A PagCMT2 gene and its application in wood improvement
The PagCMT2 gene was knocked out through CRISPR/Cas9 gene editing technology, which changed the characteristics of wood cells, solved the problem of unknown regulatory mechanism of CMT2 gene during wood formation, and achieved improvement in wood quality and utilization.
Patent Information
- Application Number
- CN202510415179.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2045-04-03
AI Technical Summary
In woody plants, the mechanism of the functional differentiation and regulatory mechanism of CMT2 gene in the wood formation process has not been fully understood, and it is difficult to effectively achieve improvements that affect wood quality and characteristics.
The PagCMT2 gene in Populus alba×Populus glandulosa was knocked out through CRISPR/Cas9 gene editing technology, which promoted secondary wall thinning and cell expansion, changed the characteristics of wood cells, and obtained forest varieties with thinning and larger secondary cell walls.
The secondary cell wall is thinner and larger, which improves the utilization rate and quality of wood, and promotes the sustainable development of forestry and the efficient utilization of biomass resources.
Smart Images

Figure CN119913177B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, and specifically to a PagCMT2 Genes and their applications in wood improvement. Background Art
[0002] Wood, as a vital renewable resource, plays an indispensable role in the development of human civilization. As one of the most abundant biomass energy sources on Earth, wood is not only widely used in traditional applications such as pulp and papermaking and construction materials, but also plays a vital role in emerging fields such as modern biomass energy and cellulose derivatives. From a botanical perspective, wood formation is a complex biological process primarily determined by the continuous development of secondary xylem. The secondary xylem originates from the vascular cambium and is primarily composed of fiber cells and vascular cells with thickened cell walls. In woody plants, the secondary xylem is composed of specialized cells with significantly thickened secondary walls (SCWs). After these cells stop expanding, they deposit a secondary wall within the primary cell wall. This relatively thick and rigid fibrous secondary cell wall not only provides essential mechanical support for the plant but also performs the crucial function of transporting water and nutrients within the plant's vascular cells. Chemically, the secondary cell wall is primarily composed of three major components: cellulose, hemicellulose, and lignin. The biosynthesis of these components involves a complex set of enzymes involved in biosynthetic pathways. Given that the formation of secondary walls directly affects the quality and properties of wood, in-depth research on the molecular mechanism of secondary wall biosynthesis in woody plants will not only help reveal the basic laws of plant growth and development, but also provide an important theoretical basis for improving wood quality and increasing wood utilization. It has important scientific significance and practical value for promoting the sustainable development of forestry and the efficient utilization of biomass resources.
[0003] In woody plants, CMT2 ( CHROMOMETHYLASE 2 ) gene, as an important member of the DNA methyltransferase family, has received increasing attention in recent years. Current research shows that CMT2 Genes play an important role in the growth and development, environmental adaptation and secondary metabolism regulation of woody plants. In model woody plants such as poplar, CMT2 Genes participate in regulating gene expression and genome stability by catalyzing DNA methylation at CHH sites (H is A, T or C). In addition, DNA methylation, as an epigenetic regulatory mechanism, may indirectly participate in the wood formation process by affecting the expression of related genes. However, compared with annual plants, woody plants have CMT2 There are still many unknowns about the functional differentiation and regulatory mechanisms of genes, especially the mechanisms of action in the growth and development processes unique to perennial woody plants, such as wood formation, which still need further exploration. Summary of the Invention
[0004] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a PagCMT2 Genes and their use in improving wood. Populus alba×Populus glandulosa A gene in Populus argentatus (84K) PagCMT2 , and determined its function in the wood formation process through CRISPR / Cas9 gene editing technology.
[0005] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:
[0006] On the one hand, there is provided a PagCMT2 The gene, whose nucleotide sequence is shown in SEQ ID No.1.
[0007] On the other hand, providing PagCMT2 Genetic applications in wood modification, missing PagCMT2 The gene can inhibit the thickening of secondary walls, promote cell expansion, and change the characteristics of wood cells, thereby obtaining forests with thinner secondary cell walls and larger cells.
