Negative-sense RNA virus plant genome editing system and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a negative-sense RNA virus plant genome editing system and application thereof. According to the genome editing system, a CRISPR-Cas9 gene editing technology is used, a plant cytoplasm rhabdovirus is used as a delivery carrier, the rhabdovirus is spread to a plant by means of entomophilous, a gene editing component is delivered to an axillary meristematic zone by utilizing RNA (Ribonucleic Acid) to move a motif, and a mutant lateral bud is obtained along with plant tillering. According to the method, plant gene editing can be completed without tissue culture, plant tissue culture dependence is overcome, the range of gene-editable strains is expanded, and pure mutants can be obtained only by one generation without hybridization and selfing processes.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to a negative-sense RNA virus plant genome editing system and its application, and further relates to plant gene editing using CRISPR-Cas9 gene editing technology with plant cytoplasmic rhabdovirus as a delivery vector. Background Art

[0002] As the third generation of gene editing technology, CRISPR-Cas9 has been widely used in various crop improvement processes. Compared with the previous two generations, it has higher editing efficiency, low off-target rate and simple operation. The most commonly used CRISPR / Cas9 system is isolated from Streptococcus pyogenes and contains the endonuclease SpCas9 and sgRNA. In cells, the Cas9 ribozyme forms a complex with the gRNA. Under the guidance of the gRNA, Cas9 cuts the specific target DNA, causing double-strand breaks (DSBs). When the broken double-stranded DNA is repaired by non-homologous end joining (NHEJ), a small fragment of base insertion or deletion (indel) can be introduced at the break of the DNA. The occurrence of Indel may cause frameshift mutations in the open reading frame of the target gene or introduce a stop codon in advance, resulting in the knockout of the target gene, ultimately achieving the purpose of gene editing. With the maturity of Cas9 derivative technology, gene editing technology is developing in a more precise direction.

[0003] Traditional editing element delivery methods in plants mainly rely on soil Agrobacterium to integrate exogenous DNA containing editing elements into the plant genome, or use a gene gun to bombard exogenous fragments into plant cells. Edited plants are then obtained by tissue culture of explants. There are currently two key technical bottlenecks that limit its application: dependence on tissue culture technology, cumbersome tissue culture operations, long cycles, and easy contamination. Many species have not yet been able to regenerate through tissue culture, and the regeneration effects of different genotypes are also very different, and there are limitations of genotype dependence. Another bottleneck is dependence on transgenics. The integration of exogenous DNA fragments into the plant genome poses unknown biosafety risks, and the application will be restricted in many aspects. Offspring can only obtain non-transgenic mutants through hybridization and self-pollination, which is very difficult for hexaploid wheat. Although many new delivery methods have emerged, they still cannot completely break through the above technical bottlenecks.

[0004] Plant viruses have the characteristics of small genome, large replication, and simple genetic manipulation. The plant virus genome will not be integrated into the genome of the host plant, and has strong biological resource attributes. In the past 30 years, many plant viruses have been transformed into expression vectors for heterologous proteins and silencing vectors, playing an important role in production applications and gene function research. In recent years, researchers have transformed viral vectors into new tools for delivering editing elements, achieving heritable editing in monocotyledons and dicotyledons, and playing an important role in gene function research and breeding. Their strategies are basically divided into two types. One is represented by positive RNA viral vectors, which have limited loading capacity and only deliver sgRNA components, and achieve heritable editing with the help of Cas9 overexpressing plants; the other is represented by negative RNA viruses, which have a large loading capacity and can deliver the entire system, and the edited leaf cells are regenerated by tissue culture to achieve heritable editing. However, both strategies have failed to completely break through the above-mentioned technical bottlenecks.

[0005] In addition, CN110511955A is the research result of the inventor's laboratory, on this basis, the negative-sense RNA virus plant genome editing system was further improved, that is, the gene editing vectors and methods therein are introduced into this application as background technology.

[0006] Based on the above-mentioned existing technologies, there is an urgent need to research and develop a new editing element delivery tool that does not rely on tissue culture or transgenic plants to achieve heritable editing in wheat. Summary of the invention

[0007] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a negative-sense RNA virus plant genome editing system and its application, which includes a virus expression vector containing a reverse complementary strand of the whole genome of barley yellow streak mosaic virus (BYSMV).

[0008] The barley yellow streak mosaic virus BYSMV involved in the present invention belongs to a cytoplasmic rhabdovirus, and its genome is a single-stranded negative-strand RNA with a total length of 12706nt. The NCBI accession number is KM213865. The BYSMV genome can transcribe 9 mRNAs, one of which encodes two proteins, so BYSMV encodes a total of 10 proteins, including 5 structural proteins and 5 auxiliary proteins. The 5 structural proteins include nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and large polymerase protein (L) (Yan et al., 2015). Between the P and M proteins, four auxiliary proteins are encoded, namely P3, P4 / P5, and P6, in which the coding frames of P4 and P5 overlap; between the G and L proteins, the P9 auxiliary protein is encoded.

[0009] The barley yellow streak mosaic virus contained in the vector of the present invention is a negative-strand RNA virus, and the reverse complementary strand of its whole genome is the full-length positive-strand cDNA.

[0010] The present invention provides a method for constructing the above-mentioned expression vector, which comprises: performing reverse transcription and PCR amplification on the genome RNA of barley yellow streak mosaic virus to obtain positive-strand cDNA, and constructing the positive-strand cDNA into a vector.

[0011] The vector includes but is not limited to pXT1 or pCass4-Rz vectors. Plant expression vectors containing cauliflower mosaic virus 35S promoter, hepatitis C virus nuclease (HDVRz) sequence (NCBI accession number is L35896.1 or L35897.1) and transcription terminator sequence (such as nopaline synthase terminator, NCBI accession number is AJ007624.1) can be used as the vector to construct the plant cytoplasmic rhabdovirus expression vector. Preferably, the plant expression vector pCB301 can be selected as the basic construction vector, and other plant expression vectors can also be selected as the basic vector to construct the vector of the present invention.

[0012] In the construction method, the positive-strand cDNA can be constructed into a vector by means of enzyme ligation or homologous recombination.

[0013] Another invention, the present invention provides a method for constructing an editing vector. The construction method comprises the following steps:

[0014] The BYSMV full-length gene was cloned into a vector to construct a full-length infectious cloning vector pBYSMV, in which a GFP gene expression frame was inserted between the N and P genes, and YFP and RFP expression frames were inserted between the M and P6 genes and the M and G genes to obtain a vector pBY-GRY.

[0015] Then, the BYSMV full-length cDNA clone was used as a template, and the fragment between BYSMV P3 and P9 was amplified using primers and cloned into the T vector. This was used as a template for reverse amplification to obtain a linearized vector. A YFP fragment with BYSMV P6 3'UTR and M 5'UTR sequences was synthesized, and homologous recombination was performed with the above vector to obtain a recombinant vector, pT-3-9-YFP. Then, an RFP fragment with BYSMV M 3'UTR and G 5'UTR sequences at the 5' end was synthesized, and homologous recombination was performed with the above vector to obtain a recombinant vector pT-3-9-YR.

[0016] In the third step, the 3-9-YR fragment was amplified and homologously recombined with the pBY-GFP linearized vector to obtain the recombinant vector, pBY-GYR.

[0017] The vector constructed above comprises an exogenous gene insertion site for inserting a sequence-specific nucleic acid modification enzyme and a guide RNA (sgRNA), and optionally, inserting a fluorescent reporter gene.

[0018] When constructing the vector, a sequence-specific nucleic acid modification enzyme gene is inserted between the N and P genes of the viral genome on the vector, wherein the sequence-specific nucleic acid modification enzyme can be a CRISPR / Cas ribozyme, an adenine base editor formed by the fusion of Cas9 ribozyme and adenine deaminase, or a cytosine base editor formed by the fusion of Cas9 ribozyme and cytosine deaminase, or a Cas9 ribozyme modified with an RNA mobile motif; sgRNA is inserted between P6 and M genes, wherein the spacer in the sgRNA can be replaced with a target of any length of 20 nt; and an RFP fluorescent reporter gene is inserted between the M and G genes.

