Primer for sex identification of male and female plants of kiwi fruit and kit and application thereof

Abstract

The invention provides a primer for sex identification of male and female plants of kiwi fruit and a kit and application of the primer and the kit, and belongs to the technical field of molecular biology. According to the invention, a pair of male specific primers Fr-1 is designed, so that the sex of the kiwi fruit can be well identified. Experimental results show that the Fr-1 primer has good repeatability and can quickly and accurately identify the gender of the kiwi fruit through PCR amplification, a universality verification result shows that the Fr-1 primer can efficiently and accurately distinguish different varieties of kiwi fruit male and female plants, errors are close to zero in the verification process, and it is indicated that the primer has high reliability and credibility. Meanwhile, the Fr-1 marker can amplify a specific band in the 'Huahong No.4' seedling, and a sample can be expanded in the later period for field test, so that the accuracy of the Fr-1 marker is ensured. Therefore, the primer and the method provided by the invention have relatively high practical application value and are suitable for large-scale popularization and application.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a primer for sex identification of male and female kiwifruit plants, a kit and an application thereof. Background Art

[0002] Kiwifruit (Actinidial chinensis Planch.), belonging to the genus Actinidia of the family Actinidia, is a perennial deciduous or semi-deciduous woody vine fruit tree. As the origin of kiwifruit, China is the main source of kiwifruit resources in the world. The main cultivated varieties in my country are Actinidia chinensis, Actinidia deliciosa and Actinidia arguta, and a few other types include Actinidia pubescens, Actinidia arborescens, and Actinidia dasyphylla.

[0003] Actinidia plants have the characteristics of dioeciousness, rich ploidy variation, and a long juvenile period of seedlings, which makes traditional breeding methods long and inefficient. As kiwifruit is a perennial vine plant, its dioecious nature makes gender identification important in its breeding process. Kiwifruit gender identification technology is applied to the screening of early seedlings, which can shorten the breeding time, save breeding costs, and improve breeding efficiency.

[0004] Recently, researchers have successfully identified and characterized two Y-linked sex-determining genes in Actinidia chinensis, namely SyGl and FrBy, and revealed the origin and evolution of the Y chromosome of kiwifruit, providing an important theoretical basis for a deeper understanding of the molecular mechanism of kiwifruit sex. However, although these studies have provided important clues for the analysis of the genetic basis of sex, in practical applications, the early identification methods of kiwifruit sex are still insufficient. Solving this problem can not only improve the efficiency of kiwifruit planting and management, but also provide a new research direction for genetic improvement and optimization of breeding strategies.

[0005] At present, some studies have attempted to identify sex through morphological observation, physiological and biochemical methods, and isozyme spectrum comparison. However, these methods are often affected by environmental factors, resulting in low accuracy and lack of universal applicability.

[0006] With the rapid development of molecular biology, molecular marker technology has gradually become the main means of identifying the sex of kiwifruit. The methods of identification using DNA molecular markers mainly include RAPD markers, AFLP markers, SSR markers, SRAP markers, SCAR markers, etc. In the identification process of different types of kiwifruit, due to the differences in their species, the identification methods used may have certain differences. Therefore, it is particularly important to choose a suitable identification method for a specific type of kiwifruit. Due to the genetic differences between different kiwifruit varieties, the identification methods used will also be different. Therefore, it is particularly important to choose a suitable identification method for a specific type of kiwifruit. At the same time, for the markers that have been screened and successfully identified, their universal verification is also an important step to improve the reliability of the identification results, but the current marker methods are still insufficient in universality.

[0007] Previous research on DNA molecular markers has mainly focused on the development and verification of kiwifruit sex molecular markers. LGFraser et al. discovered the SmY marker, which is a male-linked marker located in the sex-determining region of the chromosome, providing an important reference for kiwifruit sex identification. Guo Dandan verified the applicability of the SmY1 marker in Actinidia chinensis and Actinidia arguta, and found that SmY1 had a good sex identification effect in Actinidia chinensis, but not ideal in Actinidia arguta. Yao Chunchao et al. used RAPD technology to obtain the S1032 marker linked to the male gene, and verified its applicability in hybrid offspring, Actinidia chinensis and Actinidia dasyphylla. The results showed that the marker can effectively identify male individuals, but it exhibits certain specific fluctuations in some female individuals.