[0008] Furthermore, PagCMT2 The method for genetically modifying wood specifically comprises the following steps:
[0009] Step 1. Clone PagCMT2 genes and designed target primers;
[0010] Step 2: Construct a gRNA expression cassette and connect the gRNA expression cassette to the pYLCRISPR / Cas9 vector to construct PagCMT2 gene knockout vectors;
[0011] Step 3: Construct PagCMT2 The gene knockout vector was transferred into Agrobacterium GV3101, and the leaves of silver gland poplar tissue culture seedlings were infected, proliferated, differentiated, and rooted by Agrobacterium-mediated method to obtain forest tree varieties. pagcmt2 mutant.
[0012] Furthermore, in step 1, the target primers are CMT2-AtU3dT1F, CMT2-AtU3dT1R, CMT2-AtU3bT2F, and CMT2-AtU3bT2R, and their nucleotide sequences are as follows:
[0013] CMT2-AtU3dT1F: GTCAGAAATCGTCATCATCACCAA;
[0014] CMT2-AtU3dT1R: AAACTTGGTGATGATGACGATTTC;
[0015] CMT2-AtU3bT2F: GTCATTTCCCTCAGACGATCTCCG;
[0016] CMT2-AtU3bT2R: AAACCGGAGATCGTCTGAGGGAAA.
[0017] The beneficial effects of the present invention are:
[0018] This study identified a gene in Populus alba × Populus glandulosa (Silver Gland Poplar, 84K) PagCMT2 , knocked out using CRISPR / Cas9 gene editing technology PagCMT2 Genes that promote secondary wall thinning and cell expansion, changing wood cell characteristics, thereby obtaining improved forest varieties with thinner secondary cell walls and larger cells pagcmt2 mutant. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 for PagCMT2 Sequencing identification diagram of gene knockout strains;
[0020] Figure 2 Wild-type Populus argentatus and pagcmt2 Phenotype of mutant silver gland poplar plant;
[0021] Figure 3 Wild-type Populus argentatus and pagcmt2 Schematic diagram comparing the plant height and stem diameter at the base of the mutant silver gland poplar;
[0022] Figure 4 Wild-type Populus argentatus and pagcmt2 Optical image of a section of mutant Populus argentatus;
[0023] Figure 5 Wild-type Populus argentatus and pagcmt2 Schematic diagram comparing the xylem width and cambium width of the mutant silver gland poplar;
[0024] Figure 6 Wild-type Populus argentatus and pagcmt2 Scanning electron micrograph of mutant silver gland poplar;
[0025] Figure 7 Wild-type Populus argentatus and pagcmt2 Schematic diagram comparing the sizes of ducts and fiber cells in mutant silver gland poplar;
[0026] Figure 8 Wild-type Populus argentatus and pagcmt2 Schematic diagram comparing the wall thickness of ducts, fiber cells and ray cells in mutant silver gland poplar. DETAILED DESCRIPTION
[0027] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.
[0028] Example 1
[0029] PagCMT2 Construction of gene knockout vector:
[0030] (1) Target primer design:
[0031] Using the genome sequence of Populus alba as a template, primers CMT2-F and CMT2-R were designed to clone the first 2500bp of the gene. PagCMT2 . PagCMT2 The nucleotide sequence of the gene is shown in SEQ ID No. 1. Taking into account the GC content, target primers were designed in the first coding region of the non-SNP single nucleotide polymorphism site. The target primers are CMT2-AtU3dT1F, CMT2-AtU3dT1R, CMT2-AtU3bT2F, and CMT2-AtU3bT2R. Their nucleotide sequences are shown below:
[0032] CMT2-F:GCTTGGTCCATCCCTTTAGTG;
[0033] CMT2-R: TGATATACATCTACCAGCAGGAGG;
[0034] CMT2-AtU3dT1F: GTCAGAAATCGTCATCATCACCAA;
[0035] CMT2-AtU3dT1R:AAAACTTGGTGATGATGACGATTTC;
[0036] CMT2-AtU3bT2F:GTCATTTCCCTCAGACGATCTCCG;
[0037] CMT2-AtU3bT2R: AAACCGGAGATCGTCTGAGGGAAA.
