Molecular marker, primer and method for identifying purity of hybrid variety of eggplant variety and application of molecular marker, primer and method

Abstract

According to the method, on the basis of chip sequencing data of parents of the eggplant hybrid, different SNPs between the parents are found, two pairs of KASP primers are developed, and the purity of the hybrid variety of the medium-late-maturing eggplant variety is identified by adopting the two SNP markers and utilizing a fluorescence detection technology, so that the purity of the hybrid variety of the medium-late-maturing eggplant variety is identified. The molecular marker can quickly distinguish male parents, female parents and hybrids, can be directly used for identifying the purity of medium and late maturing eggplant commercial seeds, further can be used for evaluating true and false hybrids of the commercial seeds by depending on the molecular marker, and can effectively protect the rights and interests of the variety. The purity of the variety can be quickly identified by utilizing the molecular marker in the early stage, so that the loss caused by false hybrids is effectively reduced, possible disputes are reduced, the identification efficiency and accuracy are improved, and evidence is provided for variety protection. Therefore, the method has important application value in identification and variety protection of mid-late maturing eggplant variety hybrids.

Description

Technical Field

[0001] The present application relates to the technical field of plant breeding, and in particular to a molecular marker, a primer, a method and an application for identifying the purity of hybrid eggplant varieties. Background Art

[0002] Eggplant (Solanum melongena L.) is an annual herbaceous plant of the genus Solanum in the Solanaceae family. It has a long history of cultivation and a wide planting area. It is deeply loved by the general public and has excellent economic benefits. It occupies a very important position among vegetable crops.

[0003] Artificial emasculation and pollination are the main means of eggplant hybrid seed production, and the purity of the seeds cannot be guaranteed. Therefore, it is necessary to identify the purity of eggplant hybrid seeds to ensure that excellent varieties are more efficiently used in production.

[0004] Seed purity is a manifestation of the degree of consistency of varieties. As an important indicator for measuring seed quality and the main basis for seed grading, it is positively correlated with economic benefits. Therefore, purity identification of hybrid seeds is an indispensable step in the actual production process of hybrid seeds and is the key to ensuring that excellent varieties can be better used.

[0005] Traditional hybrid purity identification is mainly carried out in the field through plant morphology. This method is time-consuming, labor-intensive, easily affected by environmental and human factors, and has low accuracy. With the development of genome sequencing technology, researchers have developed SNP marker sites for both parents. Currently, SNP detection, as the latest molecular marker detection method, has been recommended as a method for variety identification at the DNA level by many international organizations, such as the International Seed Testing Association (ISTA), the International Union for the Protection of New Varieties of Plants (UPOV), and the International Seed Federation (ISF). There are mainly SNP chip platforms, high-throughput in-situ scanning platforms for samples (LGC's KASP technology, Life's Taqman technology), and high-throughput targeted sequencing technologies for sites and samples. These technical platforms are relatively expensive. Summary of the invention

[0006] The present application is made in view of the above problems, and its purpose is to provide a molecular marker; the molecular marker is used to identify the purity of eggplant variety hybrids.

[0007] Specifically, the first aspect of the present application provides the application of molecular markers in the following aspects, including:

[0008] (I), predicting, screening and / or identifying eggplant hybrid purity;

[0009] and / or, (II), improvement of eggplant;

[0010] The molecular marker includes at least one of a first molecular marker and a second molecular marker;

[0011] The first molecular marker is located at base 36453022 of chromosome 1 of the eggplant genome;

[0012] The second molecular marker is located at base 98723146 of chromosome 1 of the eggplant genome;

[0013] The improvement involves accelerating the selection of hybrid plants in progeny eggplants through molecular marker-assisted selection breeding.

[0014] The present application develops parental polymorphic KASP primers based on parental chip sequencing data in combination with F1 rapid seed germination, DNA extraction and laboratory fluorescence quantitative detection to quickly and accurately complete purity identification.

[0015] The second aspect of the present application provides a primer set, which comprises: (I) a first forward primer set:

[0016] The first forward primer set includes a nucleotide sequence as shown in SEQ ID NO.1

[0017] SEQ ID NO.1: GAAGGTGACCAAGTTCATGCTATTGGATCTACACACGAGGGGC .

[0018] and / or, (II) a second forward primer set:

[0019] The first forward primer set includes a nucleotide sequence as shown in SEQ ID NO.2;

[0020] SEQ ID NO.2: GAAGGTCGGAGTCAACGGATTATTGGATCTACACACGAGGGGA .

[0021] and / or, (III) a third forward primer set:

[0022] The third forward primer set includes a nucleotide sequence as shown in SEQ ID NO.3;

[0023] SEQ ID NO.3: GAAGGTGACCAAGTTCATGCTACTTCCTCCTAAACATACTTAGACGT .

[0024] and / or, (IV) a fourth forward primer set:

[0025] The fourth forward primer set includes a nucleotide sequence as shown in SEQ ID NO.4;

[0026] SEQ ID NO.4: GAAGGTCGGAGTCAACGGATTACTTCCTCCTAAACATACTTAGACGC .

[0027] and / or, (V) a first reverse primer set,

[0028] The first reverse primer set has a nucleotide sequence as shown in SEQ ID NO.5;

[0029] SEQ ID NO. 5: TCACGACCCATTTGATAGGCTTAA.

[0030] and / or, (VI) a second reverse primer set,

[0031] The second reverse primer set has a nucleotