SNP (Single Nucleotide Polymorphism) molecular marker related to oil content character of sesame seed and application

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the oil content character of sesame seeds and application, and belongs to the technical field of sesame biology. The SNP molecular marker is located at the position of 3669198bp on a fifth chromosome of a sesame genome; the basic group of the SNP molecular marker is A or G. According to the SNP molecular marker related to the oil content character of the sesame seeds and the application, genotype detection can be carried out in the seedling stage, a single plant with a breeding target can be screened, blind removal of excellent materials due to conditions such as seedling thinning is avoided, excellent offspring can be reserved as many as possible, and the breeding efficiency is improved.

Description

Technical Field

[0001] The invention relates to the field of sesame biotechnology, and in particular to a SNP molecular marker related to the oil content trait of sesame seeds and an application thereof. Background Art

[0002] Sesame oil is the most popular oil in my country and even in the world. Its raw material, sesame, also occupies an important position in my country's traditional culture. For example, "Sesame flowers bloom higher and higher" is an auspicious phrase that everyone in my country knows and says. "Lost the watermelon to pick up sesame seeds" and "Sesame official" not only truly reflect the "smallness" of sesame seeds, but also illustrate the difficulties in sesame breeding and high-yield variety improvement. Sesame is a healthy and special oil crop widely planted in the world. It has an oil content of up to 55% and is known as the "Queen of Oils". my country has made important contributions to the development of the global sesame industry (Wang Ruiyuan. China has made important contributions to the development of the global sesame industry [J]. China Oils and Fats, 2019.44(12):1-2).

[0003] The oil content in sesame seeds accounts for 48% to 62% of the dry weight of the seeds, mainly composed of saturated fatty acids and unsaturated fatty acids, including unsaturated fatty acids, oleic acid and linoleic acid, saturated fatty acids such as palmitic acid, stearic acid and arachidic acid (Wang Xuede, Cui Yingde, Liu Ribin, et al. Determination and correlation analysis of fatty acid composition in sesame seeds [J]. China Oils and Fats, 2016, 41(1): 95-99.), of which oleic acid and linoleic acid are the main ones, accounting for about 85% of the total fatty acids (Li Xiaodan, Xiao Ling, Wu Gang, et al. Study on fatty acid accumulation pattern during sesame seed development [J]. Chinese Journal of Oil Crops, 2008, 30(1): 84-89. Zhou Yong, Liu Pan, Li Donghua, et al. Cloning and functional verification of sesame stearate desaturase gene SiSAD [J]. Chinese Agricultural Science, 2019, 52(10): 1678-1685.). The content and composition ratio of saturated fatty acids and unsaturated fatty acids directly affect the quality of sesame oil. Oleic acid is a monounsaturated fatty acid with high oxidative stability. High oleic acid products have a longer shelf life. Oleic acid has higher nutritional value and can reduce low-density cholesterol and human blood lipid levels, thereby effectively preventing the occurrence of cardiovascular and cerebrovascular diseases (Wang Jingzi, Xu Guifa. Relationship between monounsaturated fatty acids and coronary heart disease [J]. Food and Drug, 2005, 7: 21-23.). Linoleic acid is an essential fatty acid for the human body. It can prevent arteriosclerosis, reduce cholesterol accumulation in the blood, and inhibit cancer. However, its oxidative stability is not as good as oleic acid (Cao Shuwen, Yu Yanying, Wen Huiliang, et al. Study on the anti-breast cancer activity of conjugated linoleic acid isomers [J]. Journal of Nutrition, 2001, 23 (1): 28-31.). Improving fatty acid components through molecular breeding methods to make the composition, content and ratio of fatty acids more reasonable is one of the main goals of sesame variety improvement. Sesame oil content and fatty acid component content are quantitative traits controlled by multiple genes. Through hybridization between different parents, germplasm materials with high oil content and other high-quality traits can be created.

