Method for mining abalone gender differential expression miRNA and target mRNA thereof

Abstract

The invention discloses an abalone gender differential expression miRNA and a mining method of target mRNA of the abalone gender differential expression miRNA, and belongs to the technical field of molecular biology. According to the method, transcriptome and sRNA sequencing is carried out on gonad tissues of sexually mature female and male abalones, so that the expression difference of mRNA and miRNA in the female and male abalones is compared, multiple differential expression miRNAs related to the sex and reproduction of the abalones and target mRNA thereof are positioned through sequencing, and a regulatory network of part of miRNA and mRNA is disclosed; according to the method, the sequencing result is accurate and reliable, and the sequenced gene is expected to serve as a molecular marker, is applied to evaluation of sex maturity and sex determination of abalones, and has important practical significance and practical application value for perfecting transcriptomes and miRNA gene banks of ovaries and testis tissues of abalones.

Description

Technical Field

[0001] The invention relates to a method for mining abalone sex-differentially expressed miRNA and its target mRNA, and belongs to the technical field of molecular biology. Background Art

[0002] Abalone is a marine gastropod that is highly regarded in Europe, the United States, and most Asian countries for its taste and nutritional value, and has huge economic and social benefits. Given the social and economic importance of abalone, understanding its sexual maturity and sex determination mechanism is crucial for abalone aquaculture. However, in the non-breeding season, there is no obvious difference in secondary sexual characteristics between sexually immature male and female abalone, and it is difficult to distinguish their genders only from morphology and appearance. It often takes a long time for abalone to reach sexual maturity and show sexual characteristics. In addition, it is difficult to control the synchronous discharge of male and female abalone gonads, which has become a major problem facing the current abalone aquaculture industry. It is extremely important to analyze the reproductive biology of abalone.

[0003] Gonadal development is usually regulated by endogenous and exogenous factors, among which endogenous factors are closely related to the expression levels of mRNAs and miRNAs. miRNAs are a class of small non-coding RNA molecules (sequence length is 18-22 nt) that can specifically bind to target mRNAs to regulate post-transcriptional gene expression. They play a key role in various biological processes, including body development, sex determination and differentiation, and cell apoptosis. Analysis of their expression profiles and functions has far-reaching research significance for solving the current abalone farming industry's problems in judging abalone sexual maturity and identifying abalone sex. However, there is currently a lack of methods for mining miRNAs related to sex and reproduction in abalone, as well as analysis of the target mRNA regulatory network of miRNAs. Summary of the invention

[0004] In view of the current problem, the present invention proposes a method for mining abalone sex differentially expressed miRNA and its target mRNA, which performs transcriptome and sRNA sequencing on gonadal tissues of sexually mature female and male abalone to compare the expression differences of mRNA and miRNA in female and male abalone, and then sequences and locates a variety of differentially expressed miRNAs and their target mRNAs related to abalone sex and reproduction; the sequencing results of this method are accurate and reliable, revealing the regulatory network of some miRNAs and mRNAs, and the sequenced genes are expected to be used as molecular markers for abalone sexual maturity judgment and sex identification; this method has important practical significance and practical application value for improving the transcriptome and miRNA gene library of abalone ovarian and testicular tissues.

[0005] The technical solution of the present invention is as follows:

[0006] The present invention provides a method for mining abalone sex-differentially expressed miRNA and its target mRNA, comprising the following steps:

[0007] S1. Collection of abalone gonadal tissue and RNA extraction: RNA was extracted from the gonads of sexually mature female and male abalone, and cDNA libraries and sRNA libraries were constructed based on the extracted RNA;

[0008] S2. Transcriptome sequencing of abalone gonadal tissue and screening of sex-differentially expressed mRNA: using transcriptome analysis technology to obtain the expression levels of each mRNA in the cDNA library of female and male abalone, respectively, and screening to obtain the sex-differentially expressed mRNA of the female and male abalone through a significance test of the difference in the expression levels of each mRNA in female and male abalone; wherein the criteria for the significance test are: P<0.05, |log2(Fold change)|≥10;

[0009] S3. sRNA sequencing of abalone gonadal tissue and screening of sex-differentially expressed miRNAs: The expression levels of each miRNA in the sRNA libraries of female and male abalones were obtained by using sRNA analysis technology, and the sex-differentially expressed miRNAs of female and male abalones were screened by performing a significance test on the difference in expression levels of each miRNA in female and male abalones; wherein the criteria for the significance test were: P<0.05, |log2(Fold change)|≥2;

[0010] S4. Mining target mRNAs of sex-differentially expressed miRNAs: For the sex-differentially expressed miRNAs obtained in step S3, use psRobot and miRanda software to screen out the target mRNAs of the sex-differentially expressed miRNAs from the sex-differentially expressed mRNAs obtained in step S2, and perform functional annotation and enrichment analysis on the obtained target mRNAs using GO and KEGG databases, where GO enrichment and KEGG pathway enrichment use p < 0.05 as the significant enrichment standard; then use Cytoscape software to construct and visualize the sex-differentially expressed miRNAs and their target mRNAs to obtain the target mRNAs of the sex-differentially expressed miRNAs.

