Application of OPR-7S protein and coding gene thereof in regulating and controlling lodging resistance of wheat

Abstract

The invention discloses an application of OPR-7S protein and a coding gene thereof in regulating and controlling lodging resistance of wheat. According to the invention, OPR-7S overexpressed transgenic OPR-7S wheat is firstly constructed, and then the lodging resistance and yield-related traits of the OPR-7S transgenic wheat and wild type tetraploid wheat Kronos are analyzed to find that OPR-7S can regulate and control the lodging resistance of wheat and does not affect the yield-related traits. Further, by detecting the content of combined phenolic acid compounds p-coumaric acid and ferulic acid in OPR-7S-transferred wheat and wild type tetraploid wheat Kronos, it is found that OPR-7S can improve the lodging resistance of wheat by regulating the content of the combined phenolic acid compounds p-coumaric acid and ferulic acid in wheat cell walls. The OPR-7S protein and related biological materials thereof play an important role in cultivation of lodging-resistant wheat varieties.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to application of OPR-7S protein and its encoding gene in regulating lodging resistance of wheat. Background Art

[0002] Wheat yield is limited by a variety of biological and abiotic factors. Biological factors mainly include a variety of pests and diseases and the harm of other species, while abiotic factors mainly include drought, floods, high temperature, low temperature, high salt, strong wind, etc. Various biological and abiotic stresses can lead to reduced or even zero wheat yield.

[0003] Relatively speaking, pests and diseases, as well as factors such as drought, floods, high and low temperatures are usually sporadic stresses, and lodging caused by short-term strong winds is more likely to occur. There are usually three ways for crops to lodging. The first is stem bending, which is common in rice and is usually caused by the ear being too heavy for the stem to bear. The second is lodging caused by stem breaking, which is usually caused by heavy rain or strong winds. The third is lodging caused by shallow root systems. Among them, the second and third lodging methods are more common in wheat. After wheat lodging, the spatial distribution of leaves is disrupted, so that the leaves cannot get sufficient light, resulting in a significant reduction in photosynthetic rate; secondly, the broken stems seriously affect the root system's absorption of water, and also affect the transport of photosynthetic products to the grains, affecting the filling of the grains, resulting in a decrease in yield; at the same time, lodging can easily cause ear germination, and the metabolic activities of the germinated grains consume the nutrients stored inside the seeds, causing their practical and storage qualities to deteriorate; in addition, the lodging plants have a high water content, which promotes the growth of fungi and has a serious impact on the appearance and quality of the grains.

[0004] The current semi-dwarf trait has certain limitations as a lodging resistance strategy. Semi-dwarf varieties have reduced plant height, which leads to reduced leaf photosynthetic efficiency, resulting in reduced biomass and yield. Therefore, improving the lodging resistance of crops without reducing plant height is an important basis for further increasing yields in the future. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to regulate the lodging resistance of wheat.

[0006] In order to solve the above technical problems, the present invention first provides a new use of OPR-7S protein or related biological materials.

[0007] The present invention provides the use of OPR-7S protein or its related biological materials in any of the following 1)-4):

[0008] 1) Regulate wheat lodging resistance;

[0009] 2) Regulate the content of bound phenolic acid compounds in wheat cell walls;

[0010] 3) Cultivate transgenic wheat with improved lodging resistance;

[0011] 4) Wheat breeding;

[0012] The OPR-7S protein is any one of the following proteins (a1) to (a4):

[0013] (a1) the protein shown in Sequence 2 in the sequence listing;

[0014] (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0015] (a3) a protein related to wheat lodging resistance and / or yield obtained by replacing and / or deleting and / or adding one or more amino acid residues in (a1);

[0016] (a4) A protein that has 98% or more identity with (a1) and is related to wheat lodging resistance and / or yield.

[0017] In the protein described in (a2) above, the tag refers to a polypeptide or protein that is fused and expressed together with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0018] In the protein described in (a3) ​​above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0019] In the protein described in (a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be calculated.

