A negative-sense RNA virus plant genome editing system and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a negative-sense RNA virus plant genome editing system and application thereof. The genome editing system uses a CRISPR-Cas9 gene editing technology, takes a plant cytoplasmic rhabdovirus as a delivery carrier, is transmitted to a plant by means of a vector, utilizes an RNA movement motif, delivers gene editing components to an axillary meristem, and obtains mutant lateral buds along with plant tillering. The application can complete plant gene editing without tissue culture, overcomes plant tissue culture dependence, expands the range of gene editing lines, and only needs one generation to obtain a pure mutant without going through hybridization and selfing processes.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and specifically relates to a negative-sense RNA virus plant genome editing system and its application, and further relates to the use of CRISPR-Cas9 gene editing technology with plant cytoplasmic rhabdovirus as a delivery vector for plant gene editing. Background Technology

[0002] CRISPR-Cas9, as a third-generation gene editing technology, has been widely used in various crop improvement processes. Compared with the previous two generations, it has higher editing efficiency, lower off-target rate, and is easier to operate. The most commonly used CRISPR / Cas9 system is isolated from *Streptococcus pyogenes* and contains the endonuclease SpCas9 and sgRNA. In cells, the Cas9 ribozyme forms a complex with gRNA. Guided by gRNA, Cas9 cuts specific target DNA, causing double-strand breaks (DSBs). When the broken double-stranded DNA is repaired through non-homologous end joining (NHEJ), small base insertions or deletions (indels) are introduced at the DNA break. Indels may cause frameshift mutations in the open reading frame of the target gene or premature introduction of stop codons, resulting in gene knockout and ultimately achieving the goal of gene editing. With the maturation of Cas9-derived technologies, gene editing technology is developing towards greater precision.

[0003] Traditional methods for delivering editing elements in plants primarily rely on Agrobacterium tumefaciens to integrate exogenous DNA containing the editing elements into the plant genome, or on using a gene gun to bombard plant cells with exogenous fragments. Edited plants are then obtained through tissue culture of the explants. Currently, two key technological bottlenecks limit their application: dependence on tissue culture technology, which is cumbersome, time-consuming, and prone to contamination; many species have not yet been able to regenerate through tissue culture, and the regeneration effect varies significantly between different genotypes, indicating genotype dependence. The other bottleneck is reliance on transgenic technology. Integrating exogenous DNA fragments into the plant genome carries unknown biosafety risks, limiting its application in many ways. Offspring can only be obtained as non-transgenic mutants through hybridization and self-pollination, which is particularly difficult for hexaploid wheat. Despite the emergence of many new delivery methods, these technological bottlenecks have not yet been completely overcome.

[0004] Plant viruses are characterized by small genomes, high replication rates, and simple genetic manipulation. Their genomes do not integrate into the host plant genome, making them a valuable biological resource. Over the past 30 years, many plant viruses have been modified into expression vectors for heterologous proteins and silencing vectors, playing a crucial role in production applications and gene function research. In recent years, researchers have adapted viral vectors into new tools for delivering editing elements, achieving heritable editing in both monocots and dicots, which has played a significant role in gene function research and breeding. Their strategies are basically divided into two types: one, represented by positive-sense RNA virus vectors, has a limited payload and delivers only the sgRNA component, achieving heritable editing through Cas9 overexpression plants; the other, represented by negative-sense RNA viruses, has a larger payload and can deliver the entire system, achieving heritable editing through tissue culture regeneration of edited leaf cells. However, neither strategy has completely overcome the aforementioned technical bottlenecks.

[0005] In addition, CN110511955A is the result of the inventor's laboratory research. Based on this, the negative sense RNA virus plant genome editing system has been improved again. That is, the gene editing vector and method are introduced into this application as background technology.

[0006] Based on the aforementioned existing technologies, there is an urgent need to research and develop a novel tool for delivering editing elements that can achieve genetic editing in wheat without relying on tissue culture or transgenic plants. Summary of the Invention

[0007] To address the problems existing in the prior art, the purpose of this invention is to provide a negative-sense RNA virus plant genome editing system and its applications. This includes a viral expression vector containing the reverse complementary strand of the whole genome of barley yellow-striped mosaic virus (BYSMV).

[0008] The barley yellow-striped mosaic virus (BYSMV) involved in this invention belongs to the cytoplasmic rhabdovirus family. Its genome is a single-stranded negative-sense RNA, 12706 nt in length, with NCBI accession number KM213865. The BYSMV genome can transcribe nine mRNAs, one of which encodes two proteins, thus BYSMV encodes a total of 10 proteins, including five structural proteins and five accessory proteins. The five structural proteins include a nucleoprotein (N), a phosphoprotein (P), a matrix protein (M), a glycoprotein (G), and a large polymerase protein (L) (Yan et al., 2015). Between the P and M proteins, four accessory proteins are encoded: P3, P4 / P5, and P6, with overlapping coding frames for P4 and P5. Between the G and L proteins, the P9 accessory protein is encoded.

[0009] The barley yellow-striped mosaic virus contained in the vector of the present invention is a negative-sense RNA virus, and the reverse complementary strand of its whole genome is the full-length positive-sense cDNA.

[0010] The present invention provides a method for constructing the aforementioned expression vector, wherein the method comprises: reverse transcription and PCR amplification of the genomic RNA of barley yellow-striped mosaic virus to obtain positive-strand cDNA, and constructing the positive-strand cDNA into a vector.

[0011] Vectors include, but are not limited to, pXT1 or pCass4-Rz. Plant expression vectors containing the cauliflower mosaic virus 35S promoter, hepatitis C virus nuclease (HDVRz) sequence (NCBI accession number L35896.1 or L35897.1), and transcription terminator sequence (e.g., carmine synthase terminator, NCBI accession number AJ007624.1) can all be used as the vectors for constructing plant cytoplasmic rhabdovirus expression vectors. Preferably, the plant expression vector pCB301 can be selected as the basic construction vector, or other plant expression vectors can be selected as the basic vectors for constructing the vector of the present invention.

[0012] In the construction method, the positive-strand cDNA can be constructed into the vector by enzyme digestion ligation or homologous recombination.

[0013] Another invention provides a method for constructing an editing carrier. The construction method includes the following steps:

[0014] The full-length BYSMV gene was cloned into a vector to construct the full-length infectious cloning vector pBYSMV. A GFP gene expression cassette was inserted between the N and P genes, and YFP and RFP expression cassettes were inserted between the M, P6 and M, G genes to obtain the vector pBY-GRY.

[0015] Using a full-length BYSMV cDNA clone as a template, the fragment between BYSMV P3 and P9 was amplified using primers and cloned into a T vector. Using this as a template, a linearized vector was obtained through reverse amplification. A YFP fragment containing the P6 3'UTR and M 5'UTR sequences of BYSMV was synthesized and homologously recombinated with the above vector to obtain the recombinant vector pT-3-9-YFP. An RFP fragment containing the M 3'UTR and G 5'UTR sequences of BYSMV at its 5' end was then synthesized and homologously recombinated with the above vector to obtain the recombinant vector pT-3-9-YR.

[0016] The third step involves amplifying the 3-9-YR fragment and performing homologous recombination with the pBY-GFP linearized vector to obtain the recombinant vector, pBY-GYR.

[0017] The constructed vector contains a foreign gene insertion site for inserting a sequence-specific nuclease, guide RNA (sgRNA). Optionally, it also includes an inserted fluorescent reporter gene.

[0018] When constructing the vector, a sequence-specific nuclease gene is inserted between the N and P genes of the viral genome. The sequence-specific nuclease can be a CRISPR / Cas ribozyme, an adenine base editor formed by fusing Cas9 ribozyme with adenine deaminase, or a cytosine base editor formed by fusing Cas9 ribozyme with cytosine deaminase, or a Cas9 ribozyme modified with a mobile RNA motif. An sgRNA is inserted between the P6 and M genes, where the spacer in the sgRNA can be replaced with a target of any length of 20 nt. An RFP fluorescent reporter gene is inserted between the M and G genes.

