PagCMT2 gene and application thereof in wood improvement

Abstract

The invention relates to the technical field of gene engineering, in particular to a PagCMT2 gene and application of the PagCMT2 gene in wood improvement. The nucleotide sequence of the PagCMT2 gene is as shown in SEQ ID No. 1. According to the invention, a gene PagCMT2 in Popula alba * Popula glatulosa (poplar, 84K) is identified, and the PagCMT2 gene is knocked out by utilizing a CRISPR / Cas9 gene editing technology, so that the thinning of a secondary wall and cell expansion can be promoted, and the characteristics of wood cells are changed, thereby obtaining an improved forest variety pagcmt2 mutant with thinned secondary cell wall and enlarged cells.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and specifically to a PagCMT2 Genes and their use in improving wood. Background Art

[0002] As an important renewable resource, wood plays an indispensable role in the development of human civilization. As one of the most abundant biomass energy sources on the earth, wood is not only widely used in traditional fields such as pulp and paper making, construction and building materials, but also plays an important role in emerging fields such as modern biomass energy and cellulose derivatives. From a botanical perspective, the formation of wood is a complex biological process, which is mainly determined by the continuous development of secondary xylem. The secondary xylem originates from the vascular cambium, and its structure is mainly composed of fiber cells and vascular cells with thickened cell walls. In woody plants, the secondary xylem is composed of specialized cells with significantly thickened secondary walls (SCW). After these cells stop expanding, they will deposit on the inner side of the primary cell wall to form a secondary wall. This relatively thick and hard fibrous secondary cell wall not only provides the necessary mechanical support for the plant, but also undertakes the important function of transporting water and nutrients in the plant vascular cells. From the perspective of chemical composition, the secondary cell wall is mainly composed of three major components: cellulose, hemicellulose and lignin. The biosynthesis of these components involves a series of complex biosynthetic pathway enzymes. Given that the formation of secondary walls directly affects the quality and properties of wood, in-depth research on the molecular mechanism of secondary wall biosynthesis in woody plants will not only help to reveal the basic laws of plant growth and development, but also provide an important theoretical basis for improving wood quality and increasing wood utilization. It has important scientific significance and practical value for promoting the sustainable development of forestry and the efficient utilization of biomass resources.

[0003] In woody plants, CMT2 ( CHROMOMETHYLASE 2 ) gene, as an important member of the DNA methyltransferase family, has received increasing attention in recent years. Current research shows that CMT2 Genes play an important role in the growth and development, environmental adaptation and secondary metabolism regulation of woody plants. In model woody plants such as poplar, CMT2 Genes participate in regulating gene expression and genome stability by catalyzing DNA methylation at CHH sites (H is A, T, or C). In addition, DNA methylation, as an epigenetic regulatory mechanism, may indirectly participate in the wood formation process by affecting the expression of related genes. However, compared with annual plants, woody plants CMT2 There are still many unknowns about the functional differentiation and regulatory mechanisms of genes, especially the mechanisms of action in the growth and development processes unique to perennial woody plants, such as wood formation, which still need further exploration. Summary of the invention

[0004] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide a PagCMT2 Genes and their use in improving wood. The present invention identifies Populus alba×Populus glandulosa A gene in Populus argenteum (84K) PagCMT2 , and determined its function in the wood formation process through CRISPR / Cas9 gene editing technology.

[0005] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is: On the one hand, there is provided a PagCMT2 The gene has a nucleotide sequence as shown in SEQ ID No.1.

[0006] On the other hand, providing PagCMT2 Genetic applications in wood modification, missing PagCMT2 The gene can inhibit the thickening of secondary walls, promote cell expansion, and change the characteristics of wood cells, thereby obtaining trees with thinner secondary cell walls and larger cells.

[0007] Further, PagCMT2 The method for genetically modifying wood specifically comprises the following steps: Step 1. Clone PagCMT2 Gene and design target primers; Step 2: Construct a gRNA expression cassette and connect the gRNA expression cassette to the pYLCRISPR / Cas9 vector to construct PagCMT2 Gene knockout vectors; Step 3: PagCMT2 The gene knockout vector was transferred into Agrobacterium GV3101, and the leaves of Populus argentatus tissue culture seedlings were infected, proliferated, differentiated, and rooted by Agrobacterium-mediated method to obtain forest tree varieties. pagcmt2 Mutant.

[0008] Furthermore, in step 1, the target primers are CMT2-AtU3dT1F, CMT2-AtU3dT1R, CMT2-AtU3bT2F, CMT2-AtU3bT2R, and their nucleotide sequences are as follows: CMT2-AtU3dT1F: GTCAGAAATCGTCATCATCACCAA; CMT2-AtU3dT1R: AAACTTGGTGATGATGACGATTTC; CMT2-AtU3bT2F: GTCATTTCCCTCAGACGATCTCCG; CMT2-AtU3bT2R: AAACCGGAGATCGTCTGAGGGAAA.