[0008] Therefore, there is an urgent need to provide a primer and labeling method for sex identification of male and female kiwifruit plants with high accuracy and good versatility, which has become a technical problem that needs to be solved. Summary of the invention

[0009] The present invention is to solve the above technical problems, thereby providing a primer for sex identification of male and female kiwifruit plants and a kit and application thereof. The technical purpose of the present invention is to solve the problem that the existing labeling method is not accurate enough when identifying the sex of male and female kiwifruit plants, and it can only be applied to a limited number of varieties, and the versatility of its detection results is poor. Therefore, the present invention provides a labeling method for sex identification of male and female kiwifruit plants with high identification accuracy and good versatility.

[0010] In order to achieve the above technical objectives, the technical solution adopted by the present invention is as follows:

[0011] One of the purposes of the present invention is to provide a primer for sex identification of male and female kiwifruit plants. The primer comprises a forward primer and a reverse primer. The sequence of the forward primer is 5'AGCCATCTCCAACACCACAG3', and the sequence of the reverse primer is 5'GCTCGGGATGAATAGGGTGG3'.

[0012] The second object of the present invention is to provide a kit for identifying the sex of male and female kiwifruit plants, which comprises the forward primer and reverse primer as described above.

[0013] Furthermore, the above-mentioned kit also includes detection reagents required for detecting various genes of male and female kiwifruit plants based on the PCR analysis method.

[0014] The third object of the present invention is to provide a detection method for identifying the sex of male and female kiwifruit plants, comprising the following steps:

[0015] (1) Extracting DNA from kiwifruit samples;

[0016] (2) using the primers described in the present invention to perform PCR amplification on the extracted sample DNA;

[0017] (3) Gel electrophoresis is performed to identify the sex of male and female kiwifruit plants.

[0018] Furthermore, the procedure of the PCR amplification is:

[0019] 1) Pre-denaturation: 94°C, 5 min;

[0020] 2) Denaturation: 94°C, 30s;

[0021] 3) Annealing: 56°C, 40s;

[0022] 4) Extension: 72°C, 2 min;

[0023] 5) Re-extension: 72°C, 5 min;

[0024] 6) Maintain at 4°C.

[0025] A fourth object of the present invention is to provide the use of the primers described above in sex identification of male and female kiwifruit plants.

[0026] A fifth object of the present invention is to provide the use of the above-mentioned kit in the sex identification of male and female kiwifruit plants.

[0027] The present invention uses Actinidia chinensis and Actinidia deliciosa as experimental materials, and systematically evaluates and verifies the reliability and applicability of the developed molecular markers for male and female kiwifruit, but the results show that the versatility of the existing molecular marker methods is poor. On this basis, the present invention designs 6 pairs of primers and screens out the most representative and applicable molecular markers. At the same time, the versatility is verified in different varieties to verify whether the marker can effectively distinguish between male and female kiwifruit plants, thereby achieving accurate gender identification. The present invention provides a molecular marker with wide applicability and accurate identification, thereby optimizing the kiwifruit gender identification technology. By improving the accuracy and efficiency of gender identification, it can provide efficient technical support for the early gender identification of kiwifruit, thereby improving breeding efficiency and providing a theoretical basis for subsequent breeding and production.

[0028] The beneficial effects of the present invention are as follows:

[0029] The present invention designs a series of primers, and after screening, a pair of male-specific primers Fr-1 is determined, which can well identify the sex of kiwifruit. The experimental results show that the Fr-1 primers have good repeatability and can quickly and accurately identify the sex of kiwifruit through PCR amplification. Further universal verification results show that the Fr-1 primers can efficiently and accurately distinguish male and female plants of different varieties of kiwifruit, and the error is close to zero during the verification process, indicating that the primers have a high degree of reliability and credibility. At the same time, the Fr-1 marker can amplify specific bands in the seedlings of 'Huahong No. 4', which has practical application value. In the later stage, the samples can be expanded for field trials to ensure its accuracy. In general, the Fr-1 primers not only have strong versatility, but also have a wide range of field application value, providing an efficient and reliable tool for kiwifruit sex identification, and laying a technical foundation for the development and industrial utilization of kiwifruit varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The DNA electrophoresis diagram of some kiwifruit samples, where: M is DNA Marker, and the material numbers correspond to Table 1.

[0031] Figure 2 The SmY1 marker amplification map of some kiwifruit samples, where M is DNA Marker and the material numbers correspond to Table 1.

[0032] Figure 3 The S1032 marker amplification map of some kiwifruit samples, where: M is DNA Marker, and the material numbers correspond to Table 1.