[0019] On the other hand, the present invention provides an editing vector, which is constructed by the above-mentioned construction method. Preferably, a sequence-specific nucleic acid modification enzyme gene is inserted between the N and P genes of the viral genome, wherein the sequence-specific nucleic acid modification enzyme can be a CRISPR / Cas ribozyme, an adenine base editor formed by the fusion of Cas9 ribozyme and adenine deaminase, or a cytosine base editor formed by the fusion of Cas9 ribozyme and cytosine deaminase, and a Cas9 ribozyme modified by a mobile RNA motif; sgRNA is inserted between P6 and M genes, wherein the spacer in sgRNA can be replaced with a target of any length of 20nt; preferably, a fluorescent reporter gene is inserted between M and G genes, and further preferably, the fluorescent reporter gene can be one of RFP, GFP and conventional fluorescent reporter groups in the prior art. Preferably, the editing vector can be a pBY-GRY vector, the sequence of which is as described in SEQID NO: 3; or the reporter gene on pBY-GRY is replaced with the above-mentioned specific nucleic acid modification enzyme gene, sgRNA sequence and other reporter genes.

[0020] On the other hand, the present invention provides an editing vector, whose framework sequence is bp 1-2338, 3060-5544, 6275-7016, and 7696-19818 of SEQ ID NO:3. A preferred editing vector has a sequence similarity of 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more with the above sequence; preferably, the editing vector has the whole genome of BYSMV or a mutant with the same function, and preferably the editing vector can edit 10 proteins of BYSMV, and can encode one or a combination of the following proteins: including 5 structural proteins and 5 auxiliary proteins, the 5 structural proteins include nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), large polymerase protein (G), and 10 amino acids. protein, L); between the P and M proteins, four auxiliary proteins are encoded, namely P3, P4 / P5, and P6, among which the coding frames of P4 and P5 overlap; between the G and L proteins, the P9 auxiliary protein is encoded. The above 10 proteins of BYSMV can be encoded in the above order, or the order of the protein encoding elements can be changed. The nucleotides encoding the above 10 BYSMV proteins can have mutations, substitutions, deletions or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, and 30 bases. The mutant nucleotides encoding the above 10 BYSMV proteins still have the function of encoding the corresponding viral proteins.

[0021] On the other hand, the present invention also provides the construction of an auxiliary vector, comprising

[0022] a) A vector expressing N, P, and L of BYSMV respectively; or a vector expressing N, P, and L of BYSMV simultaneously;

[0023] b) A vector that simultaneously expresses the gene silencing suppressors p19, HCpro and γb.

[0024] The infectivity of the vector expressing N, P and L of BYSMV simultaneously is much higher than that of the vector expressing N, P and L of the virus separately. When the vector described in b) participates in co-infection, the expression amount of the viral vector can be increased, greatly increasing the success rate of infectious cloning.

[0025] Preferably, the auxiliary vector can be pGD-NLP and pGD-VSRs, and the construction method thereof is recorded in the prior art (Qiang Gao et al., The plant rhabdovirus viroporin P9 facilitates insect-mediated virus transmission in barley. "The PLANT CELL", 2024, 36, 3483-3497).

[0026] On the other hand, in order to break through the technical bottleneck of gene editing breeding, the present invention performs TLS (tRNA-like structure) modification on the editing element on the vector so that it can move between cells in the form of RNA.

[0027] Wherein the TLS sequence is as described in SEQ ID NO:2,

[0028] 5'-TTATCAGAGTGGGTGGTGGGCCCATAACCCACAGGTCCGCTCT GATA-3'.

[0029] TLS modification includes connecting a TLS sequence to the 5' end, 3' end or the middle position of the editing element on the vector. The connecting sequence can have 1, 2, 3, 4, 5 or more base intervals with the editing element without affecting the reading frame of the editing element.

[0030] The editing element is a genome editing tool, including the use of at least one site-specific nuclease, such as an RNA-guided nuclease (e.g., Cas nuclease), a zinc finger nuclease, a meganuclease, a TALE-nuclease, a recombinase, a transposase, and any combination thereof;

[0031] Preferably, the genome editing is selected from CRISPR / Cas, TALEN, ZFN, transposon technology, PASTE technology, PE technology, base editor, and any combination thereof, preferably an element and / or gRNA encoding Cas9. Preferably, the Cas9 sequence is as described in SEQ ID NO:4.

[0032] On the other hand, the present invention provides an editing element, preferably, a gRNA used in conjunction with Cas9, preferably, the gRNA sequence is

[0033] 5'-NNNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCA AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCAC CGAGTCGGTGC-3'. "N...N" is the gRNA sequence targeting the target, and the remaining sequence is a sgRNA-Scaffold structure that is specifically suitable for the transfer of the editing element in the vector of the present invention and can be recognized by the transferred Cas9 enzyme. Preferably, the gRNA is ACGACCTGTAATGGTTTACT.

[0034] On the other hand, the present invention obtains a CRISPR / Cas9 editing system through the aforementioned vector and TLS modification of the vector, which can complete genome editing in the axillary meristem of plants.

[0035] Preferably, the editing system completes virus rescue / virus resurrection / virus regeneration / virus regeneration in the plant through the aforementioned vector, and obtains the virus for transmission to the target plant through the medium. Preferably, the recipient plant can be a gramineous crop, preferably a monocotyledonous plant, more preferably barley, wheat, millet, corn, preferably barley or wheat.

[0036] The virus rescue / virus resuscitation / virus regeneration / virus regeneration process can be completed in a plant, and the plant is a dicotyledonous plant, preferably tobacco. Preferably, the vector can be an insect vector, and the preferred insect vector is a planthopper, more preferably a gray leafhopper, a white-backed planthopper or a brown planthopper.

[0037] The plant cytoplasmic rhabdovirus expression vector provided by the present invention is a vector containing the reverse complementary chain of the BYSMV full genome.

[0038] Since the barley yellow streak mosaic virus is a negative-strand RNA virus, the reverse complementary strand of its whole genome is the full-length positive-strand cDNA.

[0039] In another aspect, the present invention provides a plant gene editing method. Preferably, the method comprises any one or a combination of the following steps, the steps comprising:

[0040] First, the recombinant virus is rescued in plants. The viral replication-related proteins N, P, L proteins, the full-length recombinant virus and the silencing suppressor are expressed in plants by Agrobacterium-mediated transient expression. Preferably, Agrobacterium carrying BYSMV editing vector, pGD-VSRs and pGD-NLP plasmids are mixed and injected into plant leaves. After greenhouse cultivation, the RFP fluorescence signal is detected. The RFP fluorescence indicates that the recombinant virus is successfully rescued into the plant. The plant is preferably tobacco.

[0041] The carrier and the auxiliary carrier are injected in a ratio of 1.0:(0.2-0.7):(0.4-0.95). Preferably, the injection ratio is 1.0:(0.3-0.6):(0.5-0.9), and more preferably, the injection ratio is 1.0:(0.4-0.55):(0.7-0.85).

[0042] Secondly, take the injected plant leaf area, place it in a pre-cooled mortar, add microinjection buffer and grind it thoroughly. The mass of the injected plant leaf area is 0.1-2g, preferably 0.2-0.8g, more preferably 0.3-0.5g. The buffer is preferably Tris-HCl buffer or PBS, preferably, the buffer formula is 100mM Tris-HCl, 10mM Mg(CH 3 COO 2 ,1mM MnCl 2 ,40mM Na 2 SO 3 , pH 8.0.

[0043] The virus juice is transferred to an EP tube, and the supernatant is taken after centrifugation. The crude virus extract is injected into the second-instar nymphs of the gray planthopper, and the nymphs are incubated in rice. The centrifugation condition is preferably 12000g for 10 minutes. The infected planthoppers are selected for virus transmission according to the reporter gene.