[0004] With the publication of sesame reference genome sequence information and the construction of sesame genetic linkage map, QTL analysis and gene discovery of important agronomic traits of sesame, including oil content, have been carried out (Wang L, Yu S, Tong C, et al. Genome sequencing of the high oil crop sesame provides insight into oil biosynthesis [J]. Genome Biol, 2014, 15 (2): R39.). Wei Wenliang et al. conducted an oil content association analysis of 216 core sesame varieties and repeatedly detected 8 molecular markers in two years. The total variation explanation rate was 28.46% and 38.01%, and the variation explanation rate ranged from 2.95% to 6.03%. Another 15 molecular markers were only detected in one year environment, and the variation explanation rate ranged from 3.06% to 5.18% (Wei Wenliang, Zhang Yanxin, Lv Haixia, et al. Analysis of the association between sesame resource population structure and oil content [J]. Chinese Agricultural Science, 2012, 45 (10): 1895-1903). Wu Kun et al. detected sesame quality traits in a RIL population containing 224 strains and obtained 5 QTLs related to oil content, which were distributed on linkage groups LG1, LG2, LG5, LG9 and LG16, and could explain 6.5% to 10.1% of the phenotypic variation (Wu Kun, Wu Wenxiong, Yang Minmin, et al. QT localization analysis of oil, protein and sesamin contents in white sesame seeds [J]. Acta Agronomica Sinica, 2017, 43(7): 1003-1011). Zhou Yong et al. constructed a RIL population containing 548 strains using Zhongzhi 13 and ZZM2748 as parents. By analyzing the content of oil, oleic acid, linoleic acid, palmitic acid and stearic acid in the population under different environments, a total of 50 QTLs were detected that were significantly correlated with the above five quality traits (Zhou Yong, Xu Fangtao, Sheng Chen, et al. QTL Analysis of Sesame Oil and Fatty Acid Content [J]. Chinese Journal of Oil Crops, 2021, 43(6): 1042-1051). Overall, there are still few studies on sesame oil content and fatty acid related gene loci. The genetic improvement of sesame oil content and fatty acids remains at the level of conventional breeding technology. The lack of oil content and fatty acid gene loci and molecular markers has restricted the breeding process. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to the oil content trait of sesame seeds and its application to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is a SNP molecular marker related to the oil content trait of sesame seeds, wherein the SNP molecular marker is located at 3669198bp on chromosome 5 of the sesame genome; the reference gene version is Sesamum_indicum:Zhongzhi13_v2.0;

[0008] The base of the SNP molecular marker is A or G.

[0009] The second technical solution of the present invention is a method for identifying the oil content of sesame seeds using the SNP molecular marker, detecting the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the sesame genome DNA to be identified, and the oil content of sesame seeds with genotype AA is significantly higher than that of individuals with genotype GG.

[0010] The third technical solution of the present invention is the application of the SNP molecular marker in the breeding of traits related to oil content in sesame seeds.

[0011] A fourth technical solution of the present invention is the use of the SNP molecular marker in identifying or assisting in identifying traits related to oil content in sesame seeds.

[0012] A fifth technical solution of the present invention is the use of the SNP molecular marker in the preparation of products for identifying or assisting in identifying traits related to oil content in sesame seeds.

[0013] Based on the above technical solution, the present invention has the following technical effects:

[0014] The present invention provides a SNP molecular marker related to the oil content trait of sesame seeds and its application, which can be used for genotype detection at the seedling stage to screen individual plants with breeding targets, avoid blindly eradicating excellent materials due to seedling thinning, thinning and other conditional operations, retain as many excellent offspring as possible, and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0016] Figure 1 Results of QTL mapping.

[0017] Figure 2 The average oil content of individual plants with different genotypes in the experimental population and the significance of their differences.

[0018] Figure 3 To verify the average oil content of individual plants with different genotypes in the population and the significance of their differences. DETAILED DESCRIPTION

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0021] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0022] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0023] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0024] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0025] The embodiment of the present invention provides a SNP molecular marker related to the oil content trait of sesame seeds, wherein the SNP molecular marker is located at 3669198 bp on chromosome 5 of the sesame genome; the reference gene version is Sesamum_indicum: Zhongzhi13_v2.0;

[0026] The base of the SNP molecular marker is A or G.

[0027] In some specific embodiments, the SNP molecular markers exist in genotypes AA, GG and AG.

