Preparation method of arch bridge type probe for CRISPR (clustered regularly interspaced short palindromic repeat) test strip

Abstract

The invention discloses a preparation method of an arch bridge type probe for a CRISPR (clustered regularly interspaced short palindromic repeats) test strip, and relates to the technical field of immunodetection analysis, the arch bridge type nucleic acid probe can be widely applied to test paper driven by CRISPR, and compared with traditional test paper, the arch bridge type nucleic acid probe has the advantages that the test efficiency is high; the CRISPR-driven test paper has the advantages that the nucleic acid sequence is easy to synthesize, the chemical and storage stability is higher, the detection specificity is high, antigen-antibody modification is avoided, the cost is low and the like, meanwhile, a new design idea is provided for CRISPR-driven test paper signal release, and the CRISPR-driven test paper has important significance in the technical field of immunodetection analysis.

Description

Technical Field

[0001] The present invention relates to a CRISPR / Cas-driven immunochromatographic probe, in particular to a method for preparing a CRISPR arch bridge probe, which belongs to the technical field of immunoassay analysis. Background Art

[0002] The CRISPR / Cas system is a long-evolved immune defense system commonly found in bacteria and archaea, which consists of clustered regularly interspaced short palindromic repeats (CRISPR) and associated proteins (Cas). Taking the most promising Cas12a as an example, it only contains a single RuvC domain and is guided into DNA targeting only by crRNA. Cas12a recognizes the T-rich protospacer adjacent motif (PAM) site through crRNA. After determining the PAM site, Cas12a cuts the target dsDNA at 37°C (cis) and produces sticky ends (5-7bp) near the PAM target site. After crRNA binds to the complementary target DNA chain, the cutting activity of Cas12a is stimulated, and it cuts any ssDNA in trans. Through the unique modification of the ssDNA reporter molecule, it produces a sensitive fluorescent signal, thereby completing the visual detection. Because it has high cutting efficiency, excellent signal secondary amplification ability, designed programmability and target identification specificity, it has become a revolutionary gene editing toolbox, widely used in gene editing, disease treatment and gene regulation, and has developed into a new weapon in the field of biosensing and molecular diagnosis.

[0003] In combining CRISPR system with immunochromatography technology, probe design is particularly important. Arch bridge probe design has many advantages in the field of biomolecule detection:

[0004] 1. Avoid trans-cleavage problems: In the CRISPR-Cas system, especially during detection using Cas12a, traditional probes may suffer from trans-cleavage, resulting in premature release or destruction of signal molecules, affecting detection sensitivity and specificity. The arch-bridge probe avoids this problem through its unique design, thereby improving detection reliability.

[0005] 2. New design idea for signal release: This design provides a new mechanism for the release of signal molecules, so that signal molecules can be effectively released under specific conditions (such as recognition of target DNA or RNA).

[0006] 3. Simplify the detection process: When combined with test paper technology, the arch bridge probe can eliminate the need to modify antibodies on the detection line and directly use the structural changes of the probe to achieve target capture and signal generation, simplifying the operation process and improving operational convenience.

[0007] 4. Reduce costs: By eliminating the expensive antibody modification step, this probe design significantly reduces material and production costs, making the detection technology more economical, especially for resource-limited environments.

[0008] 5. Versatility and customization: By modifying the probe end with different groups, the probe can be easily adjusted to adapt to different signal transduction pathways (such as fluorescence, chromatography, colorimetry, etc.), greatly expanding its application range on various detection platforms.

[0009] In general, the arch-bridge probe design, through its unique structure and mechanism, provides a new method for biomolecule detection that is efficient, economical and widely applicable, and is expected to promote the development and application of detection technology in multiple fields. Summary of the invention

[0010] The present invention can correspondingly provide a method for preparing a probe for a nucleic acid diagnostic test strip driven by the CRISPR / Cas system. Taking the specific sequence of foodborne pathogens as an example, based on colloidal gold immunochromatography combined with the high specificity of CRISPR technology, the economy and flexibility of the arch-bridge nucleic acid probe, the economical, rapid and accurate detection of the target can be achieved.