[0044] Finally, wheat was inoculated with planthoppers carrying the reporter gene. After the wheat seeds germinated in an environment of 20-28°C, the seedlings were vernalized in an environment of 2-8°C for 2-21 days before the virus inoculation experiment was carried out. After 2-21 days, the reporter gene signal was detected, and the virus-infected leaves were selected for target editing detection.

[0045] On the other hand, the present invention provides a negative-sense RNA virus plant genome editing system, which comprises the above-mentioned vector, or a vector constructed by the above-mentioned vector construction method, wherein the sgRNA can be designed and replaced for any target to be edited. Preferably, the above-mentioned editing system is for barley or wheat.

[0046] Preferably, the present invention provides a virus-mediated DNA-free wheat gene editing method that does not require tissue culture. According to the above method, the recombinant rhabdovirus is introduced into wheat cells, and the sequence-specific nucleic acid modification enzyme component is delivered to the axillary meristem using the RNA mobile motif, and the mutant lateral buds are induced during the tillering process of wheat. Finally, the mutant lateral buds are cultured to maturity, the progeny are harvested, and the M1 generation is tested.

[0047] The specific steps include: first, inoculating the recombinant virus into wheat seedlings that have been vernalized for more than 10 days, culturing them in a 25°C environment with a 16-hour light and 8-hour dark cycle for two months, and then cutting off the main stem. Secondly, sampling all the side buds to detect the target editing situation, and retaining the side buds that have been edited. After 15 days, all the side buds are tested again, and the side buds with a high degree of editing (editing efficiency greater than 75%) are retained.

[0048] The technical effects of the present invention include:

[0049] 1. The present invention develops a BYSMV carrier with strong plasticity and large loading capacity;

[0050] 2. The gene editing method of the present invention promotes the delivery of editing elements to the meristem through RNA mobile motifs;

[0051] 3. The method of the present invention obtains mutants by means of plant tillering, breaking through the limitation of tissue culture in conventional plant editing, and providing a new approach for editing plants with tissue culture restriction lines such as barley and wheat; the mutant parent is induced by plant tillering and does not need to undergo regeneration culture;

[0052] 4. The present invention utilizes BYSMV editing vector to perform heritable editing of wheat genes, and the virus delivers editing elements instantaneously without the need to be integrated into the plant genome.

[0053] 5. The pure homozygous mutation efficiency of the progeny of the present invention is 100%, and the pure homozygous mutant can be obtained in only one generation without going through the hybridization and self-pollination process. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 Schematic diagram of the BY-GYR and BY-GRC vector structures and the auxiliary vectors pGD-NLP and pGD-VSRs.

[0055] Figure 2 Evaluation of the infectivity and exogenous protein expression ability of BY-GYR and BY-GRC.

[0056] Figure 3 Schematic diagram of BYSMV tri-fluorescent vector and BYSMV editing vector.

[0057] Figure 4 Flow chart of wheat inoculation with recombinant BYSMV.

[0058] Figure 5 Detection of BYSMV-delivered editing elements.

[0059] Figure 6 Induction of lateral buds in albino mutants.

[0060] Figure 7 Phenotypic status of offspring mutants.

[0061] Figure 8 Genotype detection of offspring mutants.

[0062] Fig. 9 Schematic diagram of constructing editing TaeIF4E and TaSDN1 editing vectors.

[0063] Fig.10 TaeIF4E and TaSDN1 genes were edited in wheat, and PCR was used to verify the results of wheat somatic cell gene editing.

[0064] Fig.11 The lateral buds of TaeIF4E and TaSDN1 gene-edited mutants were screened and verified by PCR.

[0065] Fig.12 The mutant lateral buds were cultured and the allele mutant progeny were obtained by PCR detection. DETAILED DESCRIPTION

[0066] The following is a further description of the concept of the present invention and the technical effects produced in conjunction with specific embodiments, so as to fully understand the purpose, features and effects of the present invention. The methods are conventional methods unless otherwise specified. The materials can be obtained from public commercial channels unless otherwise specified. The illustrative embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations of the present invention. It should be noted that the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

[0067] In this example, the homologous recombination step uses the Vazyme homologous recombination rapid cloning kit C115-02-AA. The conventional molecular experimental methods in this example can refer to the specific experimental steps and methods in J. Sambrook et al., Molecular Cloning Experiment Guide, Second Edition, Science Press, 1995.

[0068] Example 1: Vector backbone construction

[0069] The construction of vector pBY-GRY is divided into two parts. In the first part, the full-length infectious cloning vector pBYSMV is used as the backbone, and the GFP gene expression frame is inserted between the NP gene to obtain the vector pBY-GFP; in the second part, the vector pBY-GFP is used as the backbone, and the YFP and RFP expression frames are inserted between the M, P6 genes and the M, G genes respectively to obtain the vector pBY-GRY.

[0070] For the first part, first use the BYSMV full-length cDNA clone as a template, use primers 35S-F / P-1-R to amplify the BY-NP fragment and clone it into the T vector to obtain the pT-BY-NP vector. Use this as a template to reversely amplify the vector using primers NR / N3UTR-F to obtain a linearized vector. Synthesize a GFP fragment with BYSMV N 3'UTR and P 5'UTR sequences at the 5' end, and perform homologous recombination with the above vector. The recombination system is 10 μL, and the components are as follows:

[0071] Element volume pT-BY-NP linearized vector 50ng GFP synthetic fragment 50ng 2*seamless assembly mix 5μL ddH2O Make up to 10 μL

[0072] After reacting at 50°C for 10 min, all recombinant products were transformed into competent E. coli DH5α, incubated on ice for 10 min, heat-shocked at 42°C for 90 s, and an appropriate amount of liquid LB was added. After shaking culture at 37°C and 220 rpm for 30 min, the culture was spread on solid LB medium containing 50 μg / mL kanamycin. After overnight culture, positive clones were screened and plasmids were extracted from the positive clones to obtain the recombinant vector, pT-BY-NP-GFP.

[0073] The BYSMV full-length cDNA cloning vector pBYSMV was digested with ClaⅠ and NotⅠ to obtain a linearized vector. At the same time, pT-BY-NP-GFP was used as a template, and the NP-GFP fragment was amplified using primers 35S-F / P-1-R and gel-recovered. The recovered fragment was homologously recombined with the pBYSMV linearized vector. The recombinant system was 10 μL, and the components were as shown in the following table

[0074] Element volume pBYSMV linearized vector 50ng NP-GFP fragment 50ng 2*seamless assembly mix 5μL ddH2O Make up to 10 μL

[0075] After reacting at 50°C for 10 min, all the recombinant products were transformed into competent E. coli DH5α, incubated on ice for 10 min, heat-shocked at 42°C for 90 s, and an appropriate amount of liquid LB was added. After shaking culture at 37°C and 220 rpm for 30 min, the culture was spread on solid LB medium containing 50 μg / mL kanamycin. After overnight culture, positive clones were screened, and plasmids were extracted from the positive clones to obtain the recombinant vector, pBY-GFP.

[0076] For the second part, first use the BYSMV full-length cDNA clone as a template, use primers P3-F / P9-R to amplify the BY-3-9 fragment and clone it into the T vector to obtain the pT-BY-3-9 vector, which is used as a template to reversely amplify the vector using primers P6-R / P6-3UTR-F to obtain a linearized vector. Synthesize the YFP fragment with BYSMV P6 3'UTR and M 5'UTR sequences at the 5' end, and perform homologous recombination with the above vector. The recombination system is 10 μL, and the components are as follows:

[0077] Element volume pT-BY-3-9 linearized vector 50ng YFP synthetic fragment 50ng 2*seamless assembly mix 5μL ddH2O Make up to 10 μL

[0078] After reacting at 50°C for 10 min, all the recombinant products were transformed into competent E. coli DH5α, incubated on ice for 10 min, heat-shocked at 42°C for 90 s, and an appropriate amount of liquid LB was added. After shaking culture at 37°C and 220 rpm for 30 min, the culture was spread on solid LB medium containing 50 μg / mL kanamycin. After overnight culture, positive clones were screened and plasmids were extracted from the positive clones to obtain the recombinant vector, pT-3-9-YFP.

