Safe production method of rice engineering sterile line

Abstract

The invention discloses a safe production method of a rice engineering sterile line. The safe production method comprises the following steps: preparing a sterile line rice material with double homozygous mutation of an auxin response factor OsARF18 gene and a fertility regulation gene CYP703A3; the method comprises the following steps: constructing base sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 into an expression vector to obtain a quaternary complementary vector; the quaternary complementary vector is transformed into a sterile line rice material, and a fertility recovery breeding line is created and used for breeding sterile double mutants. The invention also discloses an application of the auxin response factor OsARF18 in rice engineering sterile line production or third generation hybrid rice seed production. The double-sorting system of the rice engineering sterile line is constructed, the purity of the engineering sterile line can be fundamentally guaranteed through seed fluorescence color sorting and seedling-stage herbicide resistance screening, and absolute safety of third-generation hybrid rice seed production is achieved.

Description

Technical Field

[0001] The invention belongs to the technical field of rice hybrid seed production and relates to a safe production method for rice engineering sterile lines. Background Art

[0002] The use of hybrid vigor is the most important way to increase rice yields. The new combination of third-generation hybrid rice has been demonstrated in the planting base, and the yield has achieved continuous breakthroughs, showing strong potential for superiority. In 2020, the double-season per-acre yield of the third-generation hybrid rice exceeded 1,500 kilograms in Hengyang, Hunan. In 2021, the double-season per-acre yield of the third-generation hybrid rice exceeded 1,600 kilograms in Hengyang, Hunan, setting a new high-yield record. The purity of the engineered sterile line is a key indicator that determines whether the third-generation hybrid rice can be successfully applied, and is directly related to the biosafety of the promotion and industrial development of the technology. In the current technical system, the main method is to sort the breeding line seeds and the sterile line seeds by expressing red fluorescent protein in the seeds. Due to the poor development or lesions of individual seeds, fluorescent color sorting cannot fully guarantee the purity of the sterile line, which brings certain risks to the third-generation hybrid rice seed production. Summary of the invention

[0003] An object of the present invention is to overcome the deficiencies of the prior art and to provide at least the advantages described hereinafter.

[0004] Another object of the present invention is to provide a safe production method for rice engineered sterile lines.

[0005] To this end, the technical solution provided by the present invention is:

[0006] A safe production method for rice engineered sterile lines comprises the following steps:

[0007] Step 1: Using gene editing methods, a rice material with a homozygous mutation in the auxin response factor OsARF18 gene is obtained, and the rice material plant with a homozygous mutation in the OsARF18 gene exhibits glufosinate resistance;

[0008] Step 2: Using rice materials with homozygous mutations in the OsARF18 gene as recipients, using gene editing methods to obtain sterile rice materials with double homozygous mutations in the fertility regulating gene CYP703A3 and the OsARF18 gene;

[0009] Step 3, integrating and recombining the full-length complementary sequence of the fertility regulatory gene CYP703A3 gene as shown in SEQ ID NO: 1, the fluorescent protein gene expression element as shown in SEQ ID NO: 2, the pollen lethal gene expression element as shown in SEQ ID NO: 3, and the OsARF18 expression element as shown in SEQ ID NO: 4 into an expression vector to construct a four-complementation vector;

[0010] Step 4: transforming the four-complementation vector into the sterile rice material obtained in step 2 to create a fertility-restored breeding line for breeding of sterile double mutants.

[0011] Preferably, in the safe production method of the rice engineered sterile line, in step 1, the specific method of obtaining the rice material with homozygous mutation of the auxin response factor OsARF18 gene comprises the following steps:

[0012] 1.1) Analyze the upstream and downstream sequence regions of the wild-type rice chromosome OsARF18 gene, select the base sequence shown in SEQ ID NO: 5 as the editing site, anneal the primer pair shown in SEQ ID NO: 6 and SEQ ID NO: 7, and connect them to the targeting vector pCBSG to obtain the pCBSG-ARF18 recombinant vector;

[0013] 1.2) The targeting recombinant vector pCBSG-ARF18 was transformed into rice plants to screen and obtain the rice material osarf18 with the homozygous mutation of the OsARF18 gene.