[0038] (2) Target linker preparation:
[0039] The target primer was diluted to 10 μM with double-distilled water, and 10 μl of the forward and reverse adapters were taken. After mixing, the mixture was denatured at 94°C for 30 seconds and then cooled to room temperature by gradient cooling to form a double-stranded chain.
[0040] (3) Connecting the target primer to the gRNA expression cassette (cutting and connecting method):
[0041]
[0042] Reaction conditions: 37°C for 5 min, 20°C for 5 min, 8 cycles.
[0043] (4) 2-round nested PCR amplification:
[0044] The first round of PCR uses a universal UF / gRNA R reaction, and the second round of PCR uses specific primers for amplification. This protocol has good and stable amplification effects.
[0045] The universal primers for the first round of amplification are:
[0046] UF: CTCCGTTTTACCTGTGGAATCG;
[0047] gRNA R: CGGAGGAAAATTCCATCCAC.
[0048] The specific primers for the second round of amplification are:
[0049] B1':TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG;
[0050] B2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC;
[0051] B2':TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG;
[0052] BL: AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC.
[0053] First round PCR amplification system:
[0054]
[0055] Reaction conditions: 95°C for 1 min; 98°C for 15 s, 55°C for 15 s, 68°C for 10 s, 10 cycles; 98°C for 10 s, 65°C for 15 s, 68°C for 10 s, 20 cycles.
[0056] Take 5 μl of PCR product and perform 1% agarose gel electrophoresis detection; and take 1 μl of PCR product, dilute it 10 times with ddH2O, and then take 1 μl from it as the template for the second round of PCR reaction.
[0057] Second round PCR amplification system:
[0058]
[0059] Reaction conditions: 98°C for 10 s, 60°C for 15 s, 68°C for 30 s, 25 cycles.
[0060] Take 5 μl of PCR product and perform 1% agarose gel electrophoresis detection, and the remaining product is purified and recovered.
[0061] (5) gRNA expression cassette is connected to the pYLCRISPR / Cas9 vector:
[0062]
[0063] Reaction conditions: 37°C for 10 min; 37°C for 5 min, 10°C for 5 min, 20°C for 5 min, 15 cycles.
[0064] The ligation product was used to transform E. coli, spread on solid LB medium with kanamycin resistance, and waited for single clones to grow overnight for identification.
[0065] (6) Identification of vectors:
[0066] Plasmids were extracted from the colonies and sequenced using SP-DL primers to verify the correctness of the constructed vector.
[0067] SP-DL:GTCGTGTCCACATGTTGACCG.
[0068] Example 2
[0069] Genetic transformation of Populus argentatus:
[0070] The constructed vector plasmid was transformed into Agrobacterium GV3101 by heat shock method, and the silver gland poplar was genetically transformed by Agrobacterium-mediated method. Agrobacterium cells were picked and placed in 5 mL LB (50 mg / L rifampicin + 50 mg / L kanamycin) liquid medium, cultured in a shaking incubator at 28°C overnight until the OD600 value reached 0.8, and 1 mL was aspirated and added to 100 mL LB (50 mg / L rifampicin + 50 mg / L kanamycin) liquid medium for subculture until OD600 = 0.4-0.5. The leaves used for infection were selected from well-grown tissue culture seedlings of Populus argentatus (approximately 4 weeks old). The leaves were transversely cut at the veins with a scalpel and infected with Agrobacterium for 12 minutes. The leaves were then transferred to co-cultivation medium and incubated in the dark for 2-3 days. The leaves were then transferred to selective medium (3 mg / L hygromycin) and incubated in the dark until callus formed. Once the callus reached approximately 0.5 cm, the callus was transferred to differentiation medium (3 mg / L hygromycin). When the buds reached a height of 1 cm, the buds were transferred to rooting medium to induce rooting. The leaves were then subcultured in the rooting medium.
[0071] Example 3
[0072] PagCMT2 Identification of gene knockout lines:
[0073] The wild-type and transgenic genomic DNA were extracted and used as templates for amplification using gene sequencing primers CMT2-F and CMT2-R. The amplified products were connected to the T vector and transformed into Escherichia coli. Single clones were picked and sent to the company for sequencing. The sequencing results were as follows: Figure 1 As shown, there is a base insertion at the same position on both chromosomes of this gene, and the position is close to the transcription start site.