[0079] Using pT-3-9-YFP as template, reverse amplify the vector using primers MR / M-3UTR-F to obtain a linearized vector. Synthesize the RFP fragment with M 3'UTR and G 5'UTR of BYSMV at the 5' end.

[0080] UTR sequence, and homologous recombination with the above vector, the recombination system is 10 μL, and the components are as follows:

[0081] Element volume pT-3-9-YFP linearized vector 50ng RFP synthetic fragment 50ng 2*seamless assembly mix 5μL ddH2O Make up to 10 μL

[0082] After reacting at 50°C for 10 min, all recombinant products were transformed into competent E. coli DH5α, incubated on ice for 10 min, heat-shocked at 42°C for 90 s, and an appropriate amount of liquid LB was added. After shaking culture at 37°C and 220 rpm for 30 min, the culture was spread on solid LB medium containing 50 μg / mL kanamycin. After overnight culture, positive clones were screened and plasmids were extracted from the positive clones to obtain the recombinant vector, pT-3-9-YR.

[0083] The third step is to digest the pBY-GFP vector with SalⅠ and SwaⅠ to obtain a linearized vector. At the same time, pT-3-9-YR is used as a template, and the 3-9-YR fragment is amplified with primers P3-F / P9-R and gel-recovered. The recovered fragment is homologously recombined with the pBY-GFP linearized vector. The recombinant system is 10 μL, and the components are as follows:

[0084]

[0085]

[0086] After reacting at 50°C for 10 min, all recombinant products were transformed into competent E. coli DH5α, incubated on ice for 10 min, heat-shocked at 42°C for 90 s, and an appropriate amount of liquid LB was added. After shaking culture at 37°C and 220 rpm for 30 min, the culture was spread on solid LB medium containing 50 μg / mL kanamycin. After overnight culture, positive clones were screened and plasmids were extracted from the positive clones to obtain the recombinant vector, pBY-GYR.

[0087] The primers used in the above process are listed as follows:

[0088] Primers Sequence (5'-3') 35S-F GAGGTATCCACAACGCCGGCGGCCGCGGTGTCTCGCACACGGCTTCG P-1-R CCTCTGATGTATTCTTCTCTTCTCCCTGGGCCCAGCTTGCAATCGATG NR TTAGGAGAAGATCTGGTCAGCATTCTTTTTCGCCG N3UTR-F AGGAATCGGGAATCATTAATATCTACTTTATTGTGTGCTTCC P3-F GGGGAGTTGATCATAATGCCATCATTTAAATGTTCCAACATCCCTCATTC P9-R TCAGTTTTATTAATTACTATAATCTTTGTAGTCGACTCATTTATGAGTATG P6-R TCATATGATCCCCTGCATATTTCCAGTGACTG P6-3UTR-F ACCCCTTAACCGAGTAACTCCCTCACTAATACTAAAT MR CTACTTCTTTTTCTCCTTCTCATGGTACGTTGTTGG M-3UTR-F GTATTCACTCTCCAAGCTTTGTACTAGTAATCCAGCC

[0089] The pBY-GRY vector sequence is as follows: SEQ ID NO: 3

[0090]

[0091]

[0092]

[0093]

[0094] TGGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTC

[0095] GGATGGCTAAGGGAGAGCTCGAATTTCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGA

[0096] ATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACAT

[0097] GTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATA

[0098] GAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGAA

[0099] TTCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGACAGGATATATTGGCGGGTAAACCTA

[0100] AGAGAAAAGAGCGTTTATTAGAATAATCGGATATTTAAAAGGGCGTGAAAAGGTTTATCCGTTCGTCCATT

[0101] TGTATGTGCATGCCAACCACAGGAGATCTCAGTAAAGCGCTGGCTGAACCCCCAGCCGGAACTGACCCC

[0102] ACAAGGCCCTAGCGTTTGCAATGCACCAGGTCATCATTGACCCAGGCGTGTTCCACCAGGCCGCTGCCTC

[0103] GCAACTCTTCGCAGGCTTCGCCGACCTGCTCGCGCCACTTCTTCACGCGGGTGGAATCCGATCCGCACAT

[0104] GAGGCGGAAGGTTTCCAGCTTGAGCGGGTACGGCTCCCGGTGCGAGCTGAAATAGTCGAACATCCGTCG

[0105] GGCCGTCGGCGACAGCTTGCGGTACTTCTCCCATATGAATTTCGTGTAGTGGTCGCCAGCAAACAGCACG

[0106] ACGATTTCCTCGTCGATCAGGACCTGGCAACGGGACGTTTTCTTGCCACGGTCCAGGACGCGGAAGCGG

[0107] TGCAGCAGCGACACCGATTCCAGGTGCCCAACGCGGTCGGACGTGAAGCCCATCGCCGTCGCCTGTAGG

[0108] CGCGACAGGCATTCCTCGGCCTTCGTGTAATACCGGCCATTGATCGACCAGCCCAGGTCCTGGCAAAGCT

[0109] CGTAGAACGTGAAGGTGATCGGCTCGCCGATAGGGGTGCGCTTCGCGTACTCCAACACCTGCTGCCACA

[0110] CCAGTTCGTCATCGTCGGCCCGCAGCTCGACGCCGGTGTAGGTGATCTTCACGTCCTTGTTGACGTGGAA

[0111] AATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTTCTTGTTGCGCGTGGTGAACAGGGCAGAGCGGGC

[0112] CGTGTCGTTTGGCATCGCTCGCATCGTGTCCGGCCACGGCGCAATATCGAACAAGGAAAGCTGCATTTCC

[0113] TTGATCTGCTGCTTCGTGTGTTTCAGCAACGCGGCCTGCTTGGCCTCGCTGACCTGTTTTGCCAGGTCCT

[0114] CGCCGGCGGTTTTTCGCTTCTTGGTCGTCATAGTTCCTCGCGTGTCGATGGTCATCGACTTCGCCAAACCT

[0115] GCCGCCTCCTGTTCGAGACGACGCGAACGCTCCACGGCGGCCGATGGCGCGGGCAGGGCAGGGGGAGC

[0116] CAGTTGCACGCTGTCGCGCTCGATCTTGGCCGTAGCTTGCTGGACCATCGAGCCGACGGACTGGAAGGT

[0117] TTCGCGGGGCGCACGCATGACGGTGCGGCTTGCGATGGTTTCGGCATCCTCGGCGGAAAACCCCGCGTC

[0118] GATCAGTTCTTGCCTGTATGCCTTCCGGTCAAACGTCCGATTCATTCACCCTCCTTGCGGGATTGCCCCGA

[0119] CTCACGCCGGGGCAATGTGCCCTTATTCCTGATTTGACCCGCCTGGTGCCTTGGTGTCCAGATAATCCACC

[0120] TTATCGGCAATGAAGTCGGTCCCGTAGACCGTCTGGCCGTCCTTCTCGTACTTGGTATTCCGAATCTTGCC

[0121] CTGCACGAATACCAGCGACCCCTTGCCCAAATACTTGCCGTGGGCCTCGGCCTGAGAGCCAAAACACTT

[0122] GATGCGGAAGAAGTCGGTGCGCTCCTGCTTGTCGCCGGCATCGTTGCGCCACATCTAGGTACTAAAACAA

[0123] TTCATCCAGTAAAATATAATATTTTATTTTCTCCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAATAGCTC

[0124] GACATACTGTTCTTCCCCGATATCCTCCCTGATCGACCGGACGCAGAAGGCAATGTCATACCACTTGTCCG

[0125] CCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCATCTTTCACAAAGATGTTGCTGTCTCCC

