Weed rice strong germination potential gene molecular marker and application thereof in improving emergence rate

Abstract

The invention relates to the technical field of rice, and discloses a weedy rice strong germination potential gene molecular marker and application thereof to improvement of the emergence rate, and the weedy rice strong germination potential gene molecular marker comprises the following steps: design of a genotyping KASP primer, DNA extraction of a test rice sample, PCR amplification, fluorescence signal detection and sample OsGF14h genotyping based on the fluorescence signal. Based on the advantages of high throughput, high sensitivity, high accuracy and the like of a KASP molecular marker technology, large-scale accurate identification of hypoxia germination and seedling establishment capability of a large number of varieties and germplasm resources can be realized. In breeding, hybridization and segregation generations, foreground selection of the hypoxia-tolerant germination gene OsGF14h is carried out in a high-throughput manner, and the breeding process of direct-seeding-tolerant rice varieties is accelerated. The technical problem of large-scale high-throughput targeted improvement of low-oxygen germination resistance of direct-seeding rice is solved.

Description

Technical Field

[0001] The invention relates to the technical field of rice, in particular to a molecular marker of a weedy rice strong germination potential gene and an application thereof in improving the emergence rate. Background Art

[0002] Direct seeding of rice does not require seedling raising and transplanting, but directly sows seeds in the field, so it is a light, efficient and water-saving cultivation method. Hypoxia stress is the main factor limiting the seedling formation of direct-seeded rice seeds, so cultivating varieties with hypoxia tolerance is one of the effective ways to promote the development of direct-seeded rice. The development of molecular markers for hypoxia-tolerant germination genes is of great significance for the molecular genetic improvement of direct-seeded rice. At present, genes with potential for genetic improvement of hypoxia germination of direct-seeded rice include OsGF14h, OsCBL10, OsTPP7 and OsUGT75A. The above genes have not yet been used on a large scale in molecular breeding.

[0003] At present, direct-seeded rice variety improvement with the goal of improving germination tolerance to hypoxia still uses the traditional method of artificial performance selection of hybrid progeny, which limits the accuracy of targeted improvement of hypoxia germination, low breeding efficiency, and high labor and land costs. At the same time, since the development of high-throughput molecular markers for hypoxia germination-related genes such as OsGF14h, OsCBL10, OsTPP7, and UGT75A is still blank, their efficient and large-scale development in genetic improvement of direct-seeded rice tolerance to hypoxia germination is limited; in view of this, we proposed a molecular marker for a strong germination potential gene of weedy rice and its application in improving seedling emergence rate. Summary of the invention

[0004] The object of the present invention is to provide a molecular marker of a weedy rice strong germination potential gene and its application in improving the emergence rate, so as to solve the problems raised in the above background technology.

[0005] To achieve the above object, the present invention provides the following technical solution: a molecular marker of a weedy rice strong germination potential gene and its application in improving the emergence rate, comprising the following steps:

[0006] S1, design of KASP primers for OsGF14h (LOC_Os11g39540) genotyping;

[0007] S2, DNA extraction and purification of test rice samples;

[0008] S3, PCR amplification;

[0009] S4, fluorescence signal detection;

[0010] S5. OsGF14h genotyping of samples based on fluorescence signals.

[0011] Optionally, the S1 further includes:

[0012] Three primers are used, two of which are specific front primers with different fluorescent groups targeting different bases of a specific allele, and the third is a universal back primer.

[0013] Optionally, the S2 further comprises:

[0014] Extract genomic DNA from target rice leaves, ensure the purity and quality of the DNA and dilute it to 5-50 ng / ul; use ULTRPAGE for primer purification, dilute the specific primer concentration to 36uM, and the R primer concentration to 90uM. Mix the three primers in a volume ratio of 1:1:1 to form a primer mix.

[0015] Optionally, the S3 further includes:

[0016] Using purified DNA as template, PCR amplification reaction was performed using OsGF14h KASP primers. In the PCR reaction, universal primers bind to all alleles, while specific primers only bind to target alleles. Universal primers and specific primers amplify simultaneously, and the competition between specific primers determines the final amount of PCR product.

[0017] Optionally, the S4 further includes:

[0018] S41, using the principle of fluorescence resonance energy transfer, each allele-specific primer has a different fluorescent label;

[0019] S42. When PCR amplification occurs, the fluorescently labeled primers will bind to the corresponding fluorescence quencher. When the primers are extended and bind to the template, the fluorescence signal is enhanced.

[0020] S43. After amplification, use fluorescent quantitative PCR to read the band. The reading program is 25℃, 5s+Plate Read;

[0021] S44. After the band reading is completed, select the fluorescence type FAM, VIC, and choose Allelic Discrimination for analysis.