[0011] Furthermore, the transcriptome analysis technique in step S2 comprises the following steps:

[0012] TopHat, Scripture and Cufflinks software were used to locate, functionally analyze and predict expression levels of high-quality sequence information in the cDNA library; HTSeq software was then used to analyze gene expression levels of the sequence information, and edgeR software was used to perform significance analysis of expression differences. According to the significance test criteria for expression level differences, the mRNA expressed by gender differences was screened out.

[0013] Furthermore, the specific steps of the sRNA analysis technology described in step S3 are as follows:

[0014] Bowtie, mirdeep2, srna-tools-cli and miREvo software were used to locate, functionally analyze and predict the expression level of high-quality sequence information in the sRNA library respectively; then DESeq R software was used to analyze the significance of expression differences between female and male abalone miRNAs, and the miRNAs with gender-differential expression were screened out according to the significance test criteria of the expression level differences.

[0015] Furthermore, the expression of the sex differentially expressed miRNA and its target mRNA can be verified by qRT-PCR experiment or FISH experiment.

[0016] Furthermore, the qRT-PCR experiment comprises the following steps: using the amplification primer set SEQ ID NO.58 to SEQ ID NO.74 to amplify the miRNA or its target mRNA expressed differently by sex; -ΔΔCT The quantitative result analysis was performed by the method to calculate the relative expression levels of the sex differentially expressed miRNA or its target mRNA and the internal reference gene.

[0017] Furthermore, the FISH experiment comprises the following steps: using probes of SEQ ID NO.75 to SEQ ID NO.80 to examine the difference in expression of the target mRNA in gonadal tissues of sexually mature and sexually immature female abalone or male abalone.

[0018] The present invention provides abalone sex-differentially expressed miRNA and its target mRNA, wherein the sex-differentially expressed miRNA and its target mRNA are obtained by the above method;

[0019] The gender-differentially expressed miRNA is any one of hdh-miR-133-3p, hdh-miR-1990, hdh-miR-1994a, hdh-miR-1994b, hdh-miR-2722, hdh-miR-31, hdh-miR-92, novel_1, novel_101, novel_120, novel_18, novel_19, novel_3, novel_32, novel_42, novel_53, novel_57, novel_6, novel_8, and novel_90, and its nucleotide sequence is shown in SEQ ID NO.1 to SEQ ID NO.20; the nucleotide sequence of the target mRNA of the gender-differentially expressed miRNA is shown in SEQ ID NO.21 to SEQ ID NO.57; as shown in Table 4, the gender-differentially expressed miRNA and its target mRNA have any one of the following corresponding relationships:

[0020] Table 4 Gender differentially expressed miRNAs and their corresponding target mRNAs

[0021]

[0022]

[0023]

[0024] The sex-differentially expressed miRNA is up-regulated or down-regulated in the gonads of female and male abalone to regulate the down-regulation or up-regulation of the expression of its corresponding target mRNA; wherein the miRNAs down-regulated in male abalone include: hdh-miR-1994a, hdh-miR-1994b, novel_57, novel_120, novel_6, hdh-miR-31, etc., and the mRNA expression of their corresponding targets is up-regulated, while the expression of these genes in female abalone is the opposite; the miRNAs down-regulated in female abalone include: hdh-miR- 133-3p, hdh-miR-1990, hdh-miR-2722, hdh-miR-92, novel_1, novel_101, novel_18, novel_19, novel_3, novel_32, novel_42, novel_53, novel_8, novel_90, etc., the expression of their regulated target mRNA is upregulated, while the expression of these genes in male abalone is the opposite; based on this, these genes with different expression levels in female and male abalone can be used as molecular markers to distinguish female and male abalone.

[0025] The present invention also provides a use of the sex-differentially expressed miRNA and its target mRNA obtained by the above method. The sex-differentially expressed miRNA and its target mRNA measured by the method have significant expression difference in female and male abalone, can be used as molecular markers for female and male abalone, and applied to abalone sexual maturity assessment and sex identification.

[0026] The present invention has the following beneficial effects:

[0027] 1. The prior art lacks research on abalone sex differentially expressed miRNA. The present invention provides a method for mining abalone sex differentially expressed miRNA and its target mRNA. The method performs transcriptome and sRNA sequencing on gonadal tissues of sexually mature female and male abalone to compare the expression differences of mRNA and miRNA in female and male abalone, and then sequences and locates a variety of differentially expressed miRNAs and their target mRNAs related to abalone sex and reproduction, reveals the regulatory network of some sex differentially expressed miRNAs and mRNAs, and is verified by qRT-PCR and FISH experiments, and the sequencing results are accurate and reliable.

[0028] 2. The genes sequenced by the method provided by the present invention have important practical significance and practical application value for improving the transcriptome and miRNA gene library of abalone ovarian and testicular tissues, and are expected to be used as molecular markers for the evaluation of sexual maturity and gender identification of abalone. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 (a) Volcano plot and heat map of differentially expressed mRNAs in DD_ovary_group and DD_testis_group discus discus. Red and green dots represent up-regulated and down-regulated transcripts, respectively. Figure 1 (b) Hierarchical clustering of differentially expressed mRNAs in DD_ovary_group and DD_testis_group discus discus. Red rectangles indicate up-regulated mRNAs; blue rectangles indicate down-regulated mRNAs.