[0126] AGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTTCCGTCTTTAAAAAATCATACAGCTCGCGCG

[0127] GATCTTTAAATGGAGTGTCTTCTTCCCAGTTTTCGCAATCCACATCGGCCAGATCGTTATTCAGTAAGTAAT

[0128] CCAATTCGGCTAAGCGGCTGTCTAAGCTATTCGTATAGGGACAATCCGATATGTCGATGGAGTGAAAGAG

[0129] CCTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCTTCCGAGCAAA

[0130] GGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGTTCAAAGTGCAGGACCTTTGG

[0131] AACAGGCAGCTTTCCTTCCAGCCATAGCATCATGTCCTTTTCCCGTTCCACATCATAGGTGGTCCCTTTATA

[0132] CCGGCTGTCCGTCATTTTTAAATATAGGTTTTCATTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACAT

[0133] TCCTTCCGTATCTTTTACGCAGCGGTATTTTTCGATCAGTTTTTTCAATTCCGGTGATATTCTCATTTTAGCC

[0134] ATTTATTATTTCCTTCCTCTTTTCTACAGTATTTAAAGATACCCCAAGAAGCTAATTATAACAAGACGAACT

[0135] CCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATACCAGAAAACAGCTTTTTCAAAGTTGTTTTCAAAG

[0136] TTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAACCACAATTATGGGTGATGCTGCCAACTCGAG

[0137] AGCGGGCCGGGAGGGTTCGAGAAGGGGGGGCACCCCCCTTCGGCGTGCGCGGTCACGCGCACAGGGC

[0138] GCAGCCCTGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAGGTTAGCGGTGG

[0139] CCGAAAAACGGGCGGAAACCCTTGCAAATGCTGGATTTTCTGCCTGTGGACAGCCCCTCAAATGTCAAT

[0140] AGGTGCGCCCCTCATCTGTCAGCACTCTGCCCCTCAAGTGTCAAGGATCGCGCCCCTCATCTGTCAGTAG

[0141] TCGCGCCCCTCAAGTGTCAATACCGCAGGGCACTTATCCCCAGGCTTGTCCACATCATCTGTGGGAAACT

[0142] CGCGTAAAATCAGGCGTTTTCGCCGATTTGCGAGGCTGGCCAGCTCCACGTCGCCGGCCGAAATCGAGC

[0143] CTGCCCCTCATCTGTCAACGCCGCGCCGGGTGAGTCGGCCCCTCAAGTGTCAACGTCCGCCCCTCATCTG

[0144] TCAGTGAGGGCCAAGTTTTCCGCGAGGTATCCACAACGCCGGCGGCCGCGGTGTCTCGCACACGGCTTC

[0145] GACGGCGTTTCTGGCGCGTTTGCAGGGCCATAGACGGCCGCCAGCCCAGCGGCGAGGGCAACCAGCCC

[0146] GGTGAGCGTCTAGTGGACTGATGGGCTGCCTGTATCGAGTGGTGATTTTGTGCCGAGCTGCCGGTCGGGG

[0147] AGCTGTTGGCTGCTGGGTGGCAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACA

[0148] CATTGCGGACGTTTTTAATGTACTGGGGGTGGTTTT

[0149] Underlined font indicates the GFP expression cassette, double underlined font indicates the YFP expression cassette, and underlined and italic font indicates the RFP expression cassette.

[0150] Example 2: Evaluation of vector infectivity and exogenous protein expression ability

[0151] Rescue the recombinant viruses BY-GYR and BY-GRC (i.e., pCB-BYSMV-EGFP-RFP-ECFP in CN110511955A) in tobacco. The sequence structures of the two vectors are as follows Figure 1As shown, the infectivity of the two viral vector backbones was compared. The EGFP reporter gene was inserted in the same position of the two viral vectors, so the expression of GFP can reflect the accumulation level of the virus and evaluate the ability of the viral vector to express foreign proteins.

[0152] The specific steps are as follows: transform the two vectors into Agrobacterium GV3101 competent cells, add 1 μg plasmid to GV3101 competent cells, ice bath for 30 minutes, quick freeze in liquid nitrogen for 1 minute, heat shock at 37°C for 5 minutes, add appropriate amount of liquid LB medium, culture at 28°C, 220rpm for 4-6 hours, and then apply to solid medium with corresponding antibiotics. Pre-injection treatment of Agrobacterium, inoculate 15mL LB liquid medium (containing 25μg / mL rifampicin, 50μg / mL kanamycin, 25μg / mL gentamicin) with Agrobacterium carrying the above recombinant plasmids and pGD-VSRs and pGD-NLP plasmids, and culture at 28°C, 220rpm until OD 600 The cell suspension was about 1.2, and then centrifuged at 3000g for 10 min to collect the bacteria, discard the supernatant, and use 4 mL of Agrobacterium suspension buffer (10 mM MgCl 2, 10mM MES, 200mM Cetosyringone) and divided into two groups for mixing. In the first group, Agrobacterium carrying pBY-GYR, pGD-VSRs and pGD-NLP plasmids were mixed at a final concentration of OD600 of 1.0:0.5:0.8; in the second group, Agrobacterium carrying pBY-GRC, pGD-VSRs and pGD-NLP plasmids were mixed at a final concentration of OD600 of 1.0:0.5:0.8. After standing for 2-3 hours, the leaves of Nicotiana benthamiana were injected with a disposable syringe infiltration method. The specific operation is to use a 1mL disposable syringe to absorb an appropriate amount of bacterial solution, hold the Nicotiana benthamiana leaf with the left hand, hold the syringe bacterial solution injection needle in the right hand to the area between the second and third veins on the back of the leaf, and slowly push the syringe to fully inject the bacterial solution into the intercellular space on the back of the leaf, and finally make the injection area reach a diameter of 2cm. BY-GYR and BY-GRC groups were injected with the left and right halves of the back of the same leaf, respectively, to eliminate the error caused by the difference in growth status of different leaves. 15 days after injection, about 0.1g of leaves from the injection area of ​​BY-GYR and BY-GRC groups were collected, sampled with liquid nitrogen, and 600μL of 2*SDS loading (100mM Tris-HCl, 20% glycerol, 4% SDS, 0.2% bromophenol blue, 5% β-mercaptoethanol, pH 6.8) was added respectively. After boiling the sample for 10min, centrifuged at 12000g for 10min, and 10μL of the supernatant was taken for SDS-PAGE. First, electrophoresis was performed at 80v for 20min, and the voltage was adjusted to 120v after the sample was separated from the gel. The electrophoresis was stopped after the loading of the sample ran out, and the protein was transferred to the nitrocellulose membrane by electrotransfer, 200mA, 90min. After the transfer, the nitrocellulose membrane was rinsed in TBST buffer (20mM Tris-HCl, 150mM NaCl, 0.05% Tween 20, pH 7.5) and then transferred to the blocking solution (TBST + 5% skim milk powder) and blocked at room temperature for 1 hour. After blocking, GFP antibody was added, incubated at room temperature for 1 hour, and then rinsed three times with TBST. GAR secondary antibody was added, incubated at room temperature for 30 minutes, rinsed three times with TBST, and then developed by chemiluminescence.

[0153] The results are as follows Figure 2 The results showed that the accumulation level of GFP protein in the BY-GYR experimental group was significantly higher than that in the BY-GRC experimental group, indicating that BY-GYR has higher infectivity than BY-GRC in tobacco, and its ability to express heterologous proteins is also higher than BY-GRC. Mock is the blank control group, and RbcL is the large subunit of plant Rubisco, which is used as a loading control.