[0014] Preferably, in the safe production method of the rice engineered sterile line, the specific method of obtaining the sterile rice material with double homozygous mutations of the fertility regulating gene CYP703A3 and the auxin response factor OsARF18 gene comprises:

[0015] 2.1) Analyze the upstream and downstream sequence regions of the wild-type rice chromosome CYP703A3 gene, select the base sequence shown in SEQ ID NO: 9 as the editing site, anneal the primer pair shown in SEQ ID NO: 9 and SEQ ID NO:, and connect them to the targeting vector pCBSG to obtain the pCBSG-03A3 recombinant vector;

[0016] 2.2) The targeting recombinant vector pCBSG-03A3 is used to transform the callus tissue induced by the seeds of the rice material osarf18 with homozygous mutation of the OsARF18 gene, and the sterile rice material is screened.

[0017] Preferably, in the safe production method of rice engineered sterile lines, the method for constructing the four-complementary vector comprises:

[0018] 3.1) Connect the fluorescent protein gene fragment to the vector pCAMBIA1300 to obtain the pCAMBIA1300-DsRed2 recombinant vector;

[0019] 3.2) Connect the ZmAA1 gene fragment to the vector pCAMBIA1300-DsRed2 to obtain the pCAMBIA1300-DsRed2-ZmAA1 recombinant vector;

[0020] 3.3) Using homologous recombination method, the full-length sequence of fertility regulatory gene CYP703A3 was inserted into the pCAMBIA1300-DsRed2-ZmAA1 recombinant vector to obtain the pCAMBIA1300-CYP703A3-DsRed2-ZmAA1 recombinant vector;

[0021] 3.4) Using homologous recombination method, the full-length sequence of the auxin response factor OsARF18 gene was inserted into the pCAMBIA1300-CYP703A3-DsRed2-ZmAA1 recombinant vector to obtain the four-complementation vector pCAMBIA1300-CYP703A3-DsRed2-OsARF18-ZmAA1.

[0022] Preferably, in the safe production method of rice engineered sterile lines, the rice includes all rice variety resources.

[0023] Application of auxin response factor OsARF18 gene in the production of rice engineered sterile lines or third-generation hybrid rice seed production.

[0024] A rice engineered sterile line is prepared by any of the methods described above.

[0025] The present invention has achieved at least the following beneficial effects:

[0026] The present invention uses CRISPR / Cas9 genome editing technology to perform site-specific editing on the OsARF18 (OsSPL10, etc.) gene and CYP703A3 (CYP704B2, EAT1, etc.) fertility regulatory gene of rice materials, and creates double mutants of OsARF18 and CYP703A3 (CYP704B2, EAT1, etc.) fertility regulatory genes; then constructs a four-element complementary vector containing fertility regulatory genes, herbicide resistance regulatory genes, pollen lethal genes, and fluorescent marker genes, transforms the sterile double mutants, creates a fertility-restored breeding line, and is used for batch breeding of sterile double mutants. The sterile double mutants have stable fertility, are not affected by environmental conditions, show resistance to the herbicide glufosinate-ammonium, and can be directly used in hybrid rice seed production. This invention constructs a double sorting system for engineered sterile rice lines. Through seed fluorescence color sorting and sterile line seedling herbicide resistance screening, the purity of the engineered sterile lines can be fundamentally guaranteed, thereby achieving absolute safety in the third-generation hybrid rice seed production.

[0027] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1A flow chart of a safe production method for an engineered sterile rice line in one embodiment of the present invention is shown, wherein the genetic complementation vector pCAMBIA1300-3RAF comprises: 3: CYP703A3, a fertility regulation gene; R: DsRed2, a red fluorescent protein gene; A: ZmAA1, a pollen lethal gene; and F: OsARF18, an auxin response factor gene.

[0029] Figure 2 It is shown that the T1 generation OsARF18 gene homozygous mutant plants in one embodiment of the present invention show glufosinate resistance.

[0030] Figure 3 The plasmid map of the pCBSG vector in one embodiment of the present invention is shown.

[0031] Figure 4 The pollen phenotype under microscopic examination in one of the embodiments of the present invention is shown, wherein (A) the rice mutant osarf18 has normal fertility; (B) the osarf18 / cyp703a3 double mutant exhibits complete sterility.

[0032] Figure 5 The plasmid map of the pCAMBIA1300 vector in one embodiment of the present invention is shown.

[0033] Figure 6 The plasmid map of the pUC57-ZmAA1 vector in one embodiment of the present invention is shown.

[0034] Figure 7 Showing the plasmid map of the pJIT163 vector in one embodiment of the present invention.