[0030] Figure 2 Analysis of significant KEGG pathways of differentially expressed mRNAs in DD_ovary_group and DD_testis_group discus discus.

[0031] Figure 3The volcano plots and heat maps of differentially expressed miRNAs in DD_ovary_group and DD_testis_group discus discus (P<0.05); (a) is the volcano plot of differentially expressed miRNAs, where red and green dots represent up-regulated and down-regulated transcripts, respectively; (b) is the hierarchical clustering of differentially expressed miRNAs, where red rectangles represent up-regulated miRNAs and blue rectangles represent down-regulated miRNAs.

[0032] Figure 4 Figure 3 is the interaction network of differentially expressed miRNAs and some of their target mRNAs in DD_ovary_group and DD_testis_group discus discus, where green ovals represent downregulated target mRNAs; red ovals represent upregulated target mRNAs; green triangles represent downregulated differentially expressed miRNAs; and red triangles represent upregulated differentially expressed miRNAs.

[0033] Figure 5 Gene ontology distribution of target mRNAs of differentially expressed miRNAs.

[0034] Figure 6 The expression of differentially expressed miRNAs and differentially expressed mRNAs was quantitatively detected by qRT-PCR experiment, where the values ​​are shown as mean ± SD (n = 3), * indicates P < 0.05; ** indicates P < 0.01.

[0035] Figure 7 These are images of Verl mRNA taken under a fluorescence microscope after FISH experiment; (a, d) are fluorescence images of Verl antisense probe (red fluorescence); (b, e) are fluorescence images stained with DAPI counter (blue fluorescence); (c, f) are merged fluorescence images; scale bar is 50 μm.

[0036] Figure 8 Fluorescence microscope images of Tssk1B mRNA after FISH experiment; (a, d) are fluorescence images of Tssk1B antisense probe (green fluorescence); (b, e) are fluorescence images of DAPI counter staining (blue fluorescence); (c, f) are merged fluorescence images; scale bar is 50 μm. DETAILED DESCRIPTION

[0037] The present invention will be further described below in conjunction with the accompanying drawings and preferred embodiments. The given embodiments are only for illustrating the present invention, rather than for limiting the scope of the present invention.

[0038] Unless otherwise specified, the materials, reagents, etc. used in the following examples can be obtained from commercial sources; the methods in the following examples are conventional methods unless otherwise specified.

[0039] The sexually mature abalone used in the following examples is Haliotis discus hannai, purchased from Jinjiang Fuda Abalone Aquatic Products Co., Ltd. The physiological conditions of the selected abalone are: 100-120 mm, 36 months of age, and a visual gonadal index (VGI) of 3.

[0040] Example 1

[0041] This embodiment provides a method for mining abalone sex-differentially expressed miRNA and its target mRNA, comprising the following steps:

[0042] (1) Collection of abalone gonadal tissue and RNA extraction

[0043] Sexually mature male and female abalones with similar size, age, and visual gonadal index were selected as experimental abalones, and about 500 mg of gonadal tissue samples (sperm or eggs) were collected from each of them, quickly frozen in liquid nitrogen, and stored at -80°C; total RNA was extracted from the gonadal tissue samples of female and male abalone using TRIzol reagent, and the total RNA was evaluated for purity and integrity, and then used for library construction and sequencing;

[0044] (2) Transcriptome sequencing of abalone gonadal tissue and screening of sex-differentially expressed mRNAs

[0045] The cDNA library was constructed from 3 μg of extracted total RNA and sequenced on a sequencing platform after clustering. After the sequencing data removed the adapter sequence and low-quality data, high-quality sequence information was obtained, wherein the clustering was performed by TruSeq PE clustering toolkit v3-cBot-HS and cBot clustering generation system, the sequencing platform was Illumina HiseqX, and the sequencing read length was 150 bp for double-end sequencing; the obtained high-quality sequence information was analyzed using transcriptome analysis technology to obtain the expression level of each mRNA in the cDNA library of female and male abalone, respectively, and the gender-differential expression mRNA of female and male abalone was screened through a significance test of the difference in expression level of each mRNA in female and male abalone; wherein the standard for the significance test of the difference in expression level was: P<0.05, |log2(Fold change)|≥10;

[0046] (3) sRNA sequencing of abalone gonadal tissue and screening of sex-differentially expressed miRNAs

[0047] The sRNA library is constructed from 3 μg of extracted total RNA and sequenced on a sequencing platform after clustering. After removing the adapter sequence and low-quality data from the sequencing data, high-quality sequence information is obtained, wherein the sequencing platform is Illumina HiSeq2500, and the sequencing read length is 50 bp for single-end sequencing; the obtained high-quality sequence information is analyzed using sRNA analysis technology to obtain the expression levels of each miRNA in the sRNA library of female and male abalone, respectively, and the difference in expression levels of each miRNA in female and male abalone is tested by significance, and the miRNA differentially expressed by sex between female and male abalone is screened; wherein the criteria for the significance test are: P<0.05, |log2(Fold change)|≥2;

[0048] (4) Mining target mRNAs of sex-differentially expressed miRNAs

[0049] For the sex differentially expressed miRNA obtained in step (3), psRobot and miRanda software were used to screen out the target mRNA of the sex differentially expressed miRNA from the differentially expressed mRNA obtained in step (2), and the predicted target mRNA was subjected to GO and KEGG database functional annotation and enrichment analysis, with GO enrichment and KEGG pathway enrichment being considered significant when P < 0.05; then, Cytoscape software was used to construct and visualize the sex differentially expressed miRNA and its target mRNA to obtain the target mRNA of the sex differentially expressed miRNA.