[0028] The embodiment of the present invention also provides a method for identifying the oil content of sesame seeds using the SNP molecular marker, detecting the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the sesame genomic DNA to be identified, and the oil content of sesame seeds with genotype AA is significantly higher than that of individuals with genotype GG.

[0029] The embodiment of the present invention also provides the application of the SNP molecular marker in the breeding of traits related to oil content in sesame seeds.

[0030] The embodiment of the present invention also provides the use of the SNP molecular marker in identifying or assisting in identifying traits related to oil content in sesame seeds.

[0031] The embodiment of the present invention also provides the use of the SNP molecular marker in the preparation of a product for identifying or assisting in identifying traits related to oil content in sesame seeds.

[0032] In some specific embodiments, the sesame includes Jizhi No. 1, Linzhi No. 6 and offspring bred with the two as parents.

[0033] Example 1

[0034] Discovery of SNPs

[0035] 1. A hybrid combination was constructed with Jizhi No. 1 (oil content 51.31%) as the female parent and Linzhi No. 6 (oil content 50.44%) as the male parent. The hybridization work was completed in Shijiazhuang, Hebei in the summer of 2020, and F was planted in Sanya, Hainan in the winter of the same year. 1 , self-pollinate and harvest F 2 , planted in Shijiazhuang, Hebei in the summer of 2021, with a total of 169 plants, and conventional field management. 2 Oil content in the seed coat of individual plants in the population.

[0036] 2. Use CTAB method to extract parent and F 2 The integrity of single DNA was checked by agarose gel electrophoresis, and the DNA concentration was determined by NanoDrop 2000.

[0037] 3. Use resequencing technology to develop SNPs for the population. The experimental process is performed according to the standard protocol provided by Illumina, including sample quality detection, library construction, library quality detection and library sequencing.

[0038] 4. The offline data were filtered according to the data analysis method of LI et al. (High-density genetic linkage map construction by F2 populations and QTL analysis of early-maturity traits in upland cotton (Gossypium hirsutum L.). Plos One, 2017, 12(8): e0182918.), and the high-quality sequences were aligned to the sesame reference genome (Wang LH, Yu S, Tong CB, et al. Genome sequencing of the high oil crops esame provides insight into oil biosynthesis [J]. Genome Biology, 2014. 15(2): 1-13.) using BWA (0.7.17) software (Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 2009, 25(14): 1754-1760.). SNP markers were identified using GATK (4.0.11.0) software (The genome analysis toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Research, 2010, 20: 1297-1303.).

[0039] 5. First, filter the following low-quality reads: remove the adapter sequence; remove those with an uncertain base type ratio greater than 10%; remove those containing more than 50% low-quality bases. After filtering, the high-quality reads were first detected using GATK software for SNPs, and then the genetic map was constructed using MSTMap (the minimum spanning tree map, version update 2015) software, with an LOD value of 4.0-20.0.

[0040] 6. Combining the genetic map and fiber quality data, the ICIM program of QTLIciMapping 4.0 software was used to locate QTLs, with the parameters of Step=1cM, PIN=0.001, and the LOD value was determined by 1000 iterations. Results: Three QTLs with contribution rates of 8.308% to 10.441% were located on chromosome 5 ( Figure 1, Table 1).

[0041] Table 1

[0042]

[0043] 7. Based on the genomic location, the three QTLs were located at 3.67–4.02 Mb on chromosome 5, with a 14-base difference between the maternal and paternal materials.

[0044] According to the parental genotypes (the maternal genotype is AA and the paternal genotype is GG), F 2 The population was divided into groups, with the same genotype as the maternal group as group a, the same genotype as the paternal group as group b, and the heterozygous genotype (AG) as group h. The results showed that the SNP at 3669198bp on chromosome 5 of the sesame genome (Sesamum_indicum: Zhongzhi13_v2.0, chr5) can well distinguish the oil content of the population. The F of group a (i.e. maternal genotype AA) 2 The average oil content of seeds per plant was 49.62%, and the F 2 The average oil content of seeds per plant was 47.87%, and the difference between the two was about 2%, reaching a significant level of 0.05. 2 The oil content of seeds per plant was 48.56%, which was between the two homozygous genotypes ( Figure 2 ). This shows that the base AA at 3669198bp on chromosome 5 is effective in identifying and detecting sesame seeds with high oil content, and GG is effective in identifying and detecting sesame seeds with low oil content.