[0011] To achieve the above object, the technical solution adopted by the present invention is:

[0012] Arch bridge chain design: 5'—CCCCCCCTTTATTTCCCCCCC—3'

[0013] Hybridization chain design: 5'—GGGGGGGGGGGGGG—3'

[0014] Capture chain design: 5'—CCCCCCCCCCCCCCCC—3'×3

[0015] The 5' end of the hybrid chain is labeled with biotin, and the hybridization ratio of the hybrid chain to the arch bridge chain is optimal when it is 1:1.2. The TM value of the overall secondary structure formed by hybridization is not less than 37°C, and the TM values ​​of the nucleic acid chains on the left and right sides must be less than 37°C when hybridizing with the bubble structure as the center. The hybridization conditions of the arch bridge probe need to be carried out in a buffer system with a final concentration of 2×SSC, the hybridization water temperature is 95°C, and it is naturally cooled to room temperature after 5 minutes. After being placed at room temperature for 2 hours, it is stored at -20°C for use. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the specific implementation of the present invention or the technical solutions in the prior art, the drawings of the specific implementation are briefly introduced below. Obviously, the drawings in the following description are some implementations of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work. Among them:

[0017] Figure 1 A, B, C, and D are four arch bridge hybrid structure designs. The right picture is a schematic diagram of the side cut of the A structure for subsequent experiments.

[0018] Figure 2 Flow chart for detection

[0019] Figure 3 Schematic diagram of the reading of the test results of the arch bridge probe test paper

[0020] Figure 4 The detection sensitivity of the bridge probe test paper

[0021] Figure 5 The detection specificity of the bridge probe test paper DETAILED DESCRIPTION

[0022] To achieve the above-mentioned purpose, the technical solution adopted by the present invention is as follows. Specific implementation methods The present invention is further described below through specific embodiments, which is helpful for ordinary technicians in the field to more comprehensively understand the present invention, but does not limit the present invention in any way;

[0023] Embodiment 1:

[0024] Sequence selection and design of arch bridge probes. Experiments have found that when the arch bridge chain and the hybrid chain are too short, they cannot form a hybrid secondary structure. Therefore, the sequence length must be greater than 7 nt to form an attached DNA-DNA hybridization. Figure 1 Take the A structure as an example.

[0025] Arch bridge chain design: 5'—CCCCCCCTTTATTTCCCCCCC—3'

[0026] Hybridization chain design: 5'—GGGGGGGGGGGGGG—3'

[0027] Capture strand design: 5'—(CCCCCCCCCCCCCCCC)×3—3'

[0028] Embodiment 2:

[0029] Through experimental optimization, the bubble structure selected TTTATTT length of 7nt, and the Cas12a system had a more complete side cutting effect, which could better release the required hybrid chain.

[0030] Embodiment 3:

[0031] Arch bridge chain design: 5'—CCCCCCCTTTATTTCCCCCCC—3'

[0032] Hybridization chain design: 5'Biotin—GGGGGGGGGGGGGG—3'

[0033] Capture strand design: 5'—(CCCCCCCCCCCCCCCC)×3—3'

[0034] Combined with the length and bubble structure design, the 5' end of the hybrid chain is biotin-labeled. The TM value of the overall secondary structure formed by hybridization is not less than 37°C. When hybridizing with the bubble structure as the center, the TM values ​​of the nucleic acid chains on the left and right sides must be less than 37°C. Add 2×SSC hybridization buffer with a final concentration of 10 μm to the hybrid chain and the arch bridge chain at a ratio of 1:1.2 and place it in a 95°C water constant temperature heating device for reaction for 5 minutes, cool it naturally to room temperature, take out the water bath and place it at room temperature for 2 hours, then place it in a -20°C refrigerator for hybridization to complete the preparation of the arch bridge probe for use.