[0035] Figure 8 The present invention shows the typing and glufosinate resistance of the seeds of the breeding line in one embodiment of the present invention. DETAILED DESCRIPTION

[0036] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0037] The invention discloses a safe production method for an engineered sterile rice line, which can ensure the absolute purity of the sterile line and the absolute safety of hybrid seed production, comprising: step 1, constructing a CRISPR / Cas9 genome editing vector, performing site-directed mutagenesis on a rice gene OsARF18 (OsSPL10, etc., but not limited to), obtaining a homozygous gene mutation, and producing a rice plant that is resistant to the herbicide glufosinate ammonium; step 2, constructing a CRISPR / Cas9 genome editing vector, performing fertility regulation on the rice plant that is resistant to the herbicide glufosinate ammonium created in step 1, The method comprises the following steps: site-directed mutation of control genes (EAT1, CYP703A3, CYP704B2, etc., but not limited to) to create sterile double mutants of rice gene OsARF18 (OsSPL10, etc., but not limited to) and common nuclear sterile genes (EAT1, CYP703A3, CYP704B2, etc., but not limited to); Step 3: construct a four-element complementary vector of fertility control genes, herbicide resistance control genes, fluorescent marker genes and pollen lethal genes, and genetically transform the obtained sterile double mutants to obtain fertility-restored breeding lines. Self-pollination of the breeding lines can obtain fluorescent breeding line seeds and non-fluorescent sterile line seeds separated in a 1:1 ratio. The sterile line has stable fertility and shows resistance to the herbicide glufosinate ammonium. The seeds of individual breeding lines that are not separated by the fluorescent color sorting process are removed by glufosinate ammonium screening at the seedling stage, and can be directly used for hybrid seed production. The present invention ensures the purity of the engineered sterile line through two-step seed fluorescence color sorting and herbicide glufosinate screening, thus achieving absolute safety of the third-generation hybrid rice seed production.

[0038] like Figure 1 As shown, the present invention provides a safe production method for rice engineered sterile lines, comprising the following steps:

[0039] A safe production method for rice engineered sterile lines comprises the following steps:

[0040] Step 1: Using gene editing methods, a rice material with a homozygous mutation in the auxin response factor OsARF18 gene is obtained, and the rice material plant with a homozygous mutation in the OsARF18 gene exhibits glufosinate resistance;

[0041] Step 2: Using rice materials with homozygous mutations in the OsARF18 gene as recipients, using gene editing methods to obtain sterile rice materials with double homozygous mutations in the fertility regulating gene CYP703A3 and the OsARF18 gene;

[0042] Step 3, constructing the full-length complementary sequence of the fertility regulatory gene CYP703A3 gene as shown in SEQ ID NO: 1, the fluorescent protein gene expression element as shown in SEQ ID NO: 2, the pollen lethal gene expression element as shown in SEQ ID NO: 3, and the OsARF18 expression element as shown in SEQ ID NO: 4 into an expression vector respectively to construct a four-complementary vector;

[0043] Step 4: transforming the four-complementation vector into the sterile rice material obtained in step 2 to create a fertility-restored breeding line for breeding of sterile double mutants.

[0044] In the above scheme, preferably, in step 1, the specific method for obtaining the rice material with homozygous mutation of auxin response factor OsARF18 gene comprises the following steps:

[0045] 1.1) Analyze the upstream and downstream sequence regions of the wild-type rice chromosome OsARF18 gene, select the base sequence shown in SEQ ID NO: 5 as the editing site, anneal the primer pair shown in SEQ ID NO: 6 and SEQ ID NO: 7, and connect them to the targeting vector pCBSG to obtain the pCBSG-ARF18 recombinant vector;

[0046] 1.2) The targeting recombinant vector pCBSG-ARF18 was transformed into rice plants to screen and obtain the rice material osarf18 with the homozygous mutation of the OsARF18 gene.

[0047] In one embodiment of the present invention, as a preferred method, the specific method of obtaining the sterile rice material with double homozygous mutations of the fertility regulating gene CYP703A3 and the gene OsARF18 comprises:

[0048] 2.1) Analyze the upstream and downstream sequence regions of the wild-type rice chromosome CYP703A3 gene, select the base sequence shown in SEQ ID NO: 9 as the editing site, anneal the primer pair shown in SEQ ID NO: 9 and SEQ ID NO:, and connect them to the targeting vector pCBSG to obtain the pCBSG-03A3 recombinant vector;

[0049] 2.2) The targeting recombinant vector pCBSG-03A3 is used to transform the callus tissue induced by the seeds of the rice material osarf18 with homozygous mutation of the OsARF18 gene, and the sterile rice material is screened.