[0009] The beneficial effects of the present invention are: This study identified a gene in Populus alba × Populus glandulosa (84K) PagCMT2 , knocked out using CRISPR / Cas9 gene editing technology PagCMT2 Genes can promote secondary wall thinning and cell expansion, change wood cell characteristics, and thus obtain forest tree varieties with thinner secondary cell walls and larger cells pagcmt2 Mutant. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 for PagCMT2 Sequencing identification diagram of gene knockout strains; Figure 2 Wild-type Populus argenteum and pagcmt2 The plant phenotype of mutant silver gland poplar; Figure 3 Wild-type Populus argenteum and pagcmt2 Schematic diagram of the plant height and stem diameter at the base of the mutant silver gland poplar; Figure 4 Wild-type Populus argenteum and pagcmt2 Optical image of a section of mutant Populus argentatus; Figure 5 Wild-type Populus argenteum and pagcmt2 Schematic diagram of the comparison of xylem width and cambium width of the mutant silver gland poplar; Figure 6 Wild-type Populus argenteum and pagcmt2 Scanning electron micrograph of mutant silver gland poplar; Figure 7 Wild-type Populus argenteum and pagcmt2 Schematic diagram of the size comparison of ducts and fiber cells in mutant silver gland poplar; Figure 8 Wild-type Populus argenteum and pagcmt2 Schematic diagram of the comparison of the wall thickness of ducts, fiber cells and ray cells in mutant silver gland poplar. DETAILED DESCRIPTION

[0011] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0012] Example 1 PagCMT2 Construction of gene knockout vector: (1) Target primer design: Using the genome sequence of Populus alba as a template, primers CMT2-F and CMT2-R were designed to clone the first 2500 bp of the gene according to its genome sequence. PagCMT2 . PagCMT2 The nucleotide sequence of the gene is shown in SEQ ID No. 1. Based on the consideration of GC content, target primers were designed in the first coding region of the non-SNP single nucleotide polymorphism site. The target primers are CMT2-AtU3dT1F, CMT2-AtU3dT1R, CMT2-AtU3bT2F, CMT2-AtU3bT2R, and their nucleotide sequences are shown below: CMT2-F:GCTTGGTCCATCCCTTTAGTG; CMT2-R: TGATATACATCTACCAGCAGGAGG; CMT2-AtU3dT1F: GTCAGAAATCGTCATCATCACCA; CMT2-AtU3dT1R:AAAACTTGGTGATGATGACGATTTC; CMT2-AtU3bT2F:GTCATTTCCCTCAGACGATCTCCG; CMT2-AtU3bT2R: AAACCGGAGATCGTCTGAGGGAAA.

[0013] (2) Target linker preparation: The target primer was diluted to 10 μM with double distilled water, and 10 μl of the forward and reverse adapters were taken respectively. After mixing, the mixture was denatured at 94°C for 30 s, and then cooled to room temperature by gradient cooling to form a double-stranded chain.

[0014] (3) Connecting the target primer to the gRNA expression cassette (cutting and connecting method): Reaction conditions: 37°C for 5 min, 20°C for 5 min, 8 cycles.

[0015] (4) 2 rounds of nested PCR amplification: The first round of PCR uses universal UF / gRNA R for one reaction, and the second round of PCR uses specific primers for amplification. This scheme has good and stable amplification effect. The universal primers for the first round of amplification are: UF: CTCCGTTTTACCTGTGGAATCG; gRNA R: CGGAGGAAAATTCCATCCAC.

[0016] The specific primers for the second round of amplification are: B1':TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG; B2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC; B2':TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG; BL: AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC.

[0017] The first round of PCR amplification system: Reaction conditions: 95°C for 1 min; 98°C for 15 s, 55°C for 15 s, 68°C for 10 s, 10 cycles; 98°C for 10 s, 65°C for 15 s, 68°C for 10 s, 20 cycles.

[0018] Take 5 μl of PCR product and perform 1% agarose gel electrophoresis detection; and take 1 μl of PCR product, dilute it 10 times with ddH2O, and then take 1 μl from it as the template for the second round of PCR reaction.

[0019] Second round PCR amplification system: Reaction conditions: 98°C for 10 s, 60°C for 15 s, 68°C for 30 s, for 25 cycles.

[0020] Take 5 μl of PCR product and perform 1% agarose gel electrophoresis detection, and the remaining product is purified and recovered.

[0021] (5) gRNA expression cassette connected to pYLCRISPR / Cas9 vector: Reaction conditions: 37°C for 10 min; 37°C for 5 min, 10°C for 5 min, 20°C for 5 min, 15 cycles.

[0022] The ligation product was used to transform E. coli, spread on a solid LB medium with kanamycin resistance, and single clones were grown overnight for identification.

[0023] (6) Identification of vector: Plasmids were extracted from the colonies and sequenced using SP-DL primers to verify the correctness of the constructed vector.

[0024] SP-DL:GTCGTGTCCACATGTTGACCG.