[0022] Optionally, the S5 further includes:

[0023] S51. The experimental results were analyzed using lgcgenomic software. According to the difference in fluorescence signals, the rice samples were divided into different genotypes of OsGF14h, including the type with weak hypoxia germination ability and the type with strong hypoxia germination tolerance;

[0024] The KASP typing results of some samples were further verified by sanger sequencing;

[0025] S52. In the segregating population constructed with functional OsGF14h rice varieties and non-functional OsGF14h rice varieties as parents, 30 functional OsGF14h type offspring samples with KASP typing of T:T, 15 non-functional OsGF14h type offspring samples with KASP typing of A:A, and 2 heterozygous type offspring samples with KASP typing of T:A were detected.

[0026] Compared with the prior art, the present invention provides a molecular marker for a weedy rice strong germination potential gene and its application in improving the emergence rate, which has the following beneficial effects:

[0027] The application of the molecular marker of the strong germination potential gene of weedy rice and its improved emergence rate is aimed at the reality that the rice hypoxia-resistant germination gene has not been widely used in molecular breeding. The present invention takes the natural variation gene OsGF14h related to hypoxia germination ability as the target gene for molecular genetic improvement, and designs and develops KASP type high-throughput molecular markers. Based on the advantages of high throughput, high sensitivity, and high accuracy of KASP molecular marker technology, it can realize large-scale and accurate identification of hypoxia germination and seedling establishment ability of a large number of varieties and germplasm resources. In the breeding hybridization separation generation, high-throughput selection of the prospects of the hypoxia-resistant germination gene OsGF14h is carried out to accelerate the breeding process of rice direct-seeding resistant varieties. Solve the technical problem of large-scale high-throughput targeted improvement of direct-seeding rice hypoxia germination resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The figure is a schematic diagram of KSAP genotyping of 65 approved rice varieties and germplasm resources OsGF14h of the present invention;

[0029] Figure 2 This is a schematic diagram of the Sanger sequencing results of the samples of the present invention;

[0030] Figure 3 The figure is a schematic diagram of KSAP genotyping of 47 hybrid segregating populations OsGF14h of the present invention. DETAILED DESCRIPTION

[0031] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] like Figure 1-Figure 3 As shown, the present invention provides a technical solution: a molecular marker of a weedy rice strong germination potential gene and its application in improving the emergence rate, comprising the following steps:

[0033] S1. Design of KASP primers for genotyping of OsGF14h (LOC_Os11g39540). Three primers are used, two of which are specific front primers with different fluorescent groups for different bases of specific alleles, and the third is a universal back primer. The KASP primers of the OsGF14h gene can be used to identify genotypes that are highly correlated with the hypoxia germination and seedling establishment ability of rice. The dominant OsGF14h allele in the certified rice varieties and germplasm resources can be determined quickly and accurately. In the breeding hybridization separation generation, the prospect selection of the hypoxia-resistant germination gene OsGF14h is carried out in a high-throughput manner to accelerate the breeding process of rice varieties resistant to direct seeding. Solve the technical difficulties of large-scale high-throughput targeted improvement of direct-seeding rice for hypoxia germination resistance;

[0034]

[0035]

[0036] Two specific primers were designed for the functional variation sites of the OsGF14h gene, with FAM and VIC fluorescence label sequences added respectively:

[0037] K3-FAM:GAAGGTGACCAAGTTCATGCTCTCTCAGGAGAGTTCATTATCTCAA (non-functional type)

[0038] K3-VIC:GAAGGTCGGAGTCAACGGATTCTCTCAGGAGAGTTCATTATCTCAT (functional type)

[0039] K3-R:GGCCTTGCGCTCAACTTTTCAGTCTT

[0040] S2. DNA extraction and purification of test rice samples: Extract genomic DNA from target rice leaves, ensure the purity and quality of DNA and dilute to 5-50ng / ul. Primer purification method uses ULTRPAGE, dilute the concentration of specific primer to 36uM, and the concentration of R primer to 90uM. The three primers are mixed in a volume ratio of 1:1:1 to form a primer mix; the reaction system is as follows:

[0041] component volume(ul) DNA 5 KASP PCR MIX 5 Primer mix 0.14

[0042] S3. PCR amplification: Using the purified DNA as a template, the OsGF14h KASP primers were used for PCR amplification. In the PCR reaction, the universal primers bind to all alleles, while the specific primers only bind to the target alleles. The universal primers and specific primers are amplified simultaneously, and the competition between them determines the final amount of PCR products; the reaction conditions are:

[0043]

[0044] S4, fluorescence signal detection, using the principle of fluorescence resonance energy transfer (FRET), each allele-specific primer has a different fluorescent label. When PCR amplification occurs, the fluorescent labeled primer will bind to the corresponding fluorescence quencher. When the primer is extended and binds to the template, the fluorescence signal is enhanced. After the amplification is completed, use fluorescent quantitative PCR to read the band. The reading program is 25℃, 5s+Plate Read. After the reading is completed, select the fluorescence type FAM, VIC, and select AllelicDiscrimination for analysis;

[0045] S5. OsGF14h genotyping of samples based on fluorescence signals.