[0035] Embodiment 4:

[0036] Preparation of streptavidin-labeled gold nanoparticles: Take 1mL of 15nm colloidal gold solution in a clean ep tube, add an appropriate volume of 0.1M K2CO3 solution, mix while adding, and mix for 1min after all are added; identify the pH value with pH test paper, the pH value of the colloidal gold solution is about 7.5; add streptavidin to the above colloidal gold solution, mix while adding, so that the final streptavidin concentration is 5μg / mL; after the addition is complete, mix and react for 30min at room temperature; take 10% BSA blocking solution, add it to the above colloidal gold solution while shaking, so that the final BSA concentration is 1%, and place it at 4℃ for 30min; centrifuge the above colloidal gold solution and discard the supernatant, centrifuge at 4℃ and 12000rpm for 10min, wash twice with 10mM Tris-HCl buffer with pH 8, take 0.1mL colloidal gold solution (40mM Tris-HCl, 2% BSA, 2% sucrose, 0.2% pvp-k30, 0.2% PEG20000, pH = 8.0) to fully dissolve the colloidal gold precipitate and place it at 4°C for use; the nitrocellulose membrane needs to be coated with the corresponding capture material design on the detection line and quality control line, the detection line is the DNA capture chain, and the quality control line is the biotinylated BSA. μ After streaking at a rate of L / cm, dry at 37-45°C for 3-24 hours; the immune label needs to be modified by treating streptavidin with 13nm colloid at 5 μ g / mL complete labeling.

[0037] Coating nitrocellulose membrane: Lay the NC membrane on a flat acrylic plate, set the spacing of the scribing needles so that the distance between the C line and the T line is uniform and can be displayed in the card slot box, and perform 2-3 coatings at a scribing speed of 1μL / cm. The lines should be free of scattered points, breakpoints, water accumulation, and uneven thickness; check the integrity of the parameter settings and steps before and after scribing. The coating buffer is 20mM PBS, 3% trehalose pH 8, and the concentration of the DNA capture chain for T line coating is 50 μ m base motif (CCCCCCCCCCCCCC×3), the concentration of biotinylated BSA coated on line C was 125 μ g / mL; the machine parameters are set to 1μL / cm, 70mm / s and the film is drawn under 40%-50% relative humidity conditions. After completion, it is dried at 37°C for 18 hours and can be used.

[0038] Interpretation of experimental results: Preparation of Cas12a complex, add 100nM crRNA and 100nM Cas12a to NEB2.1 buffer, mix evenly and incubate at 30°C for 30 minutes; add the spare arch bridge probe with a final concentration of 1μM and the target, react for 20min, and then combine the test paper to interpret the results.

Claims

1. A method for preparing a CRISPR arch bridge probe, characterized in that: The arch bridge probe includes a hybridization strand and an arch bridge strand, and the nucleic acid fragment is not less than 7 nt. The preparation of the arch bridge probe can be formed by hybridization of a DNA sequence with an RNA sequence, or by hybridization of a DNA sequence with a DNA sequence, wherein the arch bridge chain needs to be a DNA fragment, and can form but is not limited to the four hybridization structures A, B, C, and D in Figure 1.

2. According to claim 1, a method for preparing a CRISPR arch bridge probe is characterized in that: When used in conjunction with the Cas12a system, the optimal base sequence of the bubble structure of the arch bridge chain is TTTATTT, and the sequence length is 7nt. The arch bridge probe design can avoid the trans-cutting of the release probe ssDNA by Cas12a, thereby opening up a new design idea for the release of the detection signal. By adding the arch bridge probe, the side-cutting signal of Cas12a after target activation can be converted into the combination of the release probe and the test paper capture probe, thereby generating the color signal aggregation of the tracer, and realizing the quantitative and qualitative analysis of the target by the intensity of the tracer signal change.

3. According to claim 1, a method for preparing a CRISPR arch bridge type probe is characterized in that: Functional groups such as biotin and fluorescence can be modified at both ends of the hybridization chain according to design selection and are not limited to them, so as to facilitate visual result interpretation in combination with portable test strips. The hybridization ratio of the hybridization chain to the arch bridge chain is optimal when it is 1:1.2, the TM value of the overall secondary structure formed by hybridization is not less than 37°C, and the TM values ​​of the left and right nucleic acid chains when hybridizing with the bubble structure as the center must be less than 37°C. The hybridization conditions of the arch bridge probe must be carried out in a buffer system with a final concentration of 2×SSC and a hybridization temperature of 95°C.

4. According to claim 1, a method for preparing a CRISPR arch bridge probe is characterized in that: The prepared arch bridge probe needs to be used in combination with the CRISPR system and test paper, and the tracer, quality control line (C line) and detection line (T line) of the test paper need to be treated accordingly.

Images