[0050] (5) Verification of the expression patterns of some sex-differentially expressed miRNAs and their interaction networks with target mRNAs.

[0051] Fluorescence real-time quantitative PCR (qRT-PCR) and FISH experiments were used to verify some of the differentially expressed miRNAs and their target mRNAs between sexes to examine the validity of the sequencing results.

[0052] In order to ensure the reliability of the results, three groups of female and male abalone were selected for the experiment; the female abalone group was named DD_ovary_group, and according to the specific groups, they were marked as DD_ovary_1, DD_ovary_2, and DD_ovary_3; the male abalone group was named DD_testis_group, and according to the specific groups, they were marked as DD_testis_1, DD_testis_2, and DD_testis_3.

[0053] The specific steps of the transcriptome analysis technology described in step (2) of this embodiment are as follows: use TopHat software to align the high-quality sequence information to the abalone reference genome, and use Scripture and Cufflinks software to analyze the function and expression level of each mRNA; then use HTSeq software to analyze the gene expression level of each mRNA, and use edgeR software to perform expression difference significance analysis, and screen out the gender-differentially expressed mRNA according to the criteria of the significance test of expression difference.

[0054] The specific steps of the sRNA analysis technology described in step (3) of this embodiment are as follows: using Bowtie to compare the high-quality sequence information with the abalone reference genome in the miRBase database, annotating to known miRNA sequences and calculating miRNA expression levels; then using mirdeep2, srna-tools-cli and miREvo software to predict the location, function and expression level of new miRNAs; and then using DESeq R software to perform expression difference significance analysis on the miRNAs of male and female abalones, and screening out the miRNAs expressed by gender according to the criteria of the significance test of expression difference.

[0055] Sequencing data analysis

[0056] The sequencing data obtained by the method for mining the abalone sex differentially expressed miRNA and its target mRNA described in this example were subjected to data quality assessment, screening of sex differentially expressed mRNA and miRNA, and analysis of gene function and metabolic pathways to identify miRNA and its target mRNA related to abalone sex differentiation and sexual maturity, and qRT-PCR experiments and FISH experiments were performed on some of the identified sex differentially expressed mRNA and miRNA to verify the accuracy of the sequencing method.

[0057] (1) Data quality assessment of transcriptome and sRNA sequencing

[0058] The composition of the original data of transcriptome sequencing of the three groups of female and male abalone is shown in Table 1. Transcriptome sequencing obtained 260,167,186 clean reads, of which 70.86% to 82.94% of clean reads can be located in the reference genome of Haliotis discus henna. In the sequencing results, an average of 59.32%, 7.07% and 33.6% of clean reads were consistent with exons, introns and intergenic genes, respectively. The results showed that the sequence validity and usable ratio obtained by sequencing were high, the overall quality was excellent, the sequencing base error rate was very low, the sequencing quality was high, the sequencing results were reliable, the data obtained were qualified, the results were reliable, and they could be used for subsequent bioinformatics analysis.

[0059] The raw data composition of sRNA sequencing of 3 groups of female and male abalone is shown in Table 2. sRNA sequencing obtained 11.41M clean reads (accounting for 97.43% of raw reads), and a total of 5.02 million sRNAs were annotated, of which 89.64% of sRNAs were successfully located in the reference genome of Haliotis discus hannai, and the small RNAs within 22nt in length were the most. The results show that the reliability of the sRNA sequencing process of the present invention is high. In order to identify known and new miRNAs in clean reads, we compared the miRNA sequences with the known miRNA sequences in the miRBase database. After positioning, 54 known miRNAs and 83 new miRNAs were identified.

[0060] Table 1 Quality of transcriptome sequencing data

[0061]

[0062]

[0063] Table 2 Quality of sRNA sequencing data

[0064]

[0065] (2) Screening of sex-differentially expressed mRNAs in abalone and its functional annotation and enrichment