[0019] On the other hand, the present invention provides an editing vector, which is constructed by the above-described method. Preferably, a sequence-specific nuclease gene is inserted between the N and P genes of the viral genome. The sequence-specific nuclease can be a CRISPR / Cas ribozyme, an adenine base editor formed by fusing a Cas9 ribozyme with adenine deaminase, or a cytosine base editor formed by fusing a Cas9 ribozyme with a cytosine deaminase, or a Cas9 ribozyme modified with a mobile RNA motif. An sgRNA is inserted between the P6 and M genes, wherein the spacer in the sgRNA can be replaced with a target of any length of 20 nt. Preferably, a fluorescent reporter gene is inserted between the M and G genes. More preferably, the fluorescent reporter gene can be one of RFP, GFP, or conventional fluorescent reporter groups. Preferably, the editing vector can be a pBY-GRY vector with the sequence described in SEQ ID NO:3; or the reporter gene on pBY-GRY can be replaced with the above-described specific nuclease gene, sgRNA sequence, and other reporter genes.

[0020] On the other hand, the present invention provides an editing vector whose frame sequence is SEQ ID NO:3, 1-2338, 3060-5544, 6275-7016, 7696-19818bp. A preferred editing vector has a sequence similarity of 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more to the above sequence; preferably, the editing vector has a BYSMV whole genome or isofunctional mutant; preferably, the editing vector can edit 10 proteins of BYSMV, encoding one or a combination of the following proteins: including 5 structural proteins and 5 accessory proteins; the 5 structural proteins include nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and large polymerase protein. Between the P and M proteins, four accessory proteins are encoded: P3, P4 / P5, and P6, with overlapping coding frames for P4 and P5. Between the G and L proteins, the P9 accessory protein is encoded. The 10 BYSMV proteins can be encoded in the above order, or the order of the protein elements can be changed. The nucleotides encoding the 10 BYSMV proteins can have mutations, substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 bases. The mutated nucleotides encoding the 10 BYSMV proteins still retain the function of encoding the corresponding viral proteins.

[0021] On the other hand, the present invention also provides the construction of auxiliary carriers, including

[0022] a) Vectors that express the N, P, and L of BYSMV respectively; or vectors that simultaneously express the N, P, and L of BYSMV.

[0023] b) Vectors that simultaneously express the gene silencing repressors p19, HCpro, and γb.

[0024] Vectors that simultaneously express BYSMV N, P, and L have significantly higher infectivity than vectors that express viral N, P, and L separately. When the vector described in b) participates in co-infection, it can increase the expression level of the viral vector and greatly increase the success rate of infectious cloning.

[0025] Preferably, the auxiliary vector can be pGD-NLP and pGD-VSRs, the construction methods of which are described in the prior art (Qiang Gao et al., The plant rhabdovirus viroporin P9 facilitates insect-mediated virus transmission in barley. The PLANT CELL, 2024, 36, 3483–3497).

[0026] On the other hand, in order to overcome the technical bottleneck of gene editing breeding, this invention modifies the editing elements on the vector with TLS (tRNA-like structure), enabling them to move between cells in the form of RNA.

[0027] The TLS sequence is as described in SEQ ID NO:2.

[0028] 5'-TTATCAGAGTGGGTGGTGGGCCCATAACCCACAGGTCCGCTCT GATA-3'.

[0029] TLS modification involves attaching a TLS sequence to the 5', 3', or middle position of the edit element on the carrier. The attachment sequence can have a spacing of 1, 2, 3, 4, or 5 or more bases from the edit element without affecting the read frame of the edit element.

[0030] The editing element is a genome editing tool that includes the use of at least one site-specific nuclease, such as RNA-guided nucleases (e.g., Cas nucleases), zinc finger nucleases, megabase-wide nucleases, TALE-nucleases, recombinases, transposases, and any combination thereof;

[0031] Preferably, the genome editing is selected from CRISPR / Cas, TALEN, ZFN, transposon technology, PASTE technology, PE technology, base editor, and any combination thereof, preferably elements encoding Cas9 and / or gRNA. Preferably, the Cas9 sequence is as described in SEQ ID NO:4.

[0032] On the other hand, the present invention provides an editing element, preferably a gRNA for use with Cas9, and preferably, the gRNA sequence is as follows:

[0033] 5'-NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCA AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCAC CGAGTCGGTGC-3'. "N……N" represents the gRNA sequence targeting the target, and the remaining sequences are sgRNA-scaffold structures specifically suitable for the transfer of editing elements in the vector of this invention and capable of being recognized by the Cas9 enzyme. Preferably, the gRNA is ACGACCTGTAATGGTTTACT.

[0034] On the other hand, the present invention obtains a CRISPR / Cas9 editing system through the aforementioned vector and TLS modification of the vector, which can complete genome editing in the axillary meristem of plants.

[0035] Preferably, the above-mentioned editing system completes virus rescue / virus revival / virus regeneration / virus regeneration within the plant via the aforementioned vector, thereby obtaining the virus for transmission to the target plant via a vector. Preferably, the recipient plant can be a gramineous crop, more preferably a monocotyledonous plant, and even more preferably barley, wheat, millet, or corn, with barley or wheat being the most preferred.

[0036] The virus rescue / regeneration / resurrection / reproduction process can be completed within a plant, preferably a dicotyledonous plant, and more preferably tobacco. Preferably, the vector can be an insect vector, with planthoppers being the most preferred, and gray planthoppers, white-backed planthoppers, or brown planthoppers being even more preferred.

[0037] The plant cytoplasmic rhabdovirus expression vector provided by this invention is a vector containing the reverse complementary strand of the entire BYSMV genome.

[0038] Since the barley yellow-striped mosaic virus is a negative-sense RNA virus, the reverse complementary strand of its entire genome is the full-length positive-sense cDNA.

[0039] On the other hand, the present invention provides a plant gene editing method. Preferably, it includes any one or more of the following steps, the steps of which include:

[0040] First, the recombinant virus was rescued from plants. Virus replication-related proteins N, P, and L, the full-length recombinant virus, and a silencing repressor were expressed in plants using Agrobacterium-mediated transient expression. Preferably, Agrobacterium carrying the BYSMV editing vector, pGD-VSRs, and pGD-NLP plasmid were co-injected into plant leaves. After greenhouse cultivation, RFP fluorescence signals were detected; RFP fluorescence indicated successful rescue of the recombinant virus into the plant. The preferred plant was tobacco.

[0041] The carrier and auxiliary carrier are injected in a ratio of 1.0:(0.2-0.7):(0.4-0.95). Preferably, the injection ratio is 1.0:(0.3-0.6):(0.5-0.9), and more preferably, the injection ratio is 1.0:(0.4-0.55):(0.7-0.85).

[0042] Next, take a portion of the plant leaf to be injected, place it in a pre-cooled mortar, add microinjection buffer, and grind thoroughly. The mass of the injected plant leaf portion is 0.1-2 g, preferably 0.2-0.8 g, more preferably 0.3-0.5 g. The buffer is preferably Tris-HCl buffer or PBS, preferably with the following formulation: 100 mM Tris-HCl, 10 mM Mg(CH3COO)2, 1 mM MnCl2, 40 mM Na2SO3, pH 8.0.

[0043] The viral extract was transferred to EP tubes, centrifuged, and the supernatant was collected. The crude viral extract was injected into second-instar nymphs of the planthopper, and the nymphs were then incubated in rice. The preferred centrifugation conditions were 12000g for 10 min. Virus-carrying planthoppers were selected for virus transmission based on the reporter gene.

[0044] Finally, wheat was inoculated with planthoppers carrying the reporter gene. After the wheat seeds germinated at 20-28℃, the seedlings were vernalized at 2-8℃ for 2-21 days before the inoculation experiment. After 2-21 days, the reporter gene signal was detected, and the virus-infected leaves were selected for target editing detection.