[0050] In one embodiment of the present invention, preferably, the method for constructing the quadruple complementation vector comprises:

[0051] 3.1) Connect the fluorescent protein gene fragment to the vector pCAMBIA1300 to obtain the pCAMBIA1300-DsRed2 recombinant vector;

[0052] 3.2) Connect the ZmAA1 gene fragment to the vector pCAMBIA1300-DsRed2 to obtain the pCAMBIA1300-DsRed2-ZmAA1 recombinant vector;

[0053] 3.3) Using homologous recombination method, the full-length sequence of fertility regulatory gene CYP703A3 was inserted into the pCAMBIA1300-DsRed2-ZmAA1 recombinant vector to obtain the pCAMBIA1300-CYP703A3-DsRed2-ZmAA1 recombinant vector;

[0054] 3.4) Using homologous recombination method, the full-length sequence of the auxin response factor OsARF18 gene was inserted into the pCAMBIA1300-CYP703A3-DsRed2-ZmAA1 recombinant vector to obtain the four-complementation vector pCAMBIA1300-CYP703A3-DsRed2-OsARF18-ZmAA1.

[0055] In one embodiment of the present invention, preferably, the rice includes all rice germplasm resources.

[0056] The present invention also provides the use of the auxin response factor OsARF18 gene in the production of rice engineering sterile lines or the production of third-generation hybrid rice seeds.

[0057] The present invention also provides a rice engineered sterile line, which is prepared by any of the methods described above.

[0058] Specifically, the present invention comprises the following steps:

[0059] Step 1: Site-directed editing of the OsARF18 gene in rice materials (Jinlong B, Huazhan or 9311, etc.) to obtain rice materials with homozygous mutations of the OsARF18 gene. Homozygous mutant plants without editing vectors were obtained in the T1 generation, and herbicide resistance was tested. The mutant plants showed resistance to glufosinate ammonium.

[0060] Editing site design: GCGGGAGAGTGACAAGTGCT (SEQ ID NO: 5)

[0061] ARF18-CAS9-F:5'-TGGCGCGGGAGAGTGACAAGTGCT-3' (SEQ ID NO: 6)

[0062] ARF18-CAS9-R:5'-AAACAGCACTTGTCACTCTCCCGC-3' (SEQ ID NO: 7)

[0063] Targeting vector construction:

[0064] Annealing and joining

[0065] a) Dissolve the forward and reverse primers in ddH2O to 10 μM, add 1 μl of each to 8 μl of annealing buffer (TE+50 mM NaCl), and mix using a pipette.

[0066] b) Run the following annealing program on the PCR instrument: slow cooling from 95°C to 16°C at a rate of 0.1°C / s.

[0067] c) Take 1 μl of the annealed product and perform a 10 μl ligation reaction with the pCBSG vector digested with BsaI (NEB).

[0068] Reaction system:

[0069]

[0070] Add H2O to 10 μl and allow to ligate for 2 hours at 25°C

[0071] d) The ligation product was transformed into E. coli, and the connection of the vector pCBSG-ARF18 was verified by colony PCR and sequencing.

[0072] e) The targeting vector pCBSG-ARF18 was used to transform rice (Jinlong B, Huazhan, 9311, etc.) to obtain rice plants with homozygous mutations of the OsARF18 gene.

[0073] In the T1 generation, plants homozygous for the mutation and free of the targeting vector were obtained. After herbicide resistance treatment, the homozygous mutants showed resistance to glufosinate ammonium, such as Figure 2 shown.

[0074] Step 2:

[0075] Using the mutant material created in step 1 as a receptor, site-directed editing of the CYP703A3 gene was performed to obtain a rice sterile material (double mutant) with a homozygous mutation in the CYP703A3 gene.

[0076] Editing site: GTTCACCTTGCCTATGGGTG (SEQ ID NO: 8)

[0077] Primer synthesis

[0078] 03A3-Cas9-F:5'-TGGCGTTCACCTTGCCTATGGGTG-3' (SEQ ID NO: 9)

[0079] 03A3-Cas9-R:5'-AAACCCACCCATAGGCAAGGTGAAC-3'(SEQ ID NO: 10)

[0080] Targeting vector construction:

[0081] Annealing and joining

[0082] f) Dissolve the forward and reverse primers in ddH2O to 10 μM, take 1 μl of each and add them to 8 μl of annealing buffer (TE+50 mM NaCl), and mix with a pipette.