[0033] Figure 4 The FrBy marker amplification map of some kiwifruit samples, where: M is DNA Marker, and the material numbers correspond to Table 1.

[0034] Figure 5 The Fr marker amplification map of some kiwifruit samples, where M is DNA Marker and the material numbers correspond to Table 1.

[0035] Figure 6 The amplification map of Fr-1 marker in some kiwifruit samples, where: M is DNA Marker, and the material number corresponds to Table 1.

[0036] Figure 7 The amplification map of Fr-1 marker in other varieties of kiwifruit samples, where: M is DNA Marker, and the material number corresponds to Table 1.

[0037] Figure 8 The amplification map of Fr-1 marker in 'Huahong 4' seedlings, where: M is DNA Marker, and the material number corresponds to Table 1. DETAILED DESCRIPTION

[0038] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is described in detail below in conjunction with the embodiments. It is necessary to point out that the following embodiments are only used to explain and illustrate the present invention and are not used to limit the present invention. Some non-essential improvements and adjustments made by those skilled in the art based on the above invention content still belong to the protection scope of the present invention.

[0039] Example 1

[0040] 1. Experimental Materials and Methods

[0041] 1. Experimental materials and sources

[0042] 1. Plant materials

[0043] In June 2023, a total of 113 kiwifruit materials were collected at the kiwifruit research base in Guangji Town, Deyang City, Sichuan Province, as listed in Table 1. Among them, 89 male and female kiwifruit materials with known sex were collected and listed as serial numbers 1-89, including Chinese kiwifruit, delicious kiwifruit, soft-jujube kiwifruit, hairy kiwifruit and large-seed kiwifruit. At the same time, 24 seedlings of 'Huahong No. 4' with unknown sex were collected and listed as serial numbers 90-113. After the young leaves were picked, they were quickly frozen in liquid nitrogen, sampled and brought back, and stored in a -80℃ ultra-low temperature refrigerator for later use.

[0044] Table 1 Kiwifruit male and female plant materials used in this example

[0045]

[0046]

[0047]

[0048]

[0049]

[0050] Note: “-” represents unknown sample name or unknown gender.

[0051] 2. Main reagents

[0052] All organic reagents used were of analytical grade: anhydrous ethanol, chloroform (Chengdu Kelong Chemical Co., Ltd.), agarose, TAE, nucleic acid dye (Biosharp), DNA marker, loading buffer (GENERAY), PCR MasterMix (Shanghai Shengke).

[0053] 3. Main instruments

[0054] Electronic balance (BSA124S, Beijing Sartori Instrument Co., Ltd.); PCR instrument (Mastercycler nexus, eppendorf); high-speed centrifuge (Mcrofuge 20R, Fujian Langjian); electrophoresis instrument (DYY-6C, Beijing Liuyi); DNA spectrophotometer (Tnano-700, Tuohe); gel imager (Chemidoc xrs, Bio-rad); ice maker (IM-25, XUEKE); tissue grinder (LC-TC0-24, Lichen Technology).

[0055] (II) Experimental methods

[0056] 1. DNA extraction

[0057] After grinding plant tissues in liquid nitrogen, DNA was extracted from young kiwifruit leaves using the BIOFIT Plant Genomic DNA Extraction Kit. After extraction, the quality and purity of the DNA were measured by agarose gel electrophoresis and UV spectrophotometer, and stored in a -80°C ultra-low temperature refrigerator for later use.

[0058] 2. Collection of Kiwifruit Sex Molecular Markers

[0059] A total of three reported molecular markers related to sex in kiwifruit were collected, and their information is shown in Table 2. The estimated product size is 700-867 bp.

[0060] Table 2. Collected information on male and female marking of kiwifruit

[0061]

[0062] 3. Primer design and synthesis

[0063] A total of 22 pairs of primers were designed by comparing the gene sequence of FrBy with Primer3.0 and NCBI Primer. The list of all primers is shown in Table 3. After screening, 6 pairs of primers were finally determined. The specific information is shown in Table 4.

[0064] Table 3 Information of 22 pairs of kiwifruit male and female primers designed

[0065]

[0066]

[0067]

[0068] Table 4 Information of male and female primers screened for kiwifruit

[0069]

[0070] 4. PCR amplification system

[0071] The above six pairs of primers were preliminarily screened using test materials of known gender, and then the samples were expanded for secondary screening, and the primers with good amplification effect, clear bands and good repeatability in all samples were selected for subsequent amplification of all samples. The annealing temperature of the primers was floated up and down, several gradients were set, and the test was repeated three times. Based on the results of the three tests, a stable annealing temperature was selected as the optimal temperature of the primers. The specific amplification procedure is shown in Table 5.