[0045] On the other hand, the present invention provides a negative-sense RNA virus plant genome editing system, which includes the above-described vector, or a vector constructed by the above-described vector construction method, wherein the sgRNA can be designed to replace any target to be edited. Preferably, the above-described editing system is for barley or wheat.

[0046] Preferably, this invention provides a virus-mediated, tissue culture-free DNA-free wheat gene editing method. Recombinant rhabdovirus is introduced into wheat cells according to the above method. Using RNA mobile motifs, sequence-specific nucleic acid-modifying enzyme components are delivered to the axillary meristem, inducing the formation of mutant lateral buds during wheat tillering. Finally, the mutant lateral buds are cultured to maturity, and the progeny are harvested for M1 generation testing.

[0047] The specific steps include: first, inoculating wheat seedlings that have been vernalized for more than 10 days with the recombinant virus, and culturing them at 25℃ with a 16-hour light-8-hour dark cycle for two months, after which the main stem is cut off. Second, sampling and testing all lateral buds to assess target editing, retaining those that have undergone editing. Fifteen days later, all lateral buds are tested again, retaining those with a high degree of editing (editing efficiency greater than 75%).

[0048] The technical effects of this invention include:

[0049] 1. This invention develops a BYSMV carrier with high plasticity and large loading capacity;

[0050] 2. The gene editing method of the present invention facilitates the delivery of editing elements to the meristematic region via RNA mobile motifs;

[0051] 3. The method of this invention obtains mutants by means of plant tillers, which breaks through the limitations of tissue culture in conventional plant editing and provides a new approach for editing tissue culture-restricted varieties of plants such as barley and wheat; the mutant parent is induced by plant tillers and does not require regeneration culture.

[0052] 4. This invention utilizes the BYSMV editing vector to perform heritable editing of wheat genes, with the virus delivering the editing element instantaneously without needing to integrate into the plant genome.

[0053] 5. The homozygous mutation efficiency of the offspring of this invention is 100%, and homozygous mutants can be obtained in just one generation without the need for hybridization and self-crossing. Attached Figure Description

[0054] Figure 1 Schematic diagrams of the BY-GYR and BY-GRC vector structures and the auxiliary vectors pGD-NLP and pGD-VSRs.

[0055] Figure 2 Assessment of the infectivity and exogenous protein expression capacity of BY-GYR and BY-GRC.

[0056] Figure 3 Schematic diagram of BYSMV trifluorescent vector and BYSMV editing vector.

[0057] Figure 4 Flowchart of recombinant BYSMV inoculation into wheat.

[0058] Figure 5 BYSMV delivers the detection of editing elements.

[0059] Figure 6 Induction of lateral buds in albino mutants.

[0060] Figure 7 Phenotypic status of offspring mutants.

[0061] Figure 8 Genotyping of offspring mutants.

[0062] Figure 9 A schematic diagram of constructing and editing TaeIF4E and TaSDN1 editing carriers.

[0063] Figure 10The TaeIF4E and TaSDN1 genes in wheat were edited, and the results of wheat somatic cell gene editing were verified by PCR.

[0064] Figure 11 Lateral buds of TaeIF4E and TaSDN1 gene-edited mutants were screened for PCR validation.

[0065] Figure 12 The mutant lateral buds were cultured and PCR was used to obtain allele mutant progeny. Detailed Implementation

[0066] The following detailed embodiments further illustrate the concept and technical effects of the present invention to fully understand its purpose, features, and effects. Unless otherwise specified, all methods described are conventional methods. Unless otherwise specified, all materials are available from publicly available commercial sources. The illustrative embodiments and descriptions of the present invention are used to explain the invention and do not constitute an undue limitation thereof. It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0067] In this embodiment, the homologous recombination step was performed using the Novizan Vazyme Homologous Recombination Rapid Cloning Kit C115-02-AA. For routine molecular experimental methods described in this embodiment, please refer to the specific experimental steps and methods in J. Sambrook et al., *Molecular Cloning: A Laboratory Manual*, 2nd Edition, Science Press, 1995.

[0068] Example 1: Carrier skeleton construction

[0069] The construction of the vector pBY-GRY was divided into two parts. In the first part, the full-length infectious cloning vector pBYSMV was used as the backbone, and the GFP gene expression cassette was inserted between the NP genes to obtain the vector pBY-GFP. In the second part, the YFP and RFP expression cassettes were inserted into the M, P6 genes and the M, G genes respectively, using the vector pBY-GFP as the backbone to obtain the vector pBY-GRY.

[0070] For the first part, using the full-length BYSMV cDNA clone as a template, the BY-NP fragment was amplified using primers 35S-F / P-1-R and cloned into a T vector to obtain the pT-BY-NP vector. Using this as a template, the vector was reverse-amplified using primers NR / N3UTR-F to obtain a linearized vector. A GFP fragment was synthesized, with the N 3'UTR and P 5'UTR sequences of BYSMV at its 5' end, and homologous recombination was performed with the above vector. The recombination system was 10 μL, and the components are shown in the table below:

[0071] Element volume pT-BY-NP linearized vector 50ng GFP synthesis fragment 50ng 2*seamless assembly mix 5μL ddH2O Add to 10 μL

[0072] After reacting at 50℃ for 10 min, all recombinant products were transformed into E. coli DH5α competent cells, incubated on ice for 10 min, heat-shocked at 42℃ for 90 s, and then an appropriate amount of liquid LB was added. The cells were cultured at 37℃ with shaking at 220 rpm for 30 min, and then plated onto solid LB medium containing 50 μg / mL kanamycin. After overnight culture, positive clones were screened, and plasmids were extracted from the positive clones to obtain the recombinant vector, pT-BY-NP-GFP.

[0073] The full-length BYSMV cDNA cloning vector pBYSMV was digested using ClaⅠ and NotⅠ to obtain a linearized vector. Simultaneously, using pT-BY-NP-GFP as a template, the NP-GFP fragment was amplified using primers 35S-F / P-1-R and then recovered via gel electrophoresis. The recovered fragment was then subjected to homologous recombination with the pBYSMV linearized vector in a 10 μL volume. The components are shown in the table below.

[0074] Element volume pBYSMV linearized carrier 50ng NP-GFP fragment 50ng 2*seamless assembly mix 5μL ddH2O Add to 10 μL

[0075] After reacting at 50℃ for 10 min, all recombinant products were transformed into E. coli DH5α competent cells, incubated on ice for 10 min, heat-shocked at 42℃ for 90 s, and then an appropriate amount of liquid LB was added. The cells were cultured at 37℃ with shaking at 220 rpm for 30 min, and then plated onto solid LB medium containing 50 μg / mL kanamycin. After overnight culture, positive clones were screened, and plasmids were extracted from the positive clones to obtain the recombinant vector, pBY-GFP.

[0076] For the second part, firstly, using the full-length BYSMV cDNA clone as a template, the BY-3-9 fragment was amplified using primers P3-F / P9-R and cloned into the T vector to obtain the pT-BY-3-9 vector. Using this as a template, the vector was reverse-amplified using primers P6-R / P6-3UTR-F to obtain a linearized vector. The YFP fragment, with the P6 3'UTR and M 5'UTR sequences of BYSMV at its 5' end, was synthesized and homologously recombinated with the above vector. The recombination system was 10 μL, and the components are shown in the table below:

[0077] Element volume pT-BY-3-9 linearized carrier 50ng YFP Synthesis Fragment 50ng 2*seamless assembly mix 5μL ddH2O Add to 10 μL

[0078] After reacting at 50℃ for 10 min, all recombinant products were transformed into E. coli DH5α competent cells, incubated on ice for 10 min, heat-shocked at 42℃ for 90 s, and then an appropriate amount of liquid LB was added. The cells were cultured at 37℃ and shaken at 220 rpm for 30 min, and then plated onto solid LB medium containing 50 μg / mL kanamycin. After overnight culture, positive clones were screened, and plasmids were extracted from the positive clones to obtain the recombinant vector, pT-3-9-YFP.