[0066] The present invention uses P<0.05, |log2(Fold change)|≥10 as the standard to screen the mRNA differentially expressed by sex. The transcriptome sequencing mRNA expression level of abalone in the DD_ovary_group group was compared with that of the DD_testis_group group, and 685 differentially expressed mRNAs were identified. At the same time, according to the expression amount of the differentially expressed mRNA, the differentially expressed mRNA was divided into up-regulated genes and down-regulated genes. It was identified that a total of 479 mRNAs were up-regulated and 206 mRNAs were down-regulated. Among the upregulated mRNAs, those with significant differences in expression levels included: yolk envelope sperm lytic protein receptor (Verl), brain tumor protein (brat), papillary protein (Ppn), galactoside (1, 2)-nucleoside transferase 2 (Fut2), tubulin 1A chain (Tuba1A), G2 / mitosis-specific cyclin A (fragment), fatty acid synthase (Fasn), indoleethylamine N-methyltransferase (Inmt), thyroid peroxidase (Tpo), protocadherin fat 3 (hFat3), peroxiredoxin, complement clr-like egf-like, lectin C-type domain, integrase core domain, zona pellucida-like domain, etc. These genes were highly expressed in the gonads of female abalone, but were almost not expressed or were expressed at a low level in the gonads of male Haliotis discus. Among the down-regulated mRNAs, the mRNAs with more significant expression differences include: tubulin-2 / -4 chain, transcription factor Sox-30 (Sox-30), testis-specific serine / threonine protein kinase (Tssk), testis, prostate and placenta expressed protein, kelch-like protein, heat shock factor protein 1 (HSF1), egg lysis protein (sperm lysis protein), etc. These genes are highly expressed in the gonads of male Abalone discus, and are almost not expressed or expressed at a low level in the gonads of female Abalone discus. Figure 1 As shown in the figure, the gene expression volcano map and heat map also showed that the screened sex-differentially expressed mRNAs had significant expression differences between the female and male abalone groups (P<0.05). The results showed that these sex-differentially expressed mRNA genes are expected to be used as molecular markers to distinguish between female and male abalone.

[0067] Functional enrichment analysis and metabolic pathway analysis were performed on the screened gender differentially expressed mRNAs using the GO and KEGG databases. As shown in Table 3, in the GO database, the screened gender differentially expressed mRNAs were enriched in 46 different biological processes, 16 different different molecular functions, and 1 different cellular component after functional annotation. The main biological processes involved included carbohydrate metabolism, protein phosphorylation, DNA integration, DNA integration, cell-matrix adhesion, etc. The main molecular functions involved included kinase activity, hydrolase activity, activity acting on glycosyl bonds and protein kinases, etc. The main cellular components involved were related to the extracellular region; Figure 2 As shown, in the KEGG database, the screened sex differentially expressed mRNAs were annotated and enriched in 7 metabolic pathways (P < 0.05), including starch and sucrose metabolism, glycosphingolipid biosynthesis-lactose and neolactose series, lysosome, glycosphingolipid biosynthesis-globose and isoglobose series, glycosaminoglycan degradation, arginine and proline metabolism, and amino sugar and nucleotide sugar metabolism.

[0068] Table 3 GO annotation and significant enrichment of sex-differentially expressed mRNAs in abalone

[0069]

[0070]

[0071]

[0072] (3) Screening of sex-differentiated miRNAs in abalone

[0073] The present invention uses P<0.05 as the standard to screen the differentially expressed miRNAs by sex. The miRNA expression levels of abalone in the DD_ovary_group group were compared with those in the DD_testis_group group, and 57 differentially expressed miRNAs were identified, of which 30 miRNAs were upregulated and 27 miRNAs were downregulated; Figure 3 As shown, the volcano plot and heat map of miRNA expression levels indicated that there were significant expression differences of the identified miRNAs between the two groups (P<0.05).

[0074] (4) Mining target mRNAs of sex-differentiated miRNAs in abalone

[0075] In order to analyze the molecular functions of the screened sex-differentially expressed miRNAs, the present invention used psRobot and miRanda software to perform predictive analysis on the target genes of the above 57 sex-differentially expressed miRNAs, established the connection between sex-differentially expressed miRNAs and sex-differentially expressed mRNAs, and used Cytoscape software to visualize the interaction between sex-differentially expressed miRNAs and predicted target mRNAs.

[0076] The results showed that among the 57 sex-differentially expressed miRNAs, 7 up-regulated miRNAs were able to target 13 differentially expressed mRNAs, and 16 down-regulated miRNAs were able to target 49 differentially expressed mRNAs. The study found that some sex-related differentially expressed mRNAs were targeted by differentially expressed miRNAs, such as the yolk envelope sperm solubilizing protein receptor (Verl), which plays a key role in promoting fertilized eggs, was targeted by novel_90, and the testis-specific serine / threonine protein kinase (Tssk), which plays an important role in germ cell differentiation and sperm function, was targeted by novel_120. After analysis, the targeting relationship between each sex-differentially expressed mRNA and sex-differentially expressed miRNA is shown in Table 4 and Figure 4 As shown, the nucleotide sequences of the screened sex-differentially expressed miRNAs are shown in SEQ ID NO.1 to SEQ ID NO.20, and the nucleotide sequences of the target mRNAs of the sex-differentially expressed miRNAs are shown in SEQ ID NO.21 to SEQ ID NO.57; the miRNAs downregulated in male abalone include: hdh-miR-1994a, hdh-miR-1994b, novel_57, novel_120, novel_6, and hdh-miR-31, and the mRNA expressions of the corresponding targets are upregulated, while the expressions of these genes in female abalone are the opposite; the miRNAs downregulated in female abalone include: hdh-miR-133-3p, hdh-miR-1990, hdh-miR-2722, and hdh-miR-31. h-miR-92, novel_1, novel_101, novel_18, novel_19, novel_3, novel_32, novel_42, novel_53, novel_8, and novel_90, the expression of their regulated target mRNAs was upregulated, while the expression of these genes in male abalone was the opposite; based on this, these miRNAs and target mRNA genes that showed obvious differences in expression levels in female and male abalone can be used as molecular markers to distinguish between female and male Haliotis discus.