[0154] The virus vector pBY-GRC is disclosed in the article published by the inventor's research group, and the optimized virus triple fluorescent vector pBY-GYR constructed by the present invention. In the two vectors, the three expression frames are inserted into different genomic positions, which will affect the genome structure of the virus and thus affect its infectivity. The virus triple fluorescent vector pBY-GYR of the present invention has a stronger heterologous expression ability and is more suitable for the development of editing vectors.

[0155] Example 3: Construction of TaPDS editing vector

[0156] The wheat TaPDS gene (FJ517553) was selected as the target and sgRNA (SEQ ID NO:1:5'- ACGACCT GTAATGGTTTACT The BYSMV editing vector was constructed by modifying the pBY-GRY plasmid with TLS (SEQ ID NO:2:5'-TTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGC TCTGATA-3'). The construction of the BYSMV editing vector only requires two steps of modification based on the pBY-GRY plasmid. The YFP and GFP genes of the pBY-GRY plasmid were replaced by the synthesized TLS-modified sgRNA and Cas9 mRNA in sequence using homologous recombination. In the first step, the pBY-GRY vector was digested at 37°C for 1h using restriction endonuclease SalⅠ and then gel-recovered to obtain a linearized vector, which was homologously recombined with the synthesized sgRNA-TLS fragment to replace the YFP gene and obtain the recombinant vector pBY-TaPDS-TLS.

[0157] The Cas9 sequence (SEQ ID NO: 4) was synthesized and its 3' end was TLS modified (SEQ ID NO: 2, 5'-TTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGC TCTGATA-3'). In the second step, the pBY-TaPDS-TLS vector was digested at 37°C for 1 hour using restriction endonuclease MluⅠ, and the linearized vector was recovered by gel recovery. The homologous recombination with the synthesized Cas9-TLS fragment was performed to replace the GFP gene. Positive clones were screened and sequenced to obtain the editing vector pBY-Cas9-TaPDS-TLS, as shown in Figure 2. Figure 3 shown.

[0158] The Cas9 sequence is as follows: SEQ ID NO: 4

[0159] ATGGATTACAAGGACCACGACGGGGATTACAAGGACCACGACATTGATTACAAGGATGATGATGACAAG

[0160] ATGGCTCCGAAGAAGAAGAGGAAGGTTGGCATCCACGGGGTGCCAGCTGCTGACAAGAAGTACTCGAT

[0161] CGGCCTCGATATTGGGACTAACTCTGTTGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCTCAAA

[0162] GAAGTTCAAGGTCCTGGGCAACACCGATCGGCATTCCATCAAGAAGAATCTCATTGGCGCTCTCCTGTTC

[0163] GACAGCGGCGAGACGGCTGAGGCTACGCGGCTCAAGCGCACCGCCCGCAGGCGGTACACGCGCAGGAA

[0164] GAATCGCATCTGCTACCTGCAGGAGATTTTCTCCAACGAGATGGCGAAGGTTGACGATTCTTTCTTCCAC

[0165] AGGCTGGAGGAGTCATTCCTCGTGGAGGAGGATAAGAAGCACGAGCGGCATCCAATCTTCGGCAACATT

[0166] GTCGACGAGGTTGCCTACCACGAGAAGTACCCTACGATCTACCATCTGCGGAAGAAGCTCGTGGACTCC

[0167] ACAGATAAGGCGGACCTCCGCCTGATCTACCTCGCTCTGGCCCACATGATTAAGTTCAGGGGCCATTTCC

[0168] TGATCGAGGGGGATCTCAACCCGGACAATAGCGATGTTGACAAGCTGTTCATCCAGCTCGTGCAGACGTA

[0169] CAACCAGCTCTTCGAGGAGAACCCCATTAATGCGTCAGGCGTCGACGCGAAGGCTATCCTGTCCGCTAG

[0170] GCTCTCGAAGTCTCGGCGCCTCGAGAACCTGATCGCCCAGCTGCCGGGCGAGAAGAAGAACGGCCTGT

[0171] TCGGGAATCTCATTGCGCTCAGCCTGGGGCTCACGCCCAACTTCAAGTCGAATTTCGATCTCGCTGAGGA

[0172] CGCCAAGCTGCAGCTCTCCAAGGACACATACGACGATGACCTGGATAACCTCCTGGCCCAGATCGGCGA

[0173] TCAGTACGCGGACCTGTTCCTCGCTGCCAAGAATCTGTCGGACGCCATCCTCCTGTCTGATATTCTCAGG

[0174] GTGAACACCGAGATTACGAAGGCTCCGCTCTCAGCCTCCATGATCAAGCGCTACGACGAGCACCATCAG

[0175] GATCTGACCCTCCTGAAGGCGCTGGTCAGGCAGCAGCTCCCCGAGAAGTACAAGGAGATCTTCTTCGAT

[0176] CAGTCGAAGAACGGCTACGCTGGGTACATTGACGGCGGGGCCTCTCAGGAGGAGTTCTACAAGTTCATC

[0177] AAGCCGATTCTGGAGAAGATGGACGGCACGGAGGAGCTGCTGGTGAAGCTCAATCGCGAGGACCTCCT

[0178] GAGGAAGCAGCGGACATTCGATAACGGCAGCATCCCACACCAGATTCATCTCGGGGAGCTGCACGCTAT

[0179] CCTGAGGAGGCAGGAGGACTTCTACCCTTTCCTCAAGGATAACCGCGAGAAGATCGAGAAGATTCTGAC

[0180] TTTCAGGATCCCGTACTACGTCGGCCCACTCGCTAGGGGCAACTCCCGCTTCGCTTGGATGACCCGCAAG

[0181] TCAGAGGAGACGATCACGCCGTGGAACTTCGAGGAGGTGGTCGACAAGGGCGCTAGCGCTCAGTCGTT

[0182] CATCGAGAGGATGACGAATTTCGACAAGAACCTGCCAAATGAGAAGGTGCTCCCTAAGCACTCGCTCCT

[0183] GTACGAGTACTTCACAGTCTACAACGAGCTGACTAAGGTGAAGTATGTGACCGAGGGCATGAGGAAGCC

[0184] GGCTTTCCTGTCTGGGGAGCAGAAGAAGGCCATCGTGGACCTCCTGTTCAAGACCAACCGGAAGGTCAC

[0185] GGTTAAGCAGCTCAAGGAGGACTACTTCAAGAAGATTGAGTGCTTCGATTCGGTCGAGATCTCTGGCGTT

[0186] GAGGACCGCTTCAACGCCTCCCTGGGGACCTACCACGATCTCCTGAAGATCATTAAGGATAAGGACTTCC

[0187] TGGACAACGAGGAGAATGAGGATATCCTCGAGGACATTGTGCTGACACTCACTCTGTTCGAGGACCGGG

[0188] AGATGATCGAGGAGCGCCTGAAGACTTACGCCCATCTCTTCGATGACAAGGTCATGAAGCAGCTCAAGA

[0189] GGAGGAGGTACACCGGCTGGGGGAGGCTGAGCAGGAAGCTCATCAACGGCATTCGGGACAAGCAGTCC

[0190] GGGAAGACGATCCTCGACTTCCTGAAGAGCGATGGCTTCGCGAACCGCAATTTCATGCAGCTGATTCAC

[0191] GATGACAGCCTCACATTCAAGGAGGATATCCAGAAGGCTCAGGTGAGCGGCCAGGGGGACTCGCTGCAC

[0192] GAGCATATCGCGAACCTCGCTGGCTCGCCAGCTATCAAGAAGGGGATTCTGCAGACCGTGAAGGTTGTG

[0193] GACGAGCTGGTGAAGGTCATGGGCAGGCACAAGCCTGAGAACATCGTCATTGAGATGGCCCGGGAGAA

[0194] TCAGACCACGCAGAAGGGCCAGAAGAACTCACGCGAGAGGATGAAGAGGATCGAGGAGGGCATTAAG

[0195] GAGCTGGGGTCCCAGATCCTCAAGGAGCACCCGGTGGAGAACACGCAGCTGCAGAATGAGAAGCTCTA

[0196] CCTGTACTACCTCCAGAATGGCCGCGATATGTATGTGGACCAGGAGCTGGATATTAACAGGCTCAGCGATT

[0197] ACGACGTCGATCATATCGTTCCACAGTCATTCCTGAAGGATGACTCCATTGACAACAAGGTCCTCACCAG

[0198] GTCGGACAAGAACCGGGGCAAGTCTGATAATGTTCCTTCAGAGGAGGTCGTTAAGAAGATGAAGAACTA

[0199] CTGGCGCCAGCTCCTGAATGCCAAGCTGATCACGCAGCGGAAGTTCGATAACCTCACAAAGGCTGAGAG

[0200] GGGCGGGCTCTCTGAGCTGGACAAGGCGGGCTTCATCAAGAGGCAGCTGGTCGAGACACGGCAGATCA

[0201] CTAAGCACGTTGCGCAGATTCTCGACTCACGGATGAACACTAAGTACGATGAGAATGACAAGCTGATCC

[0202] GCGAGGTGAAGGTCATCACCCTGAAGTCAAAGCTCGTCTCCGACTTCAGGAAGGATTTCCAGTTCTACA

[0203] AGGTTCGGGAGATCAACAATTACCACCATGCCCATGACGCGTACCTGAACGCGGTGGTCGGCACAGCTC

[0204] TGATCAAGAAGTACCCAAAGCTCGAGAGCGAGTTCGTGTACGGGGACTACAAGGTTTACGATGTGAGGA

[0205] AGATGATCGCCAAGTCGGAGCAGGAGATTGGCAAGGCTACCGCCAAGTACTTCTTCTACTCTAACATTAT

[0206] GAATTTCTTCAAGACAGAGATCACTCTGGCCAATGGCGAGATCCGGAAGCGCCCCCTCATCGAGACGAA

[0207] CGGCGAGACGGGGGAGATCGTGTGGGACAAGGGCAGGGATTTCGCGACCGTCAGGAAGGTTCTCTCCA

[0208] TGCCACAAGTGAATATCGTCAAGAAGACAGAGGTCCAGACTGGCGGGTTCTCTAAGGAGTCAATTCTGC

[0209] CTAAGCGGAACAGCGACAAGCTCATCGCCCGCAAGAAGGACTGGGATCCGAAGAAGTACGGCGGTTC

[0210] GACAGCCCCACTGTGGCCTACTCGGTCCTGGTTGTGGCGAAGGTTGAGAAGGGCAAGTCCAAGAAGCT

[0211] CAAGAGCGTGAAGGAGCTGCTGGGGATCACGATTATGGAGCGCTCCAGCTTCGAGAAGAACCGATCGA

[0212] TTTCCTGGAGGCGAAGGGCTACAAGGAGGTGAAGAGGACCTGATCATTAAGCTCCCCAAGTACTCACT

[0213] CTTCGAGCTGGAGAACGGCAGGAAGCGGATGCTGGCTTCCGCTGGCGAGCTGCAGAAGGGGAACGAGC

[0214] TGGCTCTGCCGTCCAAGTATGTGAACTTCCTCTACCTGGCCTCCCACTACGAGAAGCTCAAGGGCAGCCC

[0215] CGAGGACAACGAGCAGAAGCAGCTGTTCGTCGAGCAGCACAAGCATTACCTCGACGAGATCATTGAGC

[0216] AGATTTCCGAGTTCTCCAAGCCGGTGATCCTGGCCGACGCGAATCTGGATAAGGTCCTCTCCGCGTACAA

[0217] CAAGCACCGCGACAAGCCAATCAGGGAGCAGGCTGAGAATATCATTCATCTCTTCCACCTGACGAACCT

[0218] CGGCGCCCCTGCTGCTTTCAAGTACTTCGACACAACTATCGATCGCAAGAGGTACACAAGCACTAAGGA

[0219] GGTCCTGGACGCGACCCTCATCCACCAGTCGATTACCGGCCTCTACGAGACGCGCATCGACCTGTCTCAG

[0220] CTCGGGGGCGACAAGCGGCCAGCGGCGACGAAGAAGGCGGGGCAGGCGAAGAAGAAGAAGTGA

[0221] Example 4: Regeneration of recombinant viruses

[0222] The above editing vector pBY-Cas9-TaPDS-TLS was transformed into Agrobacterium GV3103, specifically, 1 μg of plasmid was added to the competent state of Agrobacterium GV3103, ice bathed for 30 minutes, liquid nitrogen quick-frozen for 1 minute, heat-shocked at 37°C for 5 minutes, and an appropriate amount of liquid LB medium was added. After culturing at 28°C and 220rpm for 4-6 hours, it was coated on the solid medium with the corresponding antibiotic. Agrobacterium was pre-treated before injection, and the Agrobacterium carrying the above recombinant plasmid and the pGD-VSRs and pGD-NLP plasmids were inoculated with 15mL LB liquid medium (containing 25μg / mL rifampicin, 50μg / mL kanamycin, and 25μg / mL gentamicin), and cultured at 28°C and 220rpm until OD 600 The cell suspension was about 1.2, and then centrifuged at 3000g for 10 min to collect the bacteria, discard the supernatant, and use 4 mL of Agrobacterium suspension buffer (10 mM MgCl 2 , 10mM MES, 200μM Acetosyringone), and Agrobacterium carrying pBY-Cas9-TaPDS-TLS, pGD-VSRs and pGD-NLP plasmids were mixed at a final concentration of OD600 of 1.0:0.5:0.8. After standing for 2-3 hours, the leaves of N. benthamiana were injected with a disposable syringe and sampled after 15 days of greenhouse culture. According to the fluorescence signal, 0.3-0.4g of the injection area of ​​the N. benthamiana leaf was taken, placed in a pre-cooled mortar, and 1mL of microinjection buffer (100mM Tris-HCl, 10mM Mg(CH3COO) 2 ,1mM MnCl 2 ,40mM Na 2 SO 3, pH 8.0) was fully ground. The virus juice was transferred to an EP tube, centrifuged at 4°C, 12000g for 10 minutes, and the supernatant was taken. The crude virus extract was injected into the second-instar nymphs of gray planthoppers using a microinjector. The specific details were as follows: the second-instar nymphs of planthoppers were transferred from rice to a 50mL centrifuge tube, anesthetized with carbon dioxide for 10 seconds, and about 20 nymphs were picked with a brush and placed in LB solid culture medium (without antibiotics). The planthoppers were placed with the ventral surface facing up, and the crude virus extract was injected into the thorax between the first and second pairs of legs of the planthopper nymphs with the help of a stereoscope and a microinjection instrument. The microinjection parameters were set, the injection dose was 12nL, and the injection speed was 20nL / s. About 12nL was injected into each nymph, and about 400 nymphs were injected and incubated in rice. After 10 days, about 100 infected planthoppers were selected according to RFP fluorescence for virus transmission. The specific operation is to transfer the injected planthoppers from the rice to a 50mL centrifuge tube, pass carbon dioxide for 10s anesthesia, pick about 20 nymphs with a brush and place them on a black cardboard, use a handheld fluorescent lamp to select the planthoppers with RFP fluorescent signals, transfer them to the EP tube with a brush and count them, and transfer every 24 poisoned planthoppers into one EP tube. The planthoppers with RFP fluorescent signals were inoculated with wheat (winter wheat Kexing 3302) that had been vernalized at 4℃ for more than 10 days. The specific operation was to plant three wheat plants in each pot, inoculate 8 planthoppers per seedling on average, pour 24 planthoppers into the wheat seeds, cover the flowerpot with a cylindrical plastic cover, and wrap the top with gauze to prevent the planthoppers from spreading and ensure air permeability. A total of 12 plants were inoculated, and the virus was transmitted for 7 days in a 25℃ light incubator with a cycle of 16h light and 8h dark. Seven days later, the poisonous insects were transferred to a new batch of vernalized wheat for virus transmission. The virus infection of the infected wheat was observed using a handheld fluorescent lamp. Figure 4 shown.