[0079] Using pT-3-9-YFP as a template, the vector was reverse-amplified using primers MR / M-3UTR-F to obtain a linearized vector. An RFP fragment was synthesized, with the 5' end containing the M 3'UTR and G 5' of BYSMV.

[0080] The UTR sequence was homologously recombinated with the above vector in a 10 μL recombination system, and the components are shown in the table below:

[0081] Element volume pT-3-9-YFP linearized vector 50ng RFP synthetic fragments 50ng 2*seamless assembly mix 5μL ddH2O Add to 10 μL

[0082] After reacting at 50℃ for 10 min, all recombinant products were transformed into E. coli DH5α competent cells, incubated on ice for 10 min, heat-shocked at 42℃ for 90 s, and an appropriate amount of liquid LB was added. The cells were then cultured at 37℃ with shaking at 220 rpm for 30 min, and then plated onto solid LB medium containing 50 μg / mL kanamycin. After overnight culture, positive clones were screened, and plasmids were extracted from the positive clones to obtain the recombinant vector, pT-3-9-YR.

[0083] The third step involved digesting the pBY-GFP vector with SalⅠ and SwaⅠ to obtain a linearized vector. Simultaneously, using pT-3-9-YR as a template, the 3-9-YR fragment was amplified using primers P3-F / P9-R and then recovered via gel electrophoresis. The recovered fragment underwent homologous recombination with the pBY-GFP linearized vector in a 10 μL volume. The components are shown in the table below.

[0084]

[0085]

[0086] After reacting at 50℃ for 10 min, all recombinant products were transformed into E. coli DH5α competent cells, incubated on ice for 10 min, heat-shocked at 42℃ for 90 s, and an appropriate amount of liquid LB was added. The cells were then cultured at 37℃ with shaking at 220 rpm for 30 min, and then plated onto solid LB medium containing 50 μg / mL kanamycin. After overnight culture, positive clones were screened, and plasmids were extracted from the positive clones to obtain the recombinant vector, pBY-GYR.

[0087] The primers used in the above process are listed below:

[0088] Primers Sequence (5'-3') 35S-F GAGGTATCCACAACGCCGGCGGCCGCGGTGTCTCGCACACGGCTTCG P-1-R CCTCTGATGTATTCTTCTCTTCTCCCTGGGCCCAGCTTGCAATCGATG NR TTAGGAGAAGATCTGGTCAGCATTCTTTTTCGCCG N3UTR-F AGGAATCGGGAATCATTAATATCTACTTTATTGTGTGCTTCC P3-F GGGGAGTTGATCATAATGCCATCATTTAAATGTTCCAACATCCCTCATTC P9-R TCAGTTTTATTAATTACTATAATCTTTGTAGTCGACTCATTTATGAGTATG P6-R TCATATGATCCCCTGCATATTTCCAGTGACTG P6-3UTR-F ACCCCTTAACCGAGTAACTCCCTCACTAATACTAAAT MR CTACTTCTTTTTCTCCTTCTCATGGTACGTTGTTGG M-3UTR-F GTATTCACTCTCCAAGCTTTGTACTAGTAATCCAGCC

[0089] The pBY-GRY vector sequence is as follows: SEQ ID NO:3

[0090]

[0091]

[0092]

[0093]

[0094] TGGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTC

[0095] GGATGGCTAAGGGAGAGCTCGAATTTCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGA

[0096] ATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACAT

[0097] GTAATGCATGACGTTATTTATGAGATGGGTTTTATGATTAGAGTCCCCGCAATTATACATTTAATACGCGATA

[0098] GAAAAAAAATATGCGCGCAAACTGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGAA

[0099] TTCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGACAGGATATATTGGCGGGTAAACCTA

[0100] AGAGAAAAGAGCGTTTTATTAGAATAATCGGATATTTAAAAGGGCGTGAAAGGTTTATCCGTTCGTCCATT

[0101] TGTATGTGCATGCCAACCACAGGAGATCTCAGTAAAGCGGCTGGCTGAACCCCCAGCCGGAACTGACCCC

[0102] ACAAGGCCCTAGCGTTTGCAATGCACCAGGTCATCATTGACCCAGGCGTGTTCCACCAGGCCGCTGCCTC

[0103] GCAACTCTTCGCAGGCTTCGCCGACCTGCTCGCGCCACTTCTTCACGCGGGTGGAATCCGATCCGCACAT

[0104] GAGGCGGAAGGTTTCCAGCTTGAGCGGGTACGGCTCCCGGTGCGAGCTGAAATAGTCGAACATCCGTCG

[0105] GGCCGTCGGCGACAGCTTGCGGTACTTCTCCCATATGAATTTCGTGTAGTGGTCGCCAGCAAACAGCACG

[0106] ACGATTTCCTCGTCGATCAGGACCTGGCAACGGGACGTTTTCTTGCCACGGTCCAGGACGCGGAAGCGG

[0107] TGCAGCAGCGACACCGATTCCAGGTGCCCAACGCGGTCGGACGTGAAGCCCATCGCCGTCGCCTGTAGG

[0108] CGCGACAGGCATTCCTCGGCCTTCGTGTAATACCGGCCATTGATCGACCAGCCCAGGTCCTGGCAAAGCT

[0109] CGTAGAACGTGAAGGTGATCGGCTCGCCGATAGGGGTGCGCTTCGCGTACTCCAACACCTGCTGCCACA

[0110] CCAGTTCGTCATCGTCGGCCCGCAGCTCGACGCCGGTGTAGGTGATCTTCACGTCCTTGTTGACGTGGAA

[0111] AATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTTCTTGTTGCGCGTGGTGAACAGGGCAGAGCGGGC

[0112] CGTGTCGTTTGGCATCGCTCGCATCGTGTCCGGCCACGGCGCAATATCGAACAAGGAAAGCTGCATTTCC

[0113] TTGATCTGCTGCTTCGTGTGTTTCAGCAACGCGGCCTGCTTGGCCTCGCTGACCTGTTTTGCCAGGTCCT

[0114] CGCCGGCGGTTTTTCGCTTCTTGGTCGTCATAGTTCCTCGCGTGTCGATGGTCATCGACTTCGCCAAACCT

[0115] GCCGCCTCCTGTTCGAGACGACGCGAACGCTCCACGGCGGCCGATGGCGCGGGCAGGGCAGGGGGAGC

[0116] CAGTTGCACGCTGTCGCGCTCGATCTTGGCCGTAGCTTGCTGGACCATCGAGCCGACGGACTGGAAGGT

[0117] TTCGCGGGGCGCACGCATGACGGTGCGGCTTGCGATGGTTTCGGCATCCTCGGCGGAAAACCCCGCGTC

[0118] GATCAGTTCTTGCCTGTATGCCTTCCGGTCAAACGTCCGATTCATTCACCCTCCTTGCGGGATTGCCCCGA

[0119] CTCACGCCGGGGCAATGTGCCCTTATTCCTGATTTGACCCGCCTGGTGCCTTGGTGTCCAGATAATCCACC

[0120] TTATCGGCAATGAAGTCGGTCCCGTAGACCGTCTGGCCGTCCTTCTCGTACTTGGTATTCCGAATCTTGCC

[0121] CTGCACGAATACCAGCGACCCCTTGCCCAAATACTTGCCGTGGGCCTCGGCCTGAGAGCCAAAACACTT

[0122] GATGCGGAAGAAGTCGGTGCGCTCCTGCTTGTCGCCGGCATCGTTGCGCCACATCTAGGTACTAAAACAA

[0123] TTCATCCAGTAAAATATAATATTTTATTTTCTCCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAATAGCTC

[0124] GACATACTGTTCTTCCCCGATATCCTCCCTGATCGACCGGACGCAGAAGGCAATGTCATACCACTTGTCCG

[0125] CCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCATCTTTCACAAAGATGTTGCTGTCTCCC