[0020] The related biological material is a nucleic acid molecule encoding the OPR-7S protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

[0021] Furthermore, the nucleic acid molecule encoding the OPR-7S protein is a DNA molecule as described in any one of (A1) or (A2):

[0022] (A1) the DNA molecule shown in Sequence 1 in the sequence listing;

[0023] (A2) A DNA molecule having 75% or more identity with (A1) and encoding the OPR-7S protein.

[0024] Those skilled in the art can easily mutate the nucleotide sequence encoding the OPR-7S protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the OPR-7S nucleotide sequence isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the OPR-7S protein and have the same function.

[0025] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 2 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0026] The expression cassette refers to a DNA capable of expressing the OPR-7S protein in a host cell, and the DNA may include not only a promoter for initiating transcription of OPR-7S, but also a terminator for terminating transcription of OPR-7S. Furthermore, the expression cassette may also include an enhancer sequence.

[0027] The vector may be a plasmid, a cosmid, a phage or a viral vector. The recombinant vector may be a vector containing the above nucleic acid molecule or the above expression cassette constructed using an existing plant expression vector. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb, etc. The plant expression vector may also contain the 3'-end non-translated region of the exogenous gene, i.e., a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as the non-translated region transcribed at the 3' end of the Agrobacterium crown gall induction (Ti) plasmid gene (such as the nopaline synthase gene Nos) and the plant gene (such as the soybean storage protein gene) all have similar functions. When using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene that confers resistance to kanamycin and related antibiotics, bar gene that confers resistance to the herbicide phosphinothricin, hph gene that confers resistance to the antibiotic hygromycin, dhfr gene that confers resistance to methotrexate, EPSPS gene that confers resistance to glyphosate) or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and transformed plants can be directly screened by adversity.

[0028] The microorganism may be yeast, bacteria, algae or fungi; the bacteria may be Agrobacterium (such as Agrobacterium EHA105). The recombinant microorganism is a microorganism containing the above expression cassette or the above recombinant vector.

[0029] In the above application, the regulation of wheat lodging resistance is to improve the wheat lodging resistance.

[0030] The method of regulating the content of bound phenolic acid compounds in wheat cell walls is to increase the content of bound phenolic acid compounds in wheat cell walls.

[0031] The lodging resistance is the breaking force of the stem at the second node of the aboveground part.

[0032] The combined phenolic acid compound is p-coumaric acid and / or ferulic acid.

[0033] The improvement of wheat lodging resistance and the improvement of the content of bound phenolic acid compounds in wheat cell walls are specifically embodied as follows: when the OPR-7S protein content in wheat is increased or the OPR-7S gene expression level is increased, the wheat lodging resistance is improved and the content of bound phenolic acid compounds in the cell walls is improved. It is further embodied as follows: when the OPR-7S protein content in wheat is increased or the OPR-7S gene expression level is increased, the stalk breaking force of the second node of the aboveground part of wheat is increased, and the content of p-coumaric acid and / or ferulic acid in the cell walls is increased.

[0034] In the above application, the purpose of wheat breeding is to cultivate lodging-resistant wheat varieties.

[0035] In order to solve the above technical problems, the present invention also provides a method for cultivating transgenic wheat with improved lodging resistance.

[0036] The method for cultivating transgenic wheat with improved lodging resistance provided by the present invention comprises the steps of increasing the activity and / or content of the OPR-7S protein in the recipient wheat to obtain the transgenic wheat; the transgenic wheat has higher lodging resistance than the recipient wheat.

[0037] Furthermore, the lodging resistance of the transgenic wheat is higher than that of the recipient wheat, which is reflected in that the stem breaking force of the second node of the aboveground part of the transgenic wheat is higher than that of the recipient wheat.

[0038] Furthermore, the method for increasing the activity and / or content of the above OPR-7S protein in the recipient wheat is to overexpress the above OPR-7S protein in the recipient wheat.

[0039] The overexpression method is to introduce the coding gene of the above OPR-7S protein into the recipient wheat.