[0072] Table 5 PCR amplification program

[0073]

[0074] 2. Experimental Results and Analysis

[0075] 1. DNA extraction

[0076] Extract genomic DNA from 72 kiwifruit samples of known sex and one seedling. The quality of some DNA extractions is shown in Figure 1 , it can be seen that there is no tailing in the lane, indicating that the DNA is intact and has a high concentration and can be used for PCR amplification.

[0077] 2. Establishment and universal verification of SmY1 marker amplification system

[0078] The SmY1 marker was amplified in 8 male and female kiwifruit samples, of which the first 4 samples were female plants and the last 4 samples were male plants. The results are as follows: Figure 2 .from Figure 2It can be seen that no specific bands were amplified in the four female samples; among the four male samples, only sample 24 amplified a specific band, which was consistent with the expected marker band position, and the identification accuracy was 25%. The results showed that the SmY1 marker performed poorly, which was inconsistent with the previous report that SmY1 was a male-specific marker. The comprehensive analysis results showed that this marker could not be used for kiwifruit sex identification and the primers were not specific.

[0079] 3. Establishment and universal verification of S1032 marker amplification system

[0080] The S1032 marker was amplified in 8 male and female kiwifruit samples. Similarly, the first 4 samples were female plants and the last 4 samples were male plants. The results are as follows: Figure 3 No specific bands were amplified in the four female samples and the four male samples. This is inconsistent with previous studies that showed that S1032 is a male-specific marker and only appears in male samples. The comprehensive analysis results showed that this marker cannot be used for kiwifruit sex identification and the primers are not specific.

[0081] 4. Establishment and universal verification of FrBy marker amplification system

[0082] The FrBy marker was amplified by PCR in 8 male and female kiwifruit samples, of which the first 4 were female plants and the last 4 were male plants. The experimental results are as follows: Figure 4 As shown. In the 4 female samples, no specific bands were amplified; and in the 4 male samples, only sample 25 successfully amplified a specific band that was consistent with the expected marker band position. The comprehensive analysis results showed that the FrBy marker performed poorly in this experiment and failed to stably amplify sex-specific bands in all samples. Therefore, the FrBy marker does not have sufficient sex identification specificity and cannot be widely used in kiwifruit sex identification.

[0083] 5. Establishment and universal verification of Fr marker amplification system

[0084] By using Primer3.0 and NCBI Primer to compare the FrBy gene sequence, the 22 pairs of primers designed in Table 3 were named Fr series. After screening, it was found that 18 pairs of primers had unclear or no bands. Finally, 6 pairs of primers (see Table 4) were selected for subsequent experiments. In order to evaluate the amplification effect of these primers, PCR amplification was performed on 8 kiwifruit samples, of which the first 4 were female plants and the last 4 were male plants. The experimental results are shown in Figure 4. Figure 5 shown.

[0085] from Figure 5It can be seen that the six pairs of primers in the Fr series all produced 1 to 7 fragments after amplification, and the size of the DNA fragments ranged from 100 to 1000 bp. Specifically, the Fr-1 primer failed to amplify specific bands in 4 female samples, but amplified specific bands of about 550 bp in 4 male samples, indicating that Fr-1 can effectively distinguish between male and female plants. Therefore, Fr-1 will be selected for sex identification amplification in subsequent experiments. In contrast, Fr-2, Fr-3, Fr-4, Fr-5, and Fr-6 amplified multiple bands in 8 samples, and the band patterns were irregular, so they were no longer candidate primers for subsequent experiments.

[0086] 4. Further verification of Fr-1 marker in all samples

[0087] In order to further verify whether Fr-1 can be used for kiwifruit sex identification, PCR amplification was performed on all the collected kiwifruit and Actinidia deliciosa samples. The results are as follows: Figure 6 .Depend on Figure 6 It can be seen that no bands were amplified in 48 female samples, while bands were amplified in 24 male samples, and the size was consistent with the expected product. Therefore, it can be seen that Fr-1 has a 100% accuracy rate in kiwifruit sex identification, which has been fully verified in Chinese kiwifruit and delicious kiwifruit, and can be well used for kiwifruit sex identification.