[0223] Example 5: Induction of lateral buds of albino mutants

[0224] like Figure 5 As shown, after infection, the diseased wheat plants were screened according to the RFP fluorescence signal, and the non-diseased wheat was cut off and cultured for two months in a 25°C light incubator with a cycle of 16h light and 8h dark. Two months later, the diseased wheat began to tiller, and some lateral buds had grown to the two-leaf stage. These lateral buds were observed and counted to find out the lateral buds that could tiller out the albino mutant. When the albino lateral buds grew to the two-leaf stage, the main stem and all wild-type lateral buds were cut off, and the lateral buds that tillered out subsequently were continuously screened, and the completely albino or white-green lateral buds were retained, and the surrounding wild-type lateral buds were removed. Figure 6 shown.

[0225] Example 6: Obtaining homozygous mutants in progeny

[0226] The mutant lateral shoots were further cultured, e.g. Figure 7As shown, it was transferred to the greenhouse for cultivation. The soil used for planting wheat is a mixture of substrate soil and flower soil in a ratio of 1:1. During the jointing stage of the plant, an appropriate amount of Huawuque culture solution is applied every week for three weeks. After the mutant lateral buds are cultured to the heading stage, an appropriate amount of Huawuque culture solution is applied every week for three weeks. When the plant enters the filling stage, a total of 14 ears are counted. The ear bracts are opened, the inflorescence peduncle is observed, and the ear with albino inflorescence peduncle is selected. There are a total of 6 ears with albino inflorescence peduncle. 4-6 seeds are randomly selected from each ear for sowing. The seeds are placed in vermiculite for germination. After 7 days, the seedlings are sampled to detect the target mutation and screen for pure mutants. The genomic DNA was extracted using the CTAB method. Specifically, a small amount of leaf tissue of about 0.1 g was removed from the seedlings, sampled with liquid nitrogen, 600 μL of CTAB DNA extraction buffer was added, and the tube was fully shaken and mixed. The centrifuge tube was placed in a 65°C heater for 30 min and then centrifuged at 12000 g for 10 min. The supernatant was added with an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1), shaken and mixed, and then centrifuged at 12000 g for 10 min. About 400 μL of the upper phase liquid was taken, and an equal volume of isopropanol was added. After precipitation at -20°C for 30 min, the supernatant was discarded, and the precipitate was washed twice with 75% ethanol, dried, and 50 μL of ddH 2 O, after the genomic DNA is fully dissolved, it can be used as a PCR template. Design specific primers to amplify a fragment of about 250bp near the target. Take a small amount of PCR product for agarose gel electrophoresis detection, and then send the amplicon to the Hi-TOM platform for high-throughput sequencing analysis. Figure 8 As shown, the results of the second-generation sequencing analysis showed that the offspring of seeds from the same ear had the same target mutation type and basically the same genotype; the offspring of seeds from different ears had different target mutation types and were mutants with different genotypes.

[0227] Example 7: Editing of TaeIF4E and TaSDN1 genes

[0228] Referring to the same steps as in Example 2-6, the BYSMV editing vector was used to edit the TaeIF4E and TaSDN1 genes. The sgRNAs for editing the genes are as follows:

[0229] TaeIF4

[0230] GTTGTCGAACCAGAAGGTCCG TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCATTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGCTCTGATA(SEQ ID NO:5)

[0231] TaSDN1

[0232] CGTCCTTGGTCCGCTTCTTGG TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCATTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGCCTGATA(SEQ ID NO:6)

[0233] The underlined regions are those editable by sgRNA.

[0234] Two disease resistance-related targets were selected for editing, TaeIF4E and TaSDN1. It has been reported in the literature that knocking out TaeIF4E in wheat can enhance the resistance of mutant plants to WYMV (Wheat yellow mosaic virus) (Kan et al., 2023, CRISPR / Cas9-guided knockout of eIF4E improves Wheat yellow mosaic virus resistance without yield penalty); and for SDN1, knocking out SDN1 in the wheat D chromosome set can enhance the resistance of mutant plants to BYDV (barley yellow dwarf viruses) (Jin et al., 2022, Barley GRIK1-SnRK1 kinases subvert a viral virulence protein to upregulate antiviral RNAi and inhibit infection). Targets were designed for these two genes, and viral editing vectors were constructed, such as Fig. 9 According to the TaPDS editing process, the recombinant virus was inoculated into the wheat Sinovac 3302. PCR detection was performed 15 days after inoculation, proving that efficient somatic cell editing could be induced. Fig.10 shown.

[0235] Next, we screened the mutant lateral buds. One month after infection, the diseased plants began to tiller. Some lateral buds were free of virus, and genomic DNA was extracted from these lateral buds for sequencing. It was found that some of the free lateral buds were edited. Compared with the editing caused by somatic cells, the mutation types were reduced and more fixed, proving that they were stable mutations. Fig.11 This lateral bud is retained for cultivation and is ready to harvest seeds for testing progeny editing.

[0236] Screen the mutant lateral buds, and screen the homozygous mutant lateral buds, the genotype is Fig.12 As shown, PCR detection showed that the mutant was 100% edited and the mutant lateral buds could grow normally. The lateral buds were retained for culture to obtain mutant progeny.

[0237] The embodiments described above are only some embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work shall all fall within the scope of protection of the present invention.

Claims

1. A plant cytoplasmic rhabdovirus expression vector, characterized in that: The expression vector contains the sequence of the reverse complementary chain of the whole genome of barley yellow streak mosaic virus (BYSMV), and a sequence-specific nucleic acid modification enzyme gene is inserted between the N and P genes of the viral genome on the vector; P6, sgRNA sequence inserted between M genes.

2. The expression vector according to claim 1, characterized in that The sequence-specific nucleic acid modification enzyme can be a CRISPR / Cas ribozyme, an adenine base editor formed by the fusion of Cas9 ribozyme and adenine deaminase, or a cytosine base editor formed by the fusion of Cas9 ribozyme and cytosine deaminase.

3. The expression vector according to claim 1 or 2, characterized in that The sequence-specific nucleic acid modification enzyme and / or sgRNA sequence has a TLS sequence modification near it. Preferably, the TLS sequence modification is connected to the 5' end, 3' end or middle position of the sequence-specific nucleic acid modification enzyme and / or sgRNA sequence; more preferably, the connection sequence can have 1, 2, 3, 4, 5 or more base intervals with the sequence-specific nucleic acid modification enzyme and / or sgRNA sequence without affecting the reading frame.

4. The expression vector according to any one of claims 1 to 3, characterized in that The sgRNA sequence is an sgRNA with a length of 18 to 35 nt. Preferably, the sgRNA can be 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 28, 30, 31, 32, 33, 34 or 35 nt in length; preferably, the sgRNA sequence is ACGACCTGTAATGGTTTACT.

5. The expression vector according to any one of claims 1 to 4, characterized in that The RFP fluorescent reporter gene can also be inserted between the M and G genes on the vector.

6. A negative-sense RNA virus plant genome editing system, characterized in that: The invention comprises the expression vector according to any one of claims 1 to 5.

7. The plant genome editing system according to claim 6, wherein: It also comprises an auxiliary vector, which can express N, P and L of BYSMV respectively, and / or simultaneously express N, P and L of BYSMV; and / or simultaneously express gene silencing suppressors p19, HCpro and γb.

8. The plant genome editing system according to claim 6 or 7, characterized in that The insect-infected monocotyledonous plant is more preferably barley, wheat, millet, corn, preferably barley or wheat.

9. Use of the expression vector according to any one of claims 1 to 5 or the plant genome editing system according to any one of claims 6 to 8 in plant gene editing.

10. The use according to claim 9, characterized in that The plant is a monocotyledonous plant, more preferably barley or wheat.

Images