[0040] The nucleotide sequence of the gene encoding the OPR-7S protein is shown in Sequence 1.

[0041] In a specific embodiment of the present invention, the coding gene of the OPR-7S protein is introduced into the recipient wheat via the recombinant vector pGWB18-Ubi::OPR-7S. The recombinant vector pGWB18-Ubi::OPR-7S is a vector obtained by recombining the OPR-7S gene shown in sequence 1 between attR1 (AAACAAGTTTGTACAAAAAA) and attR2 (TTTCTTGTACAAAGTGG) of the pGWB18 vector.

[0042] In any of the above-mentioned uses or methods, the transgenic plants include not only the first generation transgenic plants obtained by transforming the OPR-7S gene into the target plant, but also its progeny. For transgenic plants, the gene can be propagated in the species, or the gene can be transferred into other varieties of the same species, especially commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, complete plants and cells.

[0043] In any of the above applications or methods, the wheat may specifically be wild tetraploid wheat (Kronos).

[0044] The present invention first constructs OPR-7S overexpressed transgenic OPR-7S wheat, and then analyzes the lodging resistance, 1000-grain weight, plant height, spike length, and stalk diameter of the transgenic OPR-7S wheat and the wild-type tetraploid wheat Kronos, and finds that OPR-7S can regulate the lodging resistance of wheat without affecting yield, plant height, spike length, stalk diameter, and other yield-related traits. Further, by detecting the content of p-coumaric acid and ferulic acid in the transgenic OPR-7S wheat and the wild-type tetraploid wheat Kronos, it is found that OPR-7S can improve the lodging resistance of wheat by regulating the content of p-coumaric acid and ferulic acid in the bound phenolic acid compounds in the wheat cell wall. OPR-7S protein and related biological materials will play an important role in breeding lodging-resistant wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 The lodging resistance and yield-related traits of transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos were detected. A is the stem breaking force test results of transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. B is the PCR identification of transgenic materials. C is the plant height statistics of transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. D is the spike length statistics of transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. E is the thousand-grain weight statistics of transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. F is the stem diameter statistics of transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos.

[0046] Figure 2 The relative content detection results of p-coumaric acid and ferulic acid in the cell walls of transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. A is the relative content detection result of p-coumaric acid in the cell walls of transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. B is the relative content detection result of ferulic acid in the cell walls of transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. The p value in the figure indicates the significance level. DETAILED DESCRIPTION

[0047] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0048] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0049] The wild-type tetraploid wheat (Kronos) in the following examples is described in the document “Krasileva, KV, et al. (2017). “Uncovering hidden variation in polyploid wheat.” Proceedings of the National Academy of Sciences 114(6): E913-E921.”.

[0050] The amino acid sequence of the OPR-7S protein in the following Example 1 is shown as Sequence 2 in the sequence listing, and the coding gene sequence is shown as Sequence 1 in the sequence listing.

[0051] Example 1. Obtaining transgenic OPR-7S wheat and analysis of its stalk breaking force, yield-related traits, and content of bound phenolic acid compounds in the cell wall

[0052] 1. Obtaining Transgenic OPR-7S Wheat

[0053] 1. Construction of recombinant vector pGWB18-Ubi::OPR-7S

[0054] The OPR-7S gene shown in sequence 1 was connected to the pDONR207 vector (invitrogen, CAT#: 12535035) using the Gateway method to obtain the recombinant vector pDONR207-OPR-7S, which was sequenced and verified. Sequencing showed that the OPR-7S gene did not have any point mutations.

[0055] The recombinant vector pDONR207-HSP90.2-7B, pGWB18 vector (NCBI: txid419562) and recombinase (ThermoFisher Scientific, Cat. No. 11789100) were mixed and reacted at 22°C overnight to recombinate the OPR-7S gene shown in sequence 1 between attR1 (AAACAAGTTTGTACAAAAAA) and attR2 (TTTCTTGTACAAAGTGG) of the pGWB18 vector to obtain the recombinant vector pGWB18-Ubi::OPR-7S. The recombinant vector pGWB18-Ubi::OPR-7S expresses the OPR-7S protein.