[0083] g) Run the following annealing program on the PCR instrument: slow cooling from 95°C to 16°C at a rate of 0.1°C / s.

[0084] h) Take 1 μl of the annealed product and perform a 10 μl ligation reaction with the pCBSG vector digested with BsaI (NEB).

[0085] Reaction system:

[0086]

[0087] Add H2O to 10 μl and incubate at 25°C for 2 hours.

[0088] The ligation product was transformed into E. coli, and the connection of the vector pCBSG-03A3 was verified by colony PCR and sequencing. The map of the pCBSG vector is shown in Figure 3 shown.

[0089] The targeting vector pCBSG-03A3 vector was used to transform the callus tissue induced by the seeds of the rice mutant osarf18 to obtain sterile rice plants (double mutant materials) with homozygous mutations in the CYP703A3 gene. The sterile mutant showed complete sterility, and microscopic examination showed that it was a pollen-free sterility, such as Figure 4 shown.

[0090] Step 3: Construct a four-complementation vector containing CYP703A3, auxin response factor gene OsARF18, pollen lethal gene ZmAA1, red fluorescent protein gene DsRed2, and four expression cassettes.

[0091] Vector construction process:

[0092] 1. DsRed2 full-length amplification (1860bp)

[0093] RED-F: GAATTCAACCGTCTCTTCGTGAGAATAACC (EcoRI) (SEQ ID NO: 11)

[0094] RED-R: GGTACCCTTAAGAAACACACCTAGACTAGATTTG (Kpn I) (SEQ ID NO: 12)

[0095] The gene was cloned into T vector by PCR and then digested with EcoRI and Kpn1 after sequencing and ligated into pCAMBIA1300 (eg Figure 5 As shown), the vector pCAMBIA1300-DsRed2 was obtained

[0096] 2. The original cloning vector of ZmAA1 is pUC57, and there is a Sph I restriction site at the 5 end of the gene itself, such as Figure 5 shown.

[0097] The ZmAA1 gene was ligated into the vector pJIT163 (Fig. Figure 6 ), namely pJIT163-ZmAA1.

[0098] 3. ZmAA1 gene was partially digested into pJIT163-ZmAA1 by Hind III and Xho I, and pCAMBIA1300-DsRed2 was digested into Hind III and Sal I. (Xho I and Sal I are homozygous enzymes). The recovered ZmAA1 fragment was ligated into pCAMBIA1300-DsRed2 to obtain the vector pCAMBIA1300-DsRed2-ZmAA1.

[0099] 4. Use primers:

[0100] 03a3-inf-F:5-CCATGATTACgaattGGGATGGGTGTTTGACTCTG-3 (SEQ ID NO: 13)

[0101] 03a3-inf-R:5-AGAGACGGTTgaattCCTGTGCTCACTCGGAAG-3 (SEQ ID NO: 14)

[0102] The full-length sequence of CYP703A3 gene was amplified, and the vector pCAMBIA1300-DsRed2-ZmAA1 was cut with EcoRI to make it linear. The full-length fertility gene CYP703A3 was inserted into the vector by homologous recombination to obtain the vector pCAMBIA1300-CYP703A3-DsRed2-ZmAA1.

[0103] 5. Use of primers:

[0104] ARF18-com-F:AGGTGTGTTT CTTAAGGGAAAAGATAGTCCCAATTTGCAT (SEQ ID NO: 15)

[0105] ARF18-com-R: CCGGGTACC CTTAAG CGGTCAGTCACTGCAGCATGTAGG (SEQ ID NO: 16)

[0106] The full-length sequence of OsARF18 gene was amplified, and the vector pCAMBIA1300-CYP703A3-DsRed-ZmAA1 was cut with Afl II to make it linear. The full-length auxin response factor OsARF18 gene was inserted into the vector by homologous recombination to obtain the four-complementation vector pCAMBIA1300-CYP703A3-DsRed2-OsARF18-ZmAA1.

[0107] Step 4: Genetic transformation

[0108] The callus tissue was induced from the young spikelets of the sterile mutant, and the genetic transformation of the four-complementation vector was mediated by Agrobacterium infection to obtain the reproductive line plants with restored fertility. The seeds harvested from the self-pollination of the reproductive line were divided into two types: one was the fluorescent reproductive line seeds, and the other was the non-fluorescent sterile line seeds, such as Figure 7 As shown in the figure, through the herbicide resistance experiment, it was found that the breeding line seeds had no resistance to glufosinate ammonium, while the sterile line seeds showed resistance to glufosinate ammonium, such as Figure 8 shown.

