2 B).

[0073] (2) For overexpression plants, firstly, Western Blot detection was performed on all T0 plants using GFP antibody ( Figure 3 A); then the RNA levels of three strains with higher protein expression levels, OsLRK19-OE#2, OsLRK19-OE#11 and OsLRK19-OE#13, were further tested, such as Figure 3 As shown in B, compared with the wild type, the expression levels of OsLRK19 gene in the three overexpression strains increased by 12.53, 14.13, and 12.40 times, respectively. The primer sequences for qRT-PCR were qLRK19-F: 5'-TTCGGTCTCGCCAGATTGTACG-3' and qLRK19-R: 5'-TCCTATTGTGCCGACGACATGC-3'.

[0074] Example 4

[0075] Identification of resistance to sheath blight in transgenic rice plants

[0076] The greenhouse sheath blight fungus inoculation method was used to identify the sheath blight resistance of the wild type (WT, NIP), knockout lines (oslrk19-ko1, oslrk19-ko2 and oslrk19-ko3) and overexpression lines (OsLRK19-OE#2, OsLRK19-OE#11 and OsLRK19-OE#13) of this gene.

[0077] The method for identifying resistance to greenhouse sheath blight is as follows:

[0078] When the rice plants grow to the 3-leaf stage, they are transplanted into long pots, with 5 plants per pot. After culturing to the end of tillering, they are moved to the glass greenhouse. When the rice plants grow to the early stage of booting, they are inoculated by embedding method. Before inoculation, the plants with natural disease and dead plants and small or redundant tillers are pruned. Use tweezers to carefully embed the 1cm long and 2mm wide wood bark (covered with hyphae) with the hyphae of Rhizoctonia solani YN-7 into the inner side of the leaf sheath 1cm below the third leaf pillow from top to bottom. Each seedling is inoculated with 5 stems with relatively consistent growth periods. After inoculation, ensure that there is a water layer of no less than 1cm in the long pot, set the temperature and light conditions in the greenhouse to 14h light (30℃) / 10h dark (24℃), and use a spray humidifier to control the humidity in the greenhouse at 75%-90%. Investigate the length of the lesions 7d after inoculation.

[0079] When using greenhouse artificial inoculation, Figure 4 As shown, the average lesion lengths of the three transgenic overexpression lines OsLRK19-OE#2, OsLRK19-OE#11 and OsLRK19-OE#13 (14.12 cm, 13.72 cm and 12.75 cm, respectively) were significantly or extremely significantly lower than those of the wild-type NIP plants (16.56 cm), while the average lesion lengths of the three transgenic knockout lines oslrk19-ko1, oslrk19-ko2 and oslrk19-ko3 (12.55 cm, 12.96 cm and 13.10 cm, respectively) were significantly or extremely significantly higher than those of the wild-type NIP plants (10.55 cm). The above results indicate that the gene OsLRK19 positively regulates rice sheath blight resistance, and the sheath blight resistance of rice can be significantly improved by overexpressing the gene.

[0080] Example 5

[0081] Investigation of agronomic traits of transgenic rice plants

[0082] In the field, the main agronomic traits of each transgenic line of the gene were investigated at the rice maturity stage, and the measurements were performed on a plant-by-plant basis, including plant height, tiller number, heading date, number of grains per panicle, seed setting rate, and thousand-grain weight ( Figure 5 The results showed that the plant height, tillering number, heading date, number of grains per panicle, fruit setting rate and 1000-grain weight of the OsLRK19 gene overexpression line were not affected, while the plant height, number of grains per panicle and fruit setting rate of the knockout line were reduced or decreased, and there were no significant differences in other traits, which indicated that the gene had potential application value in rice breeding for resistance to sheath blight.

Claims

1. A gene OsLRK19 that can enhance rice resistance to sheath blight, characterized in that: The CDS sequence of the gene OsLRK19 is shown in SEQ ID NO.

1.

2. The gene OsLRK19 capable of enhancing rice resistance to sheath blight according to claim 1, characterized in that: The primer pair used to amplify the gene OsLRK19 is preferably: OsLRK19-F:5'-ATGGCGAAGCAAGCAACC-3', OsLRK19-R:5'-TTATCCTTCTTCCAAGAG-3'.

3. An overexpression vector pU1301-OsLRK19 containing the gene OsLRK19 capable of enhancing the resistance of rice to sheath blight as claimed in claim 1.

4. The overexpression vector pU1301-OsLRK19 according to claim 3, characterized in that The overexpression vector pU1301-OsLRK19 is constructed by designing primers OsLRK19_OE-F: CGAACGATAGCCGGTACCATGGCGAAGCAAGCAACC and OsLRK19_OE-R: GTCGACTCTAGAGGATCCTCCTTCTTCCAAGAGGC with a pU1301 vector linker, amplifying the CDS sequence of the OsLRK19 gene, recombining and connecting it to the pU1301 vector, transforming Escherichia coli and verifying by sequencing, and finally obtaining the overexpression vector pU1301-OsLRK19.

5. A gene knockout vector pOs-OsLRK19 based on the gene OsLRK19 capable of enhancing the resistance of rice to sheath blight according to claim 1.

6. The gene knockout vector pOs-OsLRK19 according to claim 5, characterized in that: The gene knockout vector construction method comprises the following steps: designing and synthesizing an sgRNA that recognizes a target site: 5'-TCTCCGCCTCGTTCGTGTTCGG-3', adding a linker to the first 19 base sequences of CGG as follows: OsLRK19_sg-F: 5'-TGTG-G(TCTCCGCCTCGTTCGTGTT)-3', OsLRK19_sg-R: 5'-AAAC-(AACACGAACGAGGCGGAGA)C-3', obtaining an intermediate product by primer annealing to introduce a knockout target of OsLRK19, connecting the intermediate product with a linear vector pOs cut by enzyme digestion, transforming Escherichia coli and verifying by sequencing, and finally obtaining a gene knockout vector pOs-OsLRK19.

7. Use of the gene OsLRK19 capable of enhancing rice resistance to sheath blight as claimed in claim 1, or the overexpression vector as claimed in claim 3, or the gene knockout vector as claimed in claim 5 in regulating rice resistance to sheath blight.

8. The use according to claim 7, characterized in that: By overexpressing the OsLRK19 gene, the rice resistance to sheath blight was increased and its susceptibility to the disease was reduced.

9. The use according to claim 7, characterized in that: Editing the OsLRK19 gene through CRISPR / Cas9 reduced rice resistance to sheath blight and increased its susceptibility to the disease.

10. Use of the gene OsLRK19 capable of enhancing rice resistance to sheath blight according to claim 1, or the overexpression vector according to claim 3, or the gene knockout vector according to claim 5 in cultivating rice germplasm with strong resistance to sheath blight.

Images