[0056] 2. Obtaining recombinant bacteria

[0057] The recombinant vector pGWB18-Ubi::OPR-7S was transformed into Agrobacterium EHA105 (Weidi Biotechnology, CAT#: AC1010) to obtain the recombinant bacteria pGWB18-Ubi::OPR-7S / EHA105.

[0058] 3. Obtaining OPR-7S Transgenic Wheat

[0059] Wild tetraploid wheat Kronos with good growth status was selected as the recipient, and genetic transformation was carried out by embryo stripping method. Agrobacterium pGWB18-Ubi::OPR-7S / EHA105 was used for infection and differentiation, and then screening was performed to obtain the transgenic OPR-7S wheat strain.

[0060] 4. PCR identification

[0061] The wild-type tetraploid wheat Kronos and transgenic OPR-7S wheat lines were identified. Figure 1As shown in B, the transgenic OPR-7S wheat lines OPR-7S OE3 and (OPR-7S OE5 were selected for subsequent research experiments. The specific identification steps are as follows: cut fresh wheat leaves into a 2mL thick-walled centrifuge tube, add 800μL DNA extraction solution (0.2M Tris-HCl (pH7.5), 0.25M NaCl, 0.5% SDS, 25mM EDTA) and steel beads, use a high-throughput tissue grinder for grinding, 60Hz5min Place the sample in a 65℃ oven and let it stand for 60min, during which it is shaken upside down several times until the bubbles are completely eliminated; take it out and cool it to room temperature, take it out and cool it to room temperature, centrifuge it at 12000rpm for 15min at room temperature; aspirate 600μL supernatant, add an equal volume of isopropanol, mix well and let it stand at -20℃; centrifuge it at 12000rpm and 4℃ for 10min, discard the supernatant and add 1mL Resuspend the precipitate in 75% ethanol, centrifuge at 8000rpm and 4℃ for 5min, discard the supernatant, blow dry in a clean bench, add 100μL ddH2O and store at -20℃ for later use. Then use primers OPR-CDS-F and OPR-CDS-R for PCR amplification detection. The primer sequences are as follows:

[0062] OPR-CDS-F:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTCTACTCCAAGCCT;

[0063] OPR-CDS-R: GGGGACCACTTTGTACAAGAAAGCTGGGTTCTCGGCATTCGAGCCACC.

[0064] 2. Testing of stem breaking force of OPR-7S transgenic wheat

[0065] Test materials: wild-type tetraploid wheat Kronos, T2 generation transgenic OPR-7S wheat lines OPR-7S OE3 and OPR-7S OE5.

[0066] In November 2020, the test materials were sown in the greenhouse of Fudan University, with a plant spacing of 4-5 cm and a row spacing of 20 cm. After the seeds were harvested, the second section of the stem was taken to measure the stem breaking force. The measurement position was the middle position of the second section of the aboveground part of the plant. The measurement position of the lodging resistance measuring instrument was suspended in the air and aligned with the measurement position of the stem. The "N" data unit was used to push and pull the plant 60°. The instrument reading was the stem tensile force, that is, the stem breaking force.

[0067] The results are as follows Figure 1As shown in A, the results showed that the average stem breaking force of the wild-type tetraploid wheat Kronos was 6.98, the average stem breaking force of the T2-generation OPR-7S wheat line OPR-7S OE3 was 8.50, and the average stem breaking force of the T2-generation OPR-7S wheat line OPR-7S OE5 was 7.50. Compared with the wild-type tetraploid wheat Kronos, the stem breaking force of the T2-generation OPR-7S wheat line OPR-7S OE3 and the T2-generation OPR-7S wheat line OPR-7S OE5 was significantly improved.

[0068] 3. Yield trait detection of transgenic OPR-7S wheat

[0069] Test materials: wild-type tetraploid wheat Kronos, T2 generation transgenic OPR-7S wheat lines OPR-7S OE3 and OPR-7S OE5.