[0046] S51. The experimental results were analyzed using lgcgenomic software. According to the different fluorescence signals, rice samples can be divided into different genotypes of OsGF14h, including those with weak hypoxia germination ability and those with strong hypoxia germination tolerance. Figure 1 As shown, the present invention has identified the genotype of OsGF14h in 65 approved rice varieties and germplasm resources. 29 rice samples were identified as OsGF14h functional type (KASP typing is T:T red mark), 35 rice samples were identified as OsGF14h non-functional type (KASP typing is A:A blue mark), and 1 sample was determined to be NTC type without template control. The KASP typing results of some samples were further verified by sanger sequencing;

[0047] S52. In the segregating population constructed with functional OsGF14h rice varieties and non-functional OsGF14h rice varieties as parents, 30 functional OsGF14h type offspring samples with KASP typing of T:T, 15 non-functional OsGF14h type offspring samples with KASP typing of A:A, and 2 heterozygous type offspring samples with KASP typing of T:A were detected, which effectively assisted the prospect selection of the hypoxia-resistant germination gene OsGF14h in hybrid breeding offspring and accelerated the breeding process of direct-seeding varieties.

[0048] The above generally describes the present invention in detail, but it is obvious to a person skilled in the art that some modifications or improvements can be made to the present invention. Therefore, modifications or improvements that do not depart from the spirit of the present invention are within the scope of protection of the present invention.

Claims

1. A molecular marker for a weedy rice strong germination potential gene and its application in improving the emergence rate, characterized in that: The steps include: S1, design of KASP primers for OsGF14h (LOC_Os11g39540) genotyping; S2, DNA extraction of test rice samples; S3, PCR amplification; S4, fluorescence signal detection; S5. OsGF14h genotyping of samples based on fluorescence signals.

2. The molecular marker of the strong germination potential gene of weedy rice and its application in improving the emergence rate according to claim 1, characterized in that: Said S1 further comprises: Three primers are used, two of which are specific front primers with different fluorescent groups targeting different bases of a specific allele, and the third is a universal back primer.

3. The molecular marker of the strong germination potential gene of weedy rice and its application in improving the emergence rate according to claim 1, characterized in that: The S2 further comprises: Extract genomic DNA from target rice leaves, ensure the purity and quality of the DNA and dilute it to 5-50 ng / ul; use ULTRPAGE for primer purification, dilute the specific primer concentration to 36uM, and the R primer concentration to 90uM. Mix the three primers in a volume ratio of 1:1:1 to form a primer mix.

4. The molecular marker of a weedy rice strong germination potential gene and its use in improving the emergence rate according to claim 1, characterized in that: The S3 further comprises: Total DNA was used as a template and OsGF14h KASP primers were used for PCR amplification reaction. In the PCR reaction, universal primers bind to all alleles, while specific primers only bind to target alleles. Universal primers and specific primers amplify simultaneously, and the competition between specific primers determines the final amount of PCR product.

5. The molecular marker of a weedy rice strong germination potential gene and its use in improving the emergence rate according to claim 1, characterized in that: The S4 further comprises: S41, using the principle of fluorescence resonance energy transfer, each allele-specific primer has a different fluorescent group; S42. When PCR amplification occurs, the fluorescently labeled primers will bind to the corresponding fluorescence quencher. When the primers are extended and bind to the template, the fluorescence signal is enhanced. S43. After amplification, use fluorescent quantitative PCR to read the band. The reading program is 25℃, 5s+Plate Read; S44. After the band reading is completed, select the fluorescence type FAM, VIC, and choose Allelic Discrimination for analysis.

6. The molecular marker of a weedy rice strong germination potential gene and its use in improving the emergence rate according to claim 1, characterized in that: The S5 further comprises: S51. The experimental results were analyzed using lgcgenomic software. According to the difference in fluorescence signals, the rice samples were divided into different genotypes of OsGF14h, including the weak hypoxia germination ability type and the hypoxia germination strong function type; The KASP typing results of some samples were further verified by sanger sequencing; S52. In the segregating population constructed with functional OsGF14h rice varieties and non-functional OsGF14h rice varieties as parents, 30 functional OsGF14h type offspring samples with KASP typing of T:T, 15 non-functional OsGF14h type offspring samples with KASP typing of A:A, and 2 heterozygous type offspring samples with KASP typing of T:A were detected.

Images