[0077] In order to further explore the biological functions of miRNA, GO functional enrichment analysis was performed on the predicted target mRNA genes to determine the key pathways regulating sex differentiation and sexual maturity. Figure 5As shown, some target mRNAs were involved in biological processes such as carbohydrate metabolism, protein phosphorylation, phosphorylation, cell-matrix adhesion, and cell-matrix adhesion, and some target mRNAs were involved in molecular functions such as hydrolase activity, acting on glycosyl bonds, kinase activity, protein kinase activity, hydrolase activity, hydrolysis of o-glycosyl compounds, phosphotransferase activity, and alcohol groups as receptors. KEGG pathway analysis showed significant pathways for starch and sucrose metabolism (P<0.05). The results showed that miRNA-mRNA controlled sexual maturation and sex determination of Abalone discus through these pathways.

[0078] Table 4 Gender differentially expressed miRNAs and their corresponding target mRNAs

[0079]

[0080]

[0081] (5) Fluorescence real-time quantitative PCR verification

[0082] In order to verify the reliability of the method for mining sex differentially expressed miRNA and its target mRNA of the present invention, the present invention selects some sex differentially expressed miRNAs (hdh-miR-92 (SEQ ID NO.8), novel_1 (SEQ ID NO.13), hdh-miR-1994b (SEQ ID NO.16), hdh-miR-31 (SEQ ID NO.20), novel_6 (SEQ ID NO.19)) in Table 4 and some target mRNAs (Saxo4 (SEQ ID NO.55), Tssk1B (SEQ ID NO.56), AR (SEQ ID NO.50), Verl (SEQ ID NO.47), Man2b1 (SEQ ID NO.31)) for qRT-PCR verification; wherein, the qRT-PCR experiment of mRNA uses β-actin gene expression as an internal reference control, and the qRT-PCR experiment of miRNA uses U6 gene as an internal reference control, and the gene-specific primer sequences are shown in Table 5. The U6 internal reference gene and universal reverse primer of miRNA were provided by the Mir-X miRNA First-Strand Synthesis Kit of TAKARA.

[0083] Table 5 Primer pairs for differentially expressed miRNA and mRNA

[0084] name Primer (5'-3') β-actin-qF (reference gene) GGTATCCTCACCCTCAAGT, SEQ ID NO.58 β-actin-qR (reference gene) GGGTCATCTTTTCACGGTTG, SEQ ID NO.59 Saxo4-qF GTTCAAGGGTCTTCGAGGCA, SEQ ID NO.60 Saxo4-qR CGTGAAATAACCGGGCTGCT, SEQ ID NO.61 Tssk1B-qF CCACCATTCTGACCATCCCT, SEQ ID NO.62 Tssk1B-qR CCTCCTTCTTCTTCCTCTCGG, SEQ ID NO.63 Q GAAAATGGGATCCTCGGCTG, SEQ ID NO.64 QUR TTACCCCTCACCGCTTGAAT, SEQ ID NO.65 Verl-qF GACTTCCGGGCCATCTGTAA, SEQ ID NO.66 Verl-qR ACGTTGGAGTTCTGTCTCCT, SEQ ID NO.67 Man2b1-qF GGAGGCTAAAGCGCTCATCA, SEQ ID NO.68 Man2b1-qR CCGAACTTTTGCTCAGCGTT, SEQ ID NO.69 hdh-miR-92 AATTGCACTTGTCCCGGCCTGC, SEQ ID NO.70 novel_1 AATTGCACTCGTCCCGGCCTGCAA, SEQ ID NO.71 hdh-miR-1994b TGAGACAGTGTGTCCTCCCTCA, SEQ ID NO.72 hdh-miR-31 AGGCAAGATGTTGGCATAGCT, SEQ ID NO.73 novel_6 TCGAGGAAGTAGAAGACCTTGACGT, SEQ ID NO.74

[0085] The method for amplifying and sequencing the differentially expressed mRNA and miRNA using the above primers is as follows:

[0086] The amplification reaction was carried out in a 25 μL reaction system. The amplification reaction system was: 10 μL 2xM5 HiPer SYBR Premix EsTaq (with Tli RNaseH), 2.5 μL cDNA (diluted 100 times), 0.5 μL forward and reverse primers (10 μM each), 9.5 μL nuclease-free water. The amplification reaction conditions were: 95°C for 30 s, 40 cycles of 95°C for 5 s, 60°C for 30 s; and the fluorescence signal intensity was recorded at the end of each cycle. 2 -ΔΔCT Methods The expression levels of differentially expressed mRNA and miRNA were quantified. Three groups of female and male abalone were independently tested, and each experiment was repeated three times. The instrument used was CFX96 Real-Time system (BIO-RAD, USA).

[0087] The experimental results are as follows Figure 6 As shown, the expression patterns of these miRNAs were consistent with the miRNA sequencing results, which indicated that miRNA sequencing analysis had high reliability.