[0070] The test materials were sown in the greenhouse of Fudan University in November 2020, with a plant spacing of 4-5 cm and a row spacing of 20 cm. When sampling for phenotypic statistics, random sampling was performed in each row of the three Latin squares of the transgenic OPR-7S wheat and the wild-type tetraploid wheat Kronos. The plant and grain phenotypes were observed, and the plant height, ear length, grain weight (1000-grain weight) and stem diameter were measured and counted.

[0071] The plant height test results are as follows Figure 1 As shown in C, the results showed that the average plant height of the wild-type tetraploid wheat Kronos was 47.80, the average plant height of the T2 generation OPR-7S transgenic wheat line OPR-7S OE3 was 44.35, and the average plant height of the T2 generation OPR-7S transgenic wheat line OPR-7S OE5 was 46.33.

[0072] The results of spike length test are as follows Figure 1 As shown in D, the results showed that the average ear length of the wild-type tetraploid wheat Kronos was 5.20, the average ear length of the T2 generation OPR-7S transgenic wheat line OPR-7S OE3 was 5.35, and the average ear length of the T2 generation OPR-7S transgenic wheat line OPR-7S OE5 was 5.23.

[0073] The results of the thousand-grain weight test are as follows: Figure 1 As shown in E, the results showed that the average thousand-grain weight of the wild-type tetraploid wheat Kronos was 40.85, the average thousand-grain weight of the T2 generation transgenic OPR-7S wheat line OPR-7S OE3 was 40.54, and the average thousand-grain weight of the T2 generation transgenic OPR-7S wheat line OPR-7S OE5 was 34.82.

[0074] The results of stem diameter test are as follows Figure 1 As shown in F, the results showed that the average stem diameter of the wild-type tetraploid wheat Kronos was 2.69, the average stem diameter of the T2 generation OPR-7S transgenic wheat line OPR-7S OE3 was 2.82, and the average stem diameter of the T2 generation OPR-7S transgenic wheat line OPR-7S OE5 was 2.78.

[0075] 4. Detection of relative content of cell wall-bound phenolic acid compounds in transgenic OPR-7S wheat

[0076] Test materials: wild-type tetraploid wheat Kronos, T2 generation transgenic OPR-7S wheat lines OPR-7S OE3 and OPR-7S OE5.

[0077] The relative content of phenolic acid compounds bound to the cell wall of the test materials was detected. The specific steps are as follows: take 100 seeds, crush them with a tissue grinder, pass them through a 60-mesh sieve, and continue to grind those that cannot pass through the sieve until all of them pass through the sieve to obtain flour; accurately weigh the dried flour (0.1±0.0005) g in a 2mL centrifuge tube; wash it three times with 80% methanol; resuspend the precipitate with 1mL80% methanol, transfer it to a 10mL centrifuge tube, and centrifuge it at 5000rpm for 5min; discard the supernatant, add 3mL 4M NaOH (containing 10mM p-toluic acid internal reference), vortex and oscillate, resuspend the precipitate; treat at 37℃ for 16h; add 2mL 6N HCl, shake and mix, adjust pH to 4; add 600μL of water-saturated ethyl acetate, mix thoroughly and centrifuge to absorb the upper organic phase, repeat twice, mix the organic phase three times; pass the organic phase through anhydrous sodium sulfate column and collect the remaining liquid; take 800μL of the liquid after the column into a 1.5mL centrifuge tube and evaporate the organic solvent; add 200μL of pure methanol, shake and centrifuge at 12000rpm for 10min; absorb the supernatant and analyze by HPLC. Subsequently, the wheat cell wall-bound phenolic acid compounds were eluted and detected, and the gradient elution method was used for separation, the injection volume was 5μL, the column temperature was 30℃, and the detection wavelength was 320nm. The internal reference p-toluic acid was detected at 240nm. 0.1% acetic acid was added to the mobile phase used.