[0025] Example 2 Genetic transformation of Populus argentatus: The constructed vector plasmid was transformed into Agrobacterium GV3101 by heat shock method, and the silver gland poplar was genetically transformed by Agrobacterium-mediated method. Agrobacterium cells were picked and placed in 5 mL LB (50 mg / L rifampicin + 50 mg / L kanamycin) liquid culture medium, and cultured in a shaking incubator at 28°C overnight until the OD600 value reached 0.8. 1 mL was taken and added to 100 mL LB (50 mg / L rifampicin + 50 mg / L kanamycin) liquid culture medium for subculture until OD600 = 0.4-0.5. The infected leaves were selected from the well-growing leaves of the silver gland poplar tissue culture seedlings of about 4 weeks old. The leaves were cut crosswise at the veins with a scalpel. After infection in Agrobacterium for 12 minutes, they were transferred to the co-culture medium and cultured in the dark for 2-3 days. Then they were transferred to the selection medium (3 mg / L of hygromycin) and cultured in the dark until callus grew. When the callus grew to about 0.5 cm, the callus was transferred to the differentiation medium (3 mg / L of hygromycin). When the bud height reached 1 cm, the buds were transferred to the rooting medium to induce rooting. Subculture was performed in the rooting medium.

[0026] Example 3 PagCMT2 Identification of gene knockout strains: Wild-type and transgenic genomic DNA were extracted and used as templates for amplification using gene sequencing primers CMT2-F and CMT2-R. The amplified products were connected to the T vector and transformed into Escherichia coli. Single clones were selected and sent to the company for sequencing. The sequencing results are as follows: Figure 1 As shown, there is a base insertion at the same position on both chromosomes of this gene, and this position is close to the transcription start site.

[0027] Example 4 PagCMT2 Phenotypic observation of gene knockout strains: Will PagCMT2 The knockout plants and wild-type plants were planted in a climate chamber at the same time. Three batches were planted. After about 80 days of growth, the plants in different batches were observed for phenotype, photographed, sliced ​​and observed by microscopy and scanning electron microscopy, and statistics were collected at the same time. Figure 2 Shown are wild-type Populus argentatus (WT) and pagcmt2 Phenotype of mutant silver gland poplar plant, compared with WT, PagCMT2 The knockout plants were shorter and had larger leaves ( Figure 3). In order to observe the changes of its secondary growth, the 10th stem segment of the plant was taken for vibration sectioning, the thickness of the section was 50μm, and TBO (toluidine blue) staining was performed immediately after cutting, and ordinary optical photography was performed after washing away the floating color. Figure 4 As shown, compared with WT, PagCMT2 The secondary growth of the knockout strain was significantly accelerated, and the xylem width was wider ( Figure 5 ). Compared with WT, PagCMT2 The ducts and fibroblasts of the knockout strains were significantly enlarged ( Figure 7 ). Scanning electron microscopy observation of the 14th internode revealed that ( Figure 6 ), PagCMT2 The thickness of the vessel, fiber cell and ray cell walls of the knockout plants was significantly reduced, decreasing by 11%, 41% and 22%, respectively ( Figure 8 The above results show that PagCMT2 The gene plays a certain regulatory role in xylem development, and its loss can inhibit secondary wall thickening and promote cell expansion.

[0028] In summary, the present invention identified a gene in Populus alba × Populus glandulosa (Silver Gland Poplar, 84K) PagCMT2 , knocked out using CRISPR / Cas9 gene editing technology PagCMT2 Genes that promote secondary wall thinning and cell expansion, changing wood cell characteristics, thereby obtaining improved forest varieties with thinner secondary cell walls and larger cells pagcmt2 Mutant.

[0029] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0030] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A PagCMT2 A gene characterized by Its nucleotide sequence is shown in SEQ ID No.

1.

2. The method according to claim 1 PagCMT2 The application of genes in improving wood is characterized by: Missing PagCMT2 The gene can inhibit the thickening of secondary walls, promote cell expansion, and change the characteristics of wood cells, thereby obtaining trees with thinner secondary cell walls and larger cells.

3. The use according to claim 2, characterized in that: PagCMT2 The method for genetically modifying wood specifically comprises the following steps: Step 1. Clone PagCMT2 Gene and design target primers; Step 2: Construct a gRNA expression cassette and connect the gRNA expression cassette to the pYLCRISPR / Cas9 vector to construct PagCMT2 Gene knockout vectors; Step 3: PagCMT2 The gene knockout vector was transferred into Agrobacterium GV3101, and the leaves of Populus argentatus tissue culture seedlings were infected, proliferated, differentiated, and rooted by Agrobacterium-mediated method to obtain forest tree varieties. pagcmt2 Mutant.

4. The use according to claim 2, characterized in that: In step 1, the target primers are CMT2-AtU3dT1F, CMT2-AtU3dT1R, CMT2-AtU3bT2F, CMT2-AtU3bT2R, and their nucleotide sequences are as follows: CMT2-AtU3dT1F: GTCAGAAATCGTCATCATCACCAA; CMT2-AtU3dT1R: AAACTTGGTGATGATGACGATTTC; CMT2-AtU3bT2F: GTCATTTCCCTCAGACGATCTCCG; CMT2-AtU3bT2R: AAACCGGAGATCGTCTGAGGGAAA.

Images