[0088] 5. Verification of the universality of Fr-1 markers in different varieties

[0089] Considering that the designed primers should have universal applicability, the Fr-1 marker was then applied to the identification of other varieties of kiwifruit plants and seedlings for universal verification (samples are shown in Table 1). The experimental results are as follows Figure 7 . The analysis results showed that specific bands could be amplified in the 6 male kiwifruit samples of other varieties, while no bands were amplified in the remaining 13 female samples. This indicates that the Fr-1 marker can successfully amplify stable bands in male samples of other varieties, but no bands can be amplified in female samples, and the band size is the same as the expected size, which is consistent with the results of previous studies, indicating that Fr-1 can be accurately used for sex identification.

[0090] 6. Application of Fr-1 marker for seedling identification

[0091] 'Huahong 4' is the world's first tetraploid red-fleshed female kiwifruit variety. The Fr-1 marker was applied to the identification of 'Huahong 4' seedlings. The sample information is shown in Table 1. The identification results are shown in Figure 8 .Depend on Figure 8It can be seen that among the 24 seedling samples, 12 materials were able to amplify specific bands, and the band size was the same as the expected size. The results showed that the Fr-1 marker can amplify stable bands in seedlings and has certain application value in the identification of seedlings.

[0092] Conclusion

[0093] Kiwifruit is a dioecious crop with high economic value. In the development of the industry, the economic value and market demand of female plants are significantly higher than those of male plants. With the advancement of molecular biology technology, kiwifruit sex identification has gradually shifted from traditional morphological identification to molecular marker identification. In particular, through primer design and molecular markers, accurate sex identification can be achieved in the early growth stage of kiwifruit, providing important support for subsequent breeding work. In this study, it was first confirmed that the SmY1 marker had an unsatisfactory identification effect in delicious kiwifruit, indicating that the applicability of the marker was easily affected by kiwifruit varieties; the S1032 marker could not amplify the corresponding specific band; although the FrBy marker was a candidate gene for sex determination, its accuracy was found to be low in practical applications.

[0094] The present invention has designed a series of primers, and after screening, a pair of male-specific primers Fr-1 was determined, which can be used to identify the sex of kiwifruit. The experimental results show that the Fr-1 primers have good repeatability and can quickly and accurately identify the sex of kiwifruit through PCR amplification. Further universal verification results show that the Fr-1 primers can efficiently and accurately distinguish male and female plants of different varieties of kiwifruit, and the error is close to zero during the verification process, indicating that the primers have a high degree of reliability and credibility. At the same time, the Fr-1 marker can amplify specific bands in the seedlings of 'Huahong No. 4', which has practical application value. In the later stage, the samples can be expanded for field trials to ensure its accuracy. In general, the Fr-1 primers not only have strong versatility, but also have a wide range of field application value. It provides an efficient and reliable tool for kiwifruit sex identification and lays a technical foundation for the development and industrial utilization of kiwifruit varieties.

Claims

1. A primer for sex identification of male and female kiwifruit plants, characterized in that: The primers include a forward primer and a reverse primer. The sequence of the forward primer is: 5'AGCCATCTCCAACACCACAG3', and the sequence of the reverse primer is: 5'GCTCGGGATGAATAGGGTGG3'.

2. A kit for identifying the sex of male and female kiwifruit plants, characterized in that: The method comprises the forward primer and the reverse primer according to claim 1.

3. The kit for sex identification of kiwifruit male and female plants according to claim 2, characterized in that: It also includes the detection reagents required for detecting each gene of male and female kiwifruit plants based on the PCR analysis method.

4. A detection method for identifying the sex of male and female kiwifruit plants, characterized in that: The following steps are involved: (1) Extracting DNA from kiwifruit samples; (2) performing PCR amplification on the extracted sample DNA using the primers described in claim 1; (3) Gel electrophoresis is performed to identify the sex of male and female kiwifruit plants.

5. The detection method according to claim 4, characterized in that: The procedure of the PCR amplification is: 1) Pre-denaturation: 94°C, 5 min; 2) Denaturation: 94°C, 30s; 3) Annealing: 56°C, 40s; 4) Extension: 72°C, 2 min; 5) Re-extension: 72°C, 5 min; 6) Maintain at 4°C.

6. Use of the primers described in claim 1 in sex identification of male and female kiwifruit plants.

7. Use of the kit according to claim 2 or 3 in sex identification of male and female kiwifruit plants.

Images