[0045] The sequence of 50 bp upstream and downstream of the SNP site is SEQ ID NO.1: GTTTATTCAGAGGAAAAA CCATGCAGGCAAATAGAAAACGGAACGATTTAG[A]TTGAAATTTTCCTGTCCTGACTTTTTCTGATTATATCTATAATAGAATCT.

[0046] Example 2

[0047] Validation of SNPs

[0048] 1. Use 201029-0-9-3-0-9-1 (oil content 51.31%) as the female parent and ZZM00254 (oil content 50.44%) as the male parent to construct a hybrid combination. The hybridization work will be completed in Shijiazhuang, Hebei in the summer of 2022, and F will be planted in Sanya, Hainan in the winter of the same year. 1 , self-pollinate and harvest F 2, planted in Shijiazhuang, Hebei in the summer of 2023, with a total of 127 plants, and conventional field management. 2 Oil content in the seed coat of individual plants in the population.

[0049] 2. Use CTAB method to extract parent and F 2 The integrity of single DNA was checked by agarose gel electrophoresis, and the DNA concentration was determined by NanoDrop 2000.

[0050] 3. Use resequencing technology to develop SNPs for the population. The experimental process is performed according to the standard protocol provided by Illumina, including sample quality detection, library construction, library quality detection and library sequencing.

[0051] 4. The offline data were filtered according to the data analysis method of LI et al. (High-density genetic linkage map construction by F2 populations and QTL analysis of early-maturity traits in upland cotton (Gossypium hirsutum L.). Plos One, 2017, 12(8): e0182918.), and the high-quality sequences were aligned to the sesame reference genome (Wang LH, Yu S, Tong CB, et al. Genome sequencing of the high oil crops esame provides insight into oil biosynthesis [J]. Genome Biology, 2014. 15(2): 1-13.) using BWA (0.7.17) software (Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 2009, 25(14): 1754-1760.). SNP markers were identified using GATK (4.0.11.0) software (The genome analysis toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Research, 2010, 20: 1297-1303.).

[0052] 5. Detection F 2The bases at position 3669198 on chromosome 5 of the individual strain were compared with the F according to the genotypes of the parents. 2 The population was genotyped. The results showed that the F 2 The average oil content of seeds of individual plants (i.e., group a) was 49.51%, which was the same as that of the male parent genotype GG. 2 The average seed oil content of individual plants (i.e., group b) was 48.23%, with a difference of about 1.3% between the two, reaching a significant difference of 0.05. The average seed oil content of individual plants of heterozygous genotype AG (i.e., group h) was 48.88%, which was between the two homozygous genotypes ( Figure 3 ). This proves that the base AA at position 3669198 of chromosome 5 has the function of identifying and detecting sesame seeds with high oil content, and GG has the function of identifying and detecting sesame seeds with low oil content.

[0053] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A SNP molecular marker associated with the oil content trait of sesame seeds, characterized in that: The SNP molecular marker is located at 3669198 bp on chromosome 5 of the sesame genome; The base of the SNP molecular marker is A or G.

2. The SNP molecular marker according to claim 1, characterized in that: The SNP molecular markers have genotypes AA, GG and AG.

3. A method for identifying the oil content of sesame seeds using the SNP molecular marker according to claim 1 or 2, characterized in that: The genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the genomic DNA of the sesame to be identified is detected, and the oil content of sesame seeds with genotype AA is significantly higher than that of individuals with genotype GG.

4. Use of the SNP molecular marker as claimed in claim 1 or 2 in breeding for traits related to oil content in sesame seeds.

5. Use of the SNP molecular marker as claimed in claim 1 or 2 in identifying or assisting in identifying traits related to oil content in sesame seeds.

6. Use of the SNP molecular marker as claimed in claim 1 or 2 in the preparation of a product for identifying or assisting in identifying traits related to oil content in sesame seeds.

7. The use according to any one of claims 4 to 6, characterized in that: The sesame includes Jizhi No. 1, Linzhi No. 6 and the offspring bred with the two as parents.

Images