[0088] (6) Fluorescence in situ hybridization (FISH)

[0089] In order to further verify the effectiveness of the mining method and sequencing results of the sex-differentially expressed miRNA and its target mRNA of the present invention, the present invention selected Verl (SEQ ID NO.47) and Tssk1B (SEQ ID NO.56) genes for FISH experiments to verify the expression and localization of Verl and Tssk1B genes in the gonads of female and male abalone. The FISH probe sequences of Verl and Tssk1B genes are shown in Table 6.

[0090] The specific steps of the FISH experiment are as follows:

[0091] 1) Fix the gonadal tissue (ovary and testis) of Haliotis discus hannai in in situ hybridization fixative (animal) for more than 12 hours at a storage temperature of 4°C;

[0092] 2) Dehydration and wax embedding: After tissue fixation, cut a tissue block of about 3 mm thick from the target area in a fume hood, dehydrate it with low to high gradient alcohol, make it transparent with xylene, and then embed it with wax;

[0093] 3) Paraffin sectioning and dewaxing to water: slice the paraffin block with a 4μm thick slicer, spread the slices with a slide spreader, and bake the slices in a 62° oven for 2h; then sequentially put the slices into environmentally friendly dewaxing transparent liquid I for 15min-environmentally friendly dewaxing transparent liquid II for 15min-anhydrous ethanol I for 5min-anhydrous ethanol II for 5min-85% alcohol for 5min-75% alcohol for 5min, and soak in DEPC water;

[0094] 4) Repair and digestion: According to the tissue type, fixation time and indicator location, different repair solutions are selected for repair. The specific repair conditions are shown in Table 6. After natural cooling, the tissue is circled. According to the characteristics of different indicators of different tissues, proteinase K (20ug / ml) is added at 40℃ for digestion. The digestion time is shown in Table 6. Then rinse with pure water and wash with PBS 3 times, 5 minutes each time.

[0095] 5) Prehybridization, hybridization and washing: add prehybridization solution and incubate at 37°C for 1 hour; then pour off the prehybridization solution, add probe-containing hybridization solution and hybridize overnight in a constant temperature box. The hybridization conditions are shown in Table 6; then wash away the hybridization solution. If there are many non-specific products, add formamide;

[0096] 6) Add the corresponding branch probe for hybridization and washing: Gently shake dry the slices, add the preheated corresponding branch probe hybridization solution (see Table 6) (60μL), and place horizontally in a wet box at 40℃ for hybridization for 45min. During this process, add 50ml2×SSC to the bottom of the wet box to prevent the slices from drying; then pour out the hybridization solution, and rinse the slices in 2×SSC, 1×SSC, 0.5×SSC, and 0.1×SSC preheated at 40℃ at 40℃ for 5min. Note: If there are many non-specific hybrids, you can increase the washing time and number of times and adjust the formamide concentration in the hybridization solution at this step;

[0097] 7) Add the corresponding signal probe: add the hybridization solution containing the signal probe (see Table 6) at a dilution ratio of 1:200, incubate at 40°C for 3 hours; then wash with the following SSC in sequence: 2×SSC, 40°C for 10 minutes; 1×SSC, 40°C for 2×5 minutes; 0.5×SSC, 40°C for 10 minutes;

[0098] 8) DAPI counterstaining of nuclei: DAPI staining solution was added to the slices, incubated in the dark for 8 minutes, and then anti-fluorescence quenching sealing agent was added to seal the slices after washing;

[0099] 9) Microscopic examination and photography: The sections were observed and images were collected under a Nikon upright fluorescence microscope (ultraviolet excitation wavelength 330-380 nm, emission wavelength 420 nm, blue light; FAM (488) green light excitation wavelength 465-495 nm, emission wavelength 515-555 nm, green light; CY3 red light excitation wavelength 510-560, emission wavelength 590 nm, red light).

[0100] Table 6 FISH probe information and repair conditions of Verl and Tssk1B genes

[0101]

[0102]

[0103] The experimental results are as follows Figure 7 , 8 As shown. Fluorescence microscopy images show that DAPI stains the nuclei of abalone gonad cells blue, and the Verl antisense probe expresses a strong positive signal (red fluorescence) in the gonads of mature female Haliotis discus ( Figure 7 ac), while a weak positive signal was expressed in the gonads of immature female Abalone discus hannai ( Figure 7 df); Tssk1B antisense probe expressed strong positive signals (green fluorescence) in the gonads of mature male Haliotis discus hannai ( Figure 8 ac), while a weak positive signal was expressed in the gonads of immature male Haliotis discus hannai ( Figure 8 df). The results showed that the Verl gene was highly expressed in mature female A. discus hannai and lowly expressed in the gonads of immature female A. discus hannai; the Tssk1B gene was highly expressed in mature male A. discus hannai and lowly expressed in the gonads of immature male A. discus hannai. The expression of Verl and Tssk1B genes was consistent with the actual results.

[0104] It can be seen that there is a strong correlation between the differentially expressed mRNA targeted by the sex-differentially expressed miRNA screened by the method provided by the present invention and the sexual maturity of abalone, which can accurately reflect the sexual maturity of abalone and has broad application prospects in the judgment of sexual maturity and gender identification of abalone.