[0074] Example 4
[0075] PagCMT2 Phenotypic observation of gene knockout strains:
[0076] Will PagCMT2 The knockout plants and wild-type plants were planted in a climate chamber at the same time. Three batches were planted. After about 80 days of growth, the plants in different batches were observed for phenotype, photographed, sliced and observed by microscopy and scanning electron microscopy, and statistics were collected. Figure 2 Shown are wild-type Populus argentatus (WT) and pagcmt2 Phenotype of mutant silver gland poplar plant, compared with WT, PagCMT2 The gene knockout plants were shorter and had larger leaves ( Figure 3 To observe the changes in its secondary growth, the 10th stem section of the plant was vibrated and sliced to a thickness of 50 μm. After cutting, it was immediately stained with TBO (toluidine blue). After washing away the floating color, ordinary optical photography was performed for observation. Figure 4 As shown, compared with WT, PagCMT2 The secondary growth of the gene knockout strain was significantly accelerated, and the xylem width was wider ( Figure 5 ). Compared with WT, PagCMT2 The ducts and fibroblasts of the gene knockout strains were significantly enlarged ( Figure 7 ). Scanning electron microscopy observation of the 14th internode revealed that ( Figure 6 ), PagCMT2 The thickness of vessel, fiber cell and ray cell walls of gene knockout plants were significantly thinner, decreasing by 11%, 41% and 22% respectively ( Figure 8 The above results show that PagCMT2 The gene plays a certain regulatory role in xylem development, and its loss can inhibit secondary wall thickening and promote cell expansion.
[0077] In summary, the present invention identified a gene in Populus alba × Populus glandulosa (Silver Gland Poplar, 84K) PagCMT2 , knocked out using CRISPR / Cas9 gene editing technology PagCMT2 Genes that promote secondary wall thinning and cell expansion, changing wood cell characteristics, thereby obtaining improved forest varieties with thinner secondary cell walls and larger cells pagcmt2 mutant.
[0078] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be embodied in other specific forms without departing from the spirit or essential characteristics of the present invention. Therefore, the embodiments should be considered in all respects as illustrative and non-restrictive, and the scope of the present invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations that come within the meaning and range of equivalents of the claims be embraced therein.
[0079] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.
Claims
1. PagCMT2 The application of genes in improving wood is characterized by: The wood is silver gland poplar, silver gland poplar is missing PagCMT2 The gene can inhibit the thickening of secondary walls, promote cell expansion, and change the characteristics of wood cells, thus obtaining silver gland poplar with thinner secondary cell walls and larger cells; PagCMT2 The nucleotide sequence of the gene is shown in SEQ ID No.
1.
2. The use according to claim 1, characterized in that PagCMT2 The method for genetically improving silver gland poplar specifically comprises the following steps: Step 1. Clone PagCMT2 genes and designed target primers; Step 2: Construct a gRNA expression cassette and connect the gRNA expression cassette to the pYLCRISPR / Cas9 vector to construct PagCMT2 gene knockout vectors; Step 3: Construct PagCMT2 The gene knockout vector was transferred into Agrobacterium GV3101, and the leaves of silver gland poplar tissue culture seedlings were infected, proliferated, differentiated and rooted by Agrobacterium-mediated method to obtain silver gland poplar improved varieties. pagcmt2 mutant.
3. The use according to claim 2, characterized in that In step 1, the target primers are CMT2-AtU3dT1F, CMT2-AtU3dT1R, CMT2-AtU3bT2F, and CMT2-AtU3bT2R, and their nucleotide sequences are shown below: CMT2-AtU3dT1F: GTCAGAAATCGTCATCATCACCAA; CMT2-AtU3dT1R: AAACTTGGTGATGATGACGATTTC; CMT2-AtU3bT2F: GTCATTTCCCTCAGACGATCTCCG; CMT2-AtU3bT2R: AAACCGGAGATCGTCTGAGGGAAA.
Citation Information
Patent Citations
Method for improving wood through PagMYB31 gene and application
CN116769790A
Regulation and control effect of 84K poplar PagAPA1 gene in tree secondary xylem development
CN117305356A