[0078] The results are as follows Figure 2As shown, the results showed that compared with the wild-type tetraploid wheat Kronos, the relative contents of bound phenolic acid compounds p-coumaric acid and ferulic acid in the cell wall of transgenic OPR-7S wheat were significantly increased. Among them, the relative content of p-coumaric acid, a bound phenolic acid compound in the cell wall of the wild-type tetraploid wheat Kronos, was used as the control 1. The average relative content of p-coumaric acid, a bound phenolic acid compound in the cell wall of the T2-generation transgenic OPR-7S wheat line OPR-7S OE3, was 1.40, and the average relative content of p-coumaric acid, a bound phenolic acid compound in the cell wall of the T2-generation transgenic OPR-7S wheat line OPR-7S OE5, was 1.42; the relative content of ferulic acid, a bound phenolic acid compound in the cell wall of the wild-type tetraploid wheat Kronos, was used as the control 1. The average relative content of ferulic acid, a bound phenolic acid compound in the cell wall of the T2-generation transgenic OPR-7S wheat line OPR-7S OE3, was 1.38, and the average relative content of ferulic acid, a bound phenolic acid compound in the cell wall of the T2-generation transgenic OPR-7S wheat line OPR-7S OE5, was 1.40. The experimental results further verified that the OPR-7S gene can improve the lodging resistance of wheat by regulating the content of phenolic acid compounds p-coumaric acid and ferulic acid in the cell wall.

[0079] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of OPR-7S protein or related biological materials in any of the following 1)-4): 1) Regulate wheat lodging resistance; 2) Regulate the content of bound phenolic acid compounds in wheat cell walls; 3) Cultivate transgenic wheat with improved lodging resistance; 4) Wheat breeding; The OPR-7S protein is any one of the following proteins (a1) to (a4): (a1) the protein shown in Sequence 2 in the sequence listing; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein related to wheat lodging resistance and / or yield obtained by replacing and / or deleting and / or adding one or more amino acid residues in (a1); (a4) A protein that has more than 98% identity with (a1) and is associated with wheat lodging resistance.

2. The use according to claim 1, characterized in that: The related biological material is a nucleic acid molecule encoding the OPR-7S protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule encoding the OPR-7S protein is a DNA molecule as described in any one of (A1) or (A2): (A1) the DNA molecule shown in Sequence 1 in the sequence listing; (A2) A DNA molecule having 75% or more identity with (A1) and encoding the OPR-7S protein.

4. The use according to any one of claims 1 to 3, characterized in that: The lodging resistance is the breaking force of the stem at the second node of the aboveground part.

5. The use according to any one of claims 1 to 4, characterized in that: The combined phenolic acid compound is p-coumaric acid and / or ferulic acid.

6. A method for cultivating transgenic wheat with improved lodging resistance, comprising the steps of increasing the activity and / or content of OPR-7S protein in recipient wheat to obtain transgenic wheat; the transgenic wheat has higher lodging resistance and / or yield than the recipient wheat; The OPR-7S protein is any one of the following proteins (a1) to (a4): (a1) the protein shown in Sequence 2 in the sequence listing; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein related to wheat lodging resistance and / or yield obtained by replacing and / or deleting and / or adding one or more amino acid residues in (a1); (a4) A protein that has more than 98% identity with (a1) and is associated with wheat lodging resistance.

7. The method according to claim 6, characterized in that: The lodging resistance of the transgenic wheat is higher than that of the recipient wheat, which is reflected in that the stem breaking force of the second node of the aboveground part of the transgenic wheat is higher than that of the recipient wheat.

8. The method according to claim 7, characterized in that: The method for increasing the activity and / or content of the OPR-7S protein in the recipient wheat is to overexpress the OPR-7S protein in the recipient wheat.

9. The method according to claim 8, characterized in that: The overexpression method is to introduce the coding gene of the OPR-7S protein in claim 1 into the recipient wheat.

10. The method according to any one of claims 6 to 9, characterized in that: The nucleotide sequence of the gene encoding the OPR-7S protein is shown in Sequence 1.

Images