[0105] The above embodiments are only preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A method for mining abalone sex differentially expressed miRNA and its target mRNA, characterized in that: The steps include: S1. Collection of abalone gonadal tissue and RNA extraction: RNA was extracted from the gonads of sexually mature female and male abalone, and cDNA libraries and sRNA libraries were constructed based on the extracted RNA; S2. Transcriptome sequencing of abalone gonadal tissue and screening of sex-differentially expressed mRNA: using transcriptome analysis technology to obtain the expression levels of each mRNA in the cDNA library of female and male abalone, respectively, and screening to obtain the sex-differentially expressed mRNA of the female and male abalone through a significance test of the difference in the expression levels of each mRNA in female and male abalone; wherein the criteria for the significance test are: P<0.05, |log2(Fold change)|≥10; S3. sRNA sequencing of abalone gonadal tissue and screening of sex-differentially expressed miRNAs: The expression levels of each miRNA in the sRNA libraries of female and male abalones were obtained by using sRNA analysis technology, and the sex-differentially expressed miRNAs of female and male abalones were screened by performing a significance test on the difference in expression levels of each miRNA in female and male abalones; wherein the criteria for the significance test were: P<0.05, |log2(Fold change)|≥2; S4. Mining target mRNAs of sex-differentially expressed miRNAs: For the sex-differentially expressed miRNAs obtained in step S3, psRobot and miRanda software were used to screen out the target mRNAs of the sex-differentially expressed miRNAs from the sex-differentially expressed mRNAs obtained in step S2, and the obtained target mRNAs were subjected to functional annotation and enrichment analysis of GO and KEGG databases, wherein GO enrichment and KEGG pathway enrichment were significantly enriched with P < 0.05; then Cytoscape software was used to construct and visualize the sex-differentially expressed miRNAs and their target mRNAs to obtain the target mRNAs of the sex-differentially expressed miRNAs.

2. The method for mining abalone sex differentially expressed miRNA and its target mRNA according to claim 1, characterized in that, The transcriptome analysis technique described in step S2 comprises the following steps: TopHat, Scripture and Cufflinks software were used to locate, functionally analyze and predict expression levels of high-quality sequence information in the cDNA library; HTSeq software was then used to analyze gene expression levels of the sequence information, and edgeR software was used to perform significance analysis of expression differences. According to the significance test criteria for expression level differences, the mRNA expressed by gender differences was screened out.

3. The method for mining abalone sex differentially expressed miRNA and its target mRNA according to claim 1, characterized in that, The specific steps of the sRNA analysis technique described in step S3 are as follows: Bowtie, mirdeep2, srna-tools-cli and miREvo software were used to locate, functionally analyze and predict the expression level of high-quality sequence information in the sRNA library respectively; then DESeq R software was used to perform expression difference significance analysis on the sequence information, and the miRNAs expressed differently by gender were screened according to the significance test criteria of the expression difference.

4. The method for mining abalone sex differentially expressed miRNA and its target mRNA according to claim 1, characterized in that, The validity verification method of the sequencing results of the sex-differentially expressed miRNA and its target mRNA includes: qRT-PCR experiment and fluorescence in situ hybridization (FISH) experiment.

5. The method for mining abalone sex differentially expressed miRNA and its target mRNA according to claim 4, characterized in that, The qRT-PCR experiment comprises the following steps: using the amplification primer set SEQ ID NO.58 to SEQ ID NO.74 to amplify the miRNA or its target mRNA expressed differently by gender; after amplification, using 2 -ΔΔCT The quantitative result analysis was performed by the method to calculate the relative expression amount between the miRNA or its target mRNA expressed in different sexes and the internal reference gene.

6. The method for mining abalone sex differentially expressed miRNA and its target mRNA according to claim 4, characterized in that, The FISH experiment comprises the following steps: using probes of SEQ ID NO.75 to SEQ ID NO.80 to examine the difference in expression of the target mRNA in the gonadal tissues of sexually mature and sexually immature female abalone or male abalone.

7. Abalone sex differentially expresses miRNA and its target mRNA, characterized in that: The gender differentially expressed miRNA and its target mRNA are obtained by the method of any one of claims 1 to 6; The gender-differentially expressed miRNA is any one of hdh-miR-133-3p, hdh-miR-1990, hdh-miR-1994a, hdh-miR-1994b, hdh-miR-2722, hdh-miR-31, hdh-miR-92, novel_1, novel_101, novel_120, novel_18, novel_19, novel_3, novel_32, novel_42, novel_53, novel_57, novel_6, novel_8, and novel_90, and its nucleotide sequence is shown in SEQ ID NO.1 to SEQ ID NO.20; the nucleotide sequence of the target mRNA of the gender-differentially expressed miRNA is shown in SEQ ID NO.21 to SEQ ID NO.57; as shown in Table 4, the gender-differentially expressed miRNA and its target mRNA have any one of the following corresponding relationships: Table 4 Gender differentially expressed miRNAs and their corresponding target mRNAs The sex-differentially expressed miRNA regulates the downregulation or upregulation of the expression level of its target mRNA in the gonads of female and male abalone by upregulating or downregulating its own expression level.

8. Using the abalone sex differentially expressed miRNA and its target mRNA obtained by any method as claimed in any one of claims 1 to 6 or the abalone sex differentially expressed miRNA and its target mRNA as claimed in claim 7 as molecular markers, and applying them to abalone sexual maturity assessment and sex identification.

Images