[0109] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A safe production method for rice engineered sterile lines, characterized in that: The steps include: Step 1: Using gene editing methods, a rice material with a homozygous mutation in the auxin response factor OsARF18 gene is obtained, and the rice material plant with a homozygous mutation in the OsARF18 gene exhibits glufosinate resistance; Step 2: Using rice materials with homozygous mutations in the OsARF18 gene as recipients, using gene editing methods, obtain sterile rice materials with double homozygous mutations in the fertility regulating gene CYP703A3 and the auxin response factor OsARF18 gene; Step 3, the full-length complementary sequence of the fertility regulatory gene CYP703A3 gene as shown in SEQ ID NO: 1, the fluorescent protein gene expression element as shown in SEQ ID NO: 2, the pollen lethal gene expression element as shown in SEQ ID NO: 3 and the OsARF18 expression element as shown in SEQ ID NO: 4 are recombinantly integrated into a plant expression vector to construct a four-complementation vector; Step 4: transforming the four-complementation vector into the sterile rice material obtained in step 2 to create a fertility-restored breeding line for breeding of sterile double mutants.

2. The safe production method of rice engineered sterile line according to claim 1, characterized in that: In step 1, the specific method for obtaining a rice material with a homozygous mutation in the auxin response factor OsARF18 gene comprises the following steps: (1.1) Analyze the upstream and downstream sequence regions of the OsARF18 gene in wild-type rice chromosomes, select the base sequence shown in SEQ ID NO: 5 as the editing site, anneal the primer pair shown in SEQ ID NO: 6 and SEQ ID NO: 7, and connect them to the targeting vector pCBSG to obtain the pCBSG-ARF18 recombinant vector; (1.2) The targeting recombinant vector pCBSG-ARF18 is transformed into rice plants, and the rice material osarf18 with the homozygous mutation of the OsARF18 gene is screened.

3. The safe production method of rice engineered sterile line according to claim 1, characterized in that: The specific method for obtaining the sterile rice material with double homozygous mutations of the fertility regulating gene CYP703A3 and the auxin response factor OsARF18 gene comprises: (2.1) Analyze the upstream and downstream sequence regions of the wild-type rice chromosome CYP703A3 gene, select the base sequence shown in SEQ ID NO: 9 as the editing site, anneal the primer pair shown in SEQ ID NO: 9 and SEQ ID NO:, and connect them to the targeting vector pCBSG to obtain the pCBSG-03A3 recombinant vector; (2.2) The targeting recombinant vector pCBSG-03A3 is used to transform the callus tissue induced by the seeds of the rice material osarf18 with homozygous mutation of the OsARF18 gene, and the sterile rice material is screened.

4. The safe production method of rice engineered sterile line according to claim 1, characterized in that: The method for constructing the quaternary complementation vector comprises: (3.1) Connect the fluorescent protein gene fragment to the vector pCAMBIA1300 to obtain the pCAMBIA1300-DsRed2 recombinant vector; (3.2) Connecting the ZmAA1 gene fragment to the vector pCAMBIA1300-DsRed2 to obtain the pCAMBIA1300-DsRed2-ZmAA1 recombinant vector; (3.3) Using homologous recombination method, the full-length sequence of the fertility regulatory gene OsCYP703A3 was inserted into the pCAMBIA1300-DsRed2-ZmAA1 recombinant vector to obtain the pCAMBIA1300-CYP703A3-DsRed2-ZmAA1 recombinant vector; (3.4) Using homologous recombination method, the full-length sequence of the auxin response factor OsARF18 gene was inserted into the pCAMBIA1300-CYP703A3-DsRed2-ZmAA1 recombinant vector to obtain the four-complementation vector pCAMBIA1300-CYP703A3-DsRed2-OsARF18-ZmAA1.

5. The safe production method of rice engineered sterile line according to claim 1, characterized in that: The rice includes all rice resources.

6. Application of the auxin response factor OsARF18 gene in the production of rice engineered sterile lines or third-generation hybrid rice seed production.

7. A rice engineered sterile line, characterized in that: It is prepared by the method according to any one of claims 1 to 5.

Images