[0126] AGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTTCCGTCTTTAAAAAATCATACAGCTCGCGCG

[0127] GATCTTTAAATGGAGTGTCTTCTTCCCAGTTTTCGCAATCCACATCGGCCAGATCGTTATTCAGTAAGTAAT

[0128] CCAATTCGGCTAAGCGGCTGTCTAAGCTATTCGTATAGGGACAATCCGATATGTCGATGGAGTGAAAGAG

[0129] CCTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCTTCCGAGCAAA

[0130] GGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGTTCAAAGTGCAGGACCTTTGG

[0131] AACAGGCAGCTTTCCTTCCAGCCATAGCATCATGTCCTTTTCCCGTTCCACATCATAGGTGGTCCCTTTATA

[0132] CCGGCTGTCCGTCATTTTTAAATATAGGTTTTCATTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACAT

[0133] TCCTTCCGTATCTTTTACGCAGCGGTATTTTTCGATCAGTTTTTTCAATTCCGGTGATATTCTCATTTTAGCC

[0134] ATTTATTATTTCCTTCCTCTTTTCTACAGTATTTAAAGATACCCCAAGAAGCTAATTATAACAAGACGAACT

[0135] CCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATACCAGAAAACAGCTTTTTCAAAGTTGTTTTCAAAG

[0136] TTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAACCACAATTATGGGTGATGCTGCCAACTCGAG

[0137] AGCGGGCCGGGAGGGTTCGAGAAGGGGGGGCACCCCCCTTCGGCGTGCGCGGTCACGCGCACAGGGC

[0138] GCAGCCCTGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAGGTTAGCGGTGG

[0139] CCGAAAAACGGGCGGAAACCCTTGCAAATGCTGGATTTTCTGCCTGTGGACAGCCCCTCAAATGTCAAT

[0140] AGGTGCGCCCCTCATCTGTCAGCACTCTGCCCCTCAAGTGTCAAGGATCGCGCCCCTCATCTGTCAGTAG

[0141] TCGCGCCCCTCAAGTGTCAATACCGCAGGGCACTTATCCCCAGGCTTGTCCACATCATCTGTGGGAAACT

[0142] CGCGTAAAATCAGGCGTTTTCGCCGATTTGCGAGGCTGGCCAGCTCCACGTCGCCGGCCGAAATCGAGC

[0143] CTGCCCCTCATCTGTCAACGCCGCGCCGGGTGAGTCGGCCCCTCAAGTGTCAACGTCCGCCCCTCATCTG

[0144] TCAGTGAGGGCCAAGTTTTCCGCGAGGTATCCACAACGCCGGCGGCCGCGGTGTCTCGCACACGGCTTC

[0145] GACGGCGTTTCTGGCGCGTTTGCAGGGCCATAGACGGCCGCCAGCCCAGCGGCGAGGGCAACCAGCCC

[0146] GGTGAGCGTCTAGTGGACTGATGGGCTGCCTGTATCGAGTGGTGATTTTGTGCCGAGCTGCCGGTCGGGG

[0147] AGCTGTTGGCTGCTGGGTGGCAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACA

[0148] CATTGCGGACGTTTTTAATGTACTGGGGGTGGTTTT

[0149] Underlined text indicates GFP expression box, double underlined text indicates YFP expression box, and underlined and italicized text indicates RFP expression box.

[0150] Example 2: Evaluation of the vector's infectivity and exogenous protein expression capacity

[0151] Rescuing recombinant viruses BY-GYR and BY-GRC (i.e., pCB-BYSMV-EGFP-RFP-ECFP in CN110511955A) from tobacco, the sequence structures of the two vectors are as follows: Figure 1 As shown, the infectivity of the two viral vector backbones is compared. The EGFP reporter gene is inserted at the same position in both viral vectors, so the expression of GFP can reflect the level of viral accumulation and evaluate the ability of the viral vector to express exogenous proteins.

[0152] The specific steps are as follows: The two vectors are transformed into competent Agrobacterium GV3101 cells, respectively. 1 μg of plasmid is added to each competent GV3101 cell, incubated on ice for 30 min, flash-frozen in liquid nitrogen for 1 min, and heat-shocked at 37°C for 5 min. An appropriate amount of liquid LB medium is added, and the cells are incubated at 28°C and 220 rpm for 4-6 hours. The cells are then plated onto solid media containing the corresponding antibiotics. Before injection, Agrobacterium cells carrying the recombinant plasmids and those carrying pGD-VSRs and pGD-NLP plasmids are inoculated into 15 mL of LB liquid medium (containing 25 μg / mL rifampin, 50 μg / mL kanamycin, and 25 μg / mL gentamicin), and cultured at 28°C and 220 rpm with shaking until OD (dose elapsed). 600The concentration was approximately 1.2. After centrifugation at 3000g for 10 min, bacteria were collected, the supernatant was discarded, and the bacteria were resuspended in 4 mL of Agrobacterium resuscitation buffer (10 mM MgCl2, 10 mM MES, 200 mM Acetosyringone). The mixture was then divided into two groups for mixing. The first group consisted of Agrobacterium carrying pBY-GYR, pGD-VSRs, and pGD-NLP plasmids at a final OD600 ratio of 1.0:0.5:0.8. The second group consisted of Agrobacterium carrying pBY-GRC, pGD-VSRs, and pGD-NLP plasmids at a final OD600 ratio of 1.0:0.5:0.8. After standing for 2-3 hours, the bacteria were injected into the tobacco leaves using a disposable syringe via the immersion method. The specific procedure was as follows: Using a 1mL disposable syringe, an appropriate amount of bacterial solution was drawn. The left hand held the leaf of *Nicotiana bungeana*, while the right hand held the syringe injection needle in the area between the second and third veins on the underside of the leaf. The syringe was slowly pushed to fully inject the bacterial solution into the intercellular spaces on the underside of the leaf, ultimately achieving an injection area with a diameter of 2cm. The BY-GYR and BY-GRC groups were injected into the left and right halves of the same leaf on the underside to eliminate errors caused by differences in leaf growth stages. Fifteen days after injection, approximately 0.1g of leaf samples from the injection areas of both the BY-GYR and BY-GRC groups were collected, sampled in liquid nitrogen, and 600μL of 2*SDS loading solution (100mM Tris-HCl, 20% glycerol, 4% SDS, 0.2% bromophenol blue, 5% β-mercaptoethanol, pH 6.8) was added. After boiling in water for 10 minutes, the samples were centrifuged at 12000g for 10 minutes, and 10μL of the supernatant was collected for SDS-PAGE. First, electrophoresis was performed at 80V for 20 minutes. After the samples separated on the gel, the voltage was adjusted to 120V. Electrophoresis was stopped once the loading of the samples was complete. Proteins were then transferred to a nitrocellulose membrane via electroporation at 200mA for 90 minutes. The transferred nitrocellulose membrane was rinsed in TBST buffer (20mM Tris-HCl, 150mM NaCl, 0.05% Tween 20, pH 7.5) and then transferred to blocking buffer (TBST + 5% skim milk powder) for 1 hour at room temperature. After blocking, GFP antibody was added, and the membrane was incubated at room temperature for 1 hour, followed by three washes with TBST. GAR secondary antibody was added, and the membrane was incubated at room temperature for 30 minutes, followed by three washes with TBST. Finally, chemiluminescence was used for color development.

[0153] The results are as follows Figure 2 The results showed that the accumulation level of GFP protein was significantly higher in the BY-GYR experimental group compared with that in the BY-GRC experimental group, indicating that the infectivity of BY-GYR in tobacco is higher than that of BY-GRC, and its ability to express heterologous proteins is also higher than that of BY-GRC. Mock was the blank control group, and RbcL, the large subunit of plant Rubisco, was used as the loading control.

[0154] The viral vector pBY-GRC has been disclosed in a previous article by the inventors' research group. This invention presents an optimized viral three-fluorescent vector, pBY-GYR. In both vectors, the insertion positions of the three expression cassettes in the genome differ, affecting the viral genome structure and consequently its infectivity. The viral three-fluorescent vector pBY-GYR of this invention exhibits stronger heterologous expression capabilities and is more suitable for the development of editing vectors.

[0155] Example 3: Construction of the TaPDS editing vector

[0156] The wheat TaPDS gene (FJ517553) was selected as the target, and sgRNA (SEQ ID NO:1:5'-) was synthesized. ACGACCT GTAATGGTTTACT The pBY-GRY plasmid pBY-GRY vector was modified with TLS at its 3' end (SEQ ID NO:2:5'-TTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGC TCTGATA-3'). The construction of the BYSMV editing vector only requires two steps based on the pBY-GRY plasmid. Homologous recombination was used to sequentially replace the YFP and GFP genes in the pBY-GRY plasmid with synthesized TLS-modified sgRNA and Cas9 mRNA. In the first step, the pBY-GRY vector was digested with restriction endonuclease SalⅠ at 37℃ for 1 h, followed by gel recovery to obtain a linearized vector. This linearized vector was then homologously recombinated with the synthesized sgRNA-TLS fragment to replace the YFP gene, yielding the recombinant vector pBY-TaPDS-TLS.

[0157] A Cas9 sequence (SEQ ID NO:4) was synthesized, and its 3' end was modified with TLS (SEQ ID NO:2,5'-TTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGC TCTGATA-3'). In the second step, the pBY-TaPDS-TLS vector was digested with the restriction endonuclease MluI at 37°C for 1 hour. The linearized vector was then recovered via gel electrophoresis and homologously recombinated with the synthesized Cas9-TLS fragment, replacing the GFP gene. Positive clones were screened and sequenced to obtain the editing vector pBY-Cas9-TaPDS-TLS. Figure 3 As shown.

[0158] The Cas9 sequence is as follows: SEQ ID NO:4

[0159] ATGGATTACAAGGACCACGACGGGGATTACAAGGACCACGACATTGATTACAAGGATGATGATGACAAG

[0160] ATGGCTCCGAAGAAGAAGAGGAAGGTTGGCATCCACGGGGTGCCAGCTGCTGACAAGAAGTACTCGAT

[0161] CGGCCTCGATATTGGGACTAACTCTGTTGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCTCAAA

[0162] GAAGTTCAAGGTCCTGGGCAACACCGATCGGCATTCCATCAAGAAGAATCTCATTGGCGCTCTCCTGTTC

[0163] GACAGCGGCGAGACGGCTGAGGCTACGCGGCTCAAGCGCACCGCCCGCAGGCGGTACACGCGCAGGAA

[0164] GAATCGCATCTGCTACCTGCAGGAGATTTTCTCCAACGAGATGGCGAAGGTTGACGATTCTTTCTTCCAC

[0165] AGGCTGGAGGAGTCATTCCTCGTGGAGGAGGATAAGAAGCACGAGCGGCATCCAATCTTCGGCAACATT

[0166] GTCGACGAGGTTGCCTACCACGAGAAGTACCCTACGATCTACCATCTGCGGAAGAAGCTCGTGGACTCC

[0167] ACAGATAAGGCGGACCTCCGCCTGATCTACCTCGCTCTGGCCCACATGATTAAGTTCAGGGGCCATTTCC

[0168] TGATCGAGGGGGATCTCAACCCGGACAATAGCGATGTTGACAAGCTGTTCATCCAGCTCGTGCAGACGTA

[0169] CAACCAGCTCTTCGAGGAGAACCCCATTAATGCGTCAGGCGTCGACGCGAAGGCTATCCTGTCCGCTAG

[0170] GCTCTCGAAGTCTCGGCGCCTCGAGAACCTGATCGCCCAGCTGCCGGGCGAGAAGAAGAACGGCCTGT

[0171] TCGGGAATCTCATTGCGCTCAGCCTGGGGCTCACGCCCAACTTCAAGTCGAATTTCGATCTCGCTGAGGA

[0172] CGCCAAGCTGCAGCTCTCCAAGGACACATACGACGATGACCTGGATAACCTCCTGGCCCAGATCGGCGA

[0173] TCAGTACGCGGACCTGTTCCTCGCTGCCAAGAATCTGTCGGACGCCATCCTCCTGTCTGATATTCTCAGG

[0174] GTGAACACCGAGATTACGAAGGCTCCGCTCTCAGCCTCCATGATCAAGCGCTACGACGAGCACCATCAG

[0175] GATCTGACCCTCCTGAAGGCGCTGGTCAGGCAGCAGCTCCCCGAGAAGTACAAGGAGATCTTCTTCGAT

[0176] CAGTCGAAGAACGGCTACGCTGGGTACATTGACGGCGGGGCCTCTCAGGAGGAGTTCTACAAGTTCATC

[0177] AAGCCGATTCTGGAGAAGATGGACGGCACGGAGGAGCTGCTGGTGAAGCTCAATCGCGAGGACCTCCT

[0178] GAGGAAGCAGCGGACATTCGATAACGGCAGCATCCCACACCAGATTCATCTCGGGGAGCTGCACGCTAT

[0179] CCTGAGGAGGCAGGAGGACTTCTACCCTTTCCTCAAGGATAACCGCGAGAAGATCGAGAAGATTCTGAC

[0180] TTTCAGGATCCCGTACTACGTCGGCCCACTCGCTAGGGGCAACTCCCGCTTCGCTTGGATGACCCGCAAG

[0181] TCAGAGGAGACGATCACGCCGTGGAACTTCGAGGAGGTGGTCGACAAGGGCGCTAGCGCTCAGTCGTT

[0182] CATCGAGAGGATGACGAATTTCGACAAGAACCTGCCAAATGAGAAGGTGCTCCCTAAGCACTCGCTCCT

[0183] GTACGAGTACTTCACAGTCTACAACGAGCTGACTAAGGTGAAGTATGTGACCGAGGGCATGAGGAAGCC

[0184] GGCTTTCCTGTCTGGGGAGCAGAAGAAGGCCATCGTGGACCTCCTGTTCAAGACCAACCGGAAGGTCAC

[0185] GGTTAAGCAGCTCAAGGAGGACTACTTCAAGAAGATTGAGTGCTTCGATTCGGTCGAGATCTCTGGCGTT

[0186] GAGGACCGCTTCAACGCCTCCCTGGGGACCTACCACGATCTCCTGAAGATCATTAAGGATAAGGACTTCC

[0187] TGGACAACGAGGAGAATGAGGATATCCTCGAGGACATTGTGCTGACACTCACTCTGTTCGAGGACCGGG

[0188] AGATGATCGAGGAGCGCCTGAAGACTTACGCCCATCTCTTCGATGACAAGGTCATGAAGCAGCTCAAGA

[0189] GGAGGAGGTACACCGGCTGGGGGAGGCTGAGCAGGAAGCTCATCAACGGCATTCGGGACAAGCAGTCC

[0190] GGGAAGACGATCCTCGACTTCCTGAAGAGCGATGGCTTCGCGAACCGCAATTTCATGCAGCTGATTCAC

[0191] GATGACAGCCTCACATTCAAGGAGGATATCCAGAAGGCTCAGGTGAGCGGCCAGGGGGACTCGCTGCAC

[0192] GAGCATATCGCGAACCTCGCTGGCTCGCCAGCTATCAAGAAGGGGATTCTGCAGACCGTGAAGGTTGTG

[0193] GACGAGCTGGTGAAGGTCATGGGCAGGCACAAGCCTGAGAACATCGTCATTGAGATGGCCCGGGAGAA

[0194] TCAGACCACGCAGAAGGGCCAGAAGAACTCACGCGAGAGGATGAAGAGGATCGAGGAGGGCATTAAG

[0195] GAGCTGGGGTCCCAGATCCTCAAGGAGCACCCGGTGGAGAACACGCAGCTGCAGAATGAGAAGCTCTA

[0196] CCTGTACTACCTCCAGAATGGCCGCGATATGTATGTGGACCAGGAGCTGGATATTAACAGGCTCAGCGATT

[0197] ACGACGTCGATCATATCGTTCCACAGTCATTCCTGAAGGATGACTCCATTGACAACAAGGTCCTCACCAG

[0198] GTCGGACAAGAACCGGGGCAAGTCTGATAATGTTCCTTCAGAGGAGGTCGTTAAGAAGATGAAGAACTA

[0199] CTGGCGCCAGCTCCTGAATGCCAAGCTGATCACGCAGCGGAAGTTCGATAACCTCACAAAGGCTGAGAG

[0200] GGGCGGGCTCTCTGAGCTGGACAAGGCGGGCTTCATCAAGAGGCAGCTGGTCGAGACACGGCAGATCA

[0201] CTAAGCACGTTGCGCAGATTCTCGACTCACGGATGAACACTAAGTACGATGAGAATGACAAGCTGATCC

[0202] GCGAGGTGAAGGTCATCACCCTGAAGTCAAAGCTCGTCTCCGACTTCAGGAAGGATTTCCAGTTCTACA

[0203] AGGTTCGGGAGATCAACAATTACCACCATGCCCATGACGCGTACCTGAACGCGGTGGTCGGCACAGCTC

[0204] TGATCAAGAAGTACCCAAAGCTCGAGAGCGAGTTCGTGTACGGGGACTACAAGGTTTACGATGTGAGGA

[0205] AGATGATCGCCAAGTCGGAGCAGGAGATTGGCAAGGCTACCGCCAAGTACTTCTTCTACTCTAACATTAT

[0206] GAATTTCTTCAAGACAGAGATCACTCTGGCCAATGGCGAGATCCGGAAGCGCCCCCTCATCGAGACGAA

[0207] CGGCGAGACGGGGGAGATCGTGTGGGACAAGGGCAGGGATTTCGCGACCGTCAGGAAGGTTCTCTCCA

[0208] TGCCACAAGTGAATATCGTCAAGAAGACAGAGGTCCAGACTGGCGGGTTCTCTAAGGAGTCAATTCTGC

[0209] CTAAGCGGAACAGCGACAAGCTCATCGCCCGCAAGAAGGACTGGGATCCGAAGAAGTACGGCGGTTC

[0210] GACAGCCCCACTGTGGCCTACTCGGTCCTGGTTGTGGCGAAGGTTGAGAAGGGCAAGTCCAAGAAGCT

[0211] CAAGAGCGTGAAGGAGCTGCTGGGGATCACGATTATGGAGCGCTCCAGCTTCGAGAAGAACCGATCGA

[0212] TTTCCTGGAGGCGAAGGGCTACAAGGAGGTGAAGAGGACCTGATCATTAAGCTCCCCAAGTACTCACT

[0213] CTTCGAGCTGGAGAACGGCAGGAAGCGGATGCTGGCTTCCGCTGGCGAGCTGCAGAAGGGGAACGAGC

[0214] TGGCTCTGCCGTCCAAGTATGTGAACTTCCTCTACCTGGCCTCCCACTACGAGAAGCTCAAGGGCAGCCC

[0215] CGAGGACAACGAGCAGAAGCAGCTGTTCGTCGAGCAGCACAAGCATTACCTCGACGAGATCATTGAGC

[0216] AGATTTCCGAGTTCTCCAAGCCGGTGATCCTGGCCGACGCGAATCTGGATAAGGTCCTCTCCGCGTACAA

[0217] CAAGCACCGCGACAAGCCAATCAGGGAGCAGGCTGAGAATATCATTCATCTCTTCCACCTGACGAACCT

[0218] CGGCGCCCCTGCTGCTTTCAAGTACTTCGACACAACTATCGATCGCAAGAGGTACACAAGCACTAAGGA

[0219] GGTCCTGGACGCGACCCTCATCCACCAGTCGATTACCGGCCTCTACGAGACGCGCATCGACCTGTCTCAG

[0220] CTCGGGGGCGACAAGCGGCCAGCGGCGACGAAGAAGGCGGGGCAGGCGAAGAAGAAGAAGTGA

[0221] Example 4: Regeneration of Recombinant Viruses

[0222] The edited vector pBY-Cas9-TaPDS-TLS was transformed into Agrobacterium GV3103. Specifically, 1 μg of plasmid was added to competent Agrobacterium GV3103 cells, incubated on ice for 30 min, then flash-frozen in liquid nitrogen for 1 min, heat-shocked at 37°C for 5 min, and then an appropriate amount of liquid LB medium was added. After culturing at 28°C and 220 rpm for 4-6 hours, the cells were spread onto solid media containing the corresponding antibiotics. Before injection, Agrobacterium cells carrying the recombinant plasmid and those carrying pGD-VSRs and pGD-NLP plasmids were inoculated into 15 mL of LB liquid medium (containing 25 μg / mL rifampin, 50 μg / mL kanamycin, and 25 μg / mL gentamicin) and cultured at 28°C and 220 rpm with shaking until OD was reached. 600The concentration was approximately 1.2. After centrifugation at 3000g for 10 min to collect the bacteria, the supernatant was discarded, and the bacteria were resuspended in 4 mL of Agrobacterium suspension buffer (10 mM MgCl2, 10 mM MES, 200 μM Acetosyringone). Agrobacterium bacteria carrying pBY-Cas9-TaPDS-TLS, pGD-VSRs, and pGD-NLP plasmids were mixed at a final OD600 ratio of 1.0:0.5:0.8. After standing for 2-3 hours, the mixture was injected into tobacco leaves using a disposable syringe infiltration method. After 15 days of greenhouse cultivation, samples were collected. Based on the fluorescence signal, 0.3-0.4 g of the injected area of ​​the tobacco leaves was taken and placed in a pre-cooled mortar. 1 mL of microinjection buffer (100 mM Tris-HCl, 10 mM Mg(CH3COO)2, 1 mM MnCl2, 40 mM Na2SO3, pH 8.0) was added and the mixture was thoroughly ground. The virus extract was transferred to EP tubes and centrifuged at 12000g for 10 minutes at 4°C. The supernatant was then collected, and the crude virus extract was injected into second-instar nymphs of the planthopper using a microinjection apparatus. Specifically, second-instar nymphs were transferred from rice to 50mL centrifuge tubes and anesthetized with carbon dioxide for 10 seconds. Approximately 20 nymphs were then picked up with a brush and placed in LB solid medium (antibiotic-free). The planthoppers were positioned ventrally upwards, and the crude virus extract was injected into the thoracic cavity between the first and second pairs of legs using a stereomicroscope and microinjection apparatus. Microinjection parameters were set as follows: injection dose 12nL, injection rate 20nL / s. Approximately 12nL was injected into each nymph, and about 400 nymphs were injected before incubation in rice. After 10 days, approximately 100 infected planthoppers were selected based on RFP fluorescence for virus transmission. The specific procedure was as follows: Planthoppers treated with the injection were transferred from the rice plants to 50mL centrifuge tubes. After anesthetizing the plants with carbon dioxide for 10 seconds, approximately 20 nymphs were picked up with a brush and placed on a black cardboard. Using a handheld fluorescent lamp, planthoppers with RFP fluorescent signals were selected and transferred to EP tubes with a brush, and counted. Every 24 infected planthoppers were transferred to one EP tube. Planthoppers with RFP fluorescent signals were then inoculated into wheat (winter wheat, Kexing 3302) that had been vernalized at 4℃ for more than 10 days. Specifically, three wheat seedlings were planted per pot, with an average of 8 planthoppers inoculated per seedling. 24 planthoppers were poured into the wheat seedlings, and the pots were covered with a cylindrical plastic cover, the top of which was wrapped with gauze to prevent the planthoppers from spreading and to ensure ventilation. A total of 12 seedlings were inoculated and incubated in a 25℃ light incubator with a 16-hour light cycle and an 8-hour dark cycle for 7 days to transmit the virus. Seven days later, the insects were transferred to a new batch of vernalized wheat for virus transmission. The infected wheat was then observed using a handheld fluorescent lamp to assess virus infection. A diagram illustrating virus rescue and infection of plants is shown below. Figure 4 As shown.

[0223] Example 5: Induction of lateral buds in albino mutants

[0224] like Figure 5 As shown, after inoculation, diseased wheat plants were screened based on RFP fluorescence signals. Unaffected wheat plants were cut off and cultured in a 25℃ light incubator with a 16-hour light cycle followed by 8 hours of darkness for two months. After two months, the diseased wheat began to tiller, and some lateral buds had grown to the two-leaf stage. These lateral buds were observed and counted to identify those that could produce albino mutant lateral buds. When the albino lateral buds grew to the two-leaf stage, the main stem and all wild-type lateral buds were cut off. Subsequent tillering of lateral buds was then continuously screened, retaining completely albino or white-green lateral buds and removing surrounding wild-type lateral buds. Figure 6 As shown.

[0225] Example 6: Obtaining homozygous progeny mutants

[0226] Further culture of mutant lateral buds, such as Figure 7 As shown, the mutant was transferred to a greenhouse for cultivation. The soil used for planting wheat was a 1:1 mixture of substrate soil and potting soil. During the jointing stage, an appropriate amount of Flower-Free Culture Solution was applied weekly for three weeks. After the lateral buds of the mutant reached the heading stage, an appropriate amount of Flower-Free Culture Solution was applied weekly for three weeks. When the plants entered the grain-filling stage, a total of 14 ears were counted. The inflorescence stalks were observed by opening the bracts, and ears with albino inflorescence stalks were selected. A total of 6 ears with albino inflorescence stalks were selected, and 4-6 seeds were randomly selected from each ear for sowing. The seeds were germinated in vermiculite. After 7 days, seedlings were sampled to detect target mutations and homozygous mutants were screened. Genomic DNA was extracted using the CTAB method. Specifically, approximately 0.1 g of leaf tissue from seedlings was sampled in liquid nitrogen, and 600 μL of CTAB DNA extraction buffer was added. The mixture was thoroughly vortexed and centrifuged at 12000 g for 10 min after incubating at 65°C for 30 min. The supernatant was collected, and an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) was added. After vortexing and centrifugation at 12000 g for 10 min, approximately 400 μL of the upper phase was collected, and an equal volume of isopropanol was added. The mixture was precipitated at -20°C for 30 min, and then centrifuged at 2000 g for 10 min. The supernatant was discarded, and the precipitate was washed twice with 75% ethanol. After drying, 50 μL of ddH2O was added, and the genomic DNA was fully dissolved before use as a PCR template. Specific primers were designed to amplify a fragment of approximately 250 bp near the target. A small amount of PCR product was analyzed by agarose gel electrophoresis, and the amplicon was then sent to the Hi-TOM platform for high-throughput sequencing analysis. Figure 8 As shown, the results of second-generation sequencing analysis indicate that seeds from the same ear source have the same target mutation type in their offspring, and their genotypes are basically the same; seeds from different ear sources have different target mutation types in their offspring, and they are mutants with different genotypes.

[0227] Example 7: Editing of the TaeIF4E and TaSDN1 genes

[0228] Following the same steps as in Examples 2-6, the TaeIF4E and TaSDN1 genes were edited using the BYSMV editing vector. The sgRNAs for the edited genes are as follows:

[0229] TaeIF4E

[0230] GTTGTCGAACCAGAAGGTCCG TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCATTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGCTCTGATA(SEQ ID NO:5)

[0231] TaSDN1

[0232] CGTCCTTGGTCCGCTTCTTGG TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCATTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGCCTGATA (SEQ ID NO: 6)

[0233] The underlined part indicates an editable region of the sgRNA.

[0234] Two disease resistance-related targets, TaeIF4E and TaSDN1, were selected for editing. Literature has reported that knocking out TaeIF4E in wheat enhances the resistance of mutant plants to WYMV (Wheat yellow mosaic virus) (Kan et al., 2023, CRISPR / Cas9-guided knockout of eIF4E improves Wheat yellow mosaic virus resistance without yield penalty); while for SDN1, knocking out SDN1 in the wheat D-set chromosome enhances the resistance of mutant plants to BYDV (barley yellow dwarf viruses) (Jin et al., 2022, Barley GRIK1-SnRK1 kinases subvert a viral virulence protein toupregulate antiviral RNAi and inhibit infection). Targets were designed for these two genes, and viral editing vectors were constructed, such as... Figure 9As shown. Following the TaPDS editing procedure, the recombinant virus was inoculated into Sinovac 3302 wheat germ cells. Fifteen days after inoculation, PCR testing demonstrated that it could induce highly efficient somatic cell editing, as shown. Figure 10 As shown.

[0235] Next, mutant lateral buds were screened. One month after inoculation, the diseased plants began to tiller. Some lateral buds became virus-free. Genomic DNA was extracted from these lateral buds and sequenced. It was found that some of the virus-free lateral buds underwent editing. Compared with editing induced by somatic cells, the number of mutation types was reduced and more consistent, proving that they were stable mutations. Figure 11 As shown. This lateral bud is retained for cultivation, in preparation for seed harvesting and progeny testing.

[0236] Screening for mutant lateral buds, homozygous mutant lateral buds were obtained, with genotypes as follows: Figure 12 As shown, PCR detection confirmed a 100% edited biallelic mutant. Furthermore, the mutant lateral bud could grow normally; by retaining this lateral bud for culture, mutant progeny were obtained.

[0237] The embodiments described above are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

Claims

1. A plant cytoplasmic rhabdovirus expression vector, characterized in that, The plant cytoplasmic rhabdovirus expression vector contains the reverse complementary sequence of the whole genome of barley yellow-striped mosaic virus (BYSMV). In the plant cytoplasmic rhabdovirus expression vector, a sequence-specific nuclease Cas9 gene was inserted between the N and P genes of the barley yellow striped mosaic virus (BYSMV) genome, and an sgRNA sequence was inserted between the P6 and M genes. The 3' end of both the sequence-specific nuclease Cas9 gene and the sgRNA sequence is modified with a TLS sequence, the nucleotide sequence of which is shown in SEQ ID NO:2; The framework sequence of the plant cytoplasmic rhabdovirus expression vector is shown in SEQ ID NO:

3.

2. The plant cytoplasmic rhabdovirus expression vector as described in claim 1, characterized in that, The length of the sgRNA sequence is 18~35 nt.

3. The plant cytoplasmic rhabdovirus expression vector as described in any one of claims 1-2, characterized in that, An RFP fluorescent reporter gene was inserted between the M and G genes of the barley yellow-striped mosaic virus (BYSMV) genome into a plant cytoplasmic rhabdovirus expression vector.

4. A negative-sense RNA virus plant genome editing system, characterized in that, It includes the expression vector as described in any one of claims 1-3.

5. The negative-sense RNA virus plant genome editing system as described in claim 4, characterized in that, It also includes auxiliary vectors, which may be vectors that express BYSMV N, P, and L separately, or vectors that simultaneously express BYSMV N, P, and L; and / or vectors that simultaneously express gene silencing repressors p19, HCpro, and γb.

6. The negative-sense RNA virus plant genome editing system as claimed in claim 4 or 5, characterized in that, Monocotyledonous plants are infected by insect vectors.

7. The application of a negative-sense RNA virus plant genome editing system as described in any one of claims 4-6 in plant gene editing, characterized in that, The plant is either tobacco or wheat; RNA-mediated movement motifs facilitate the delivery of editing elements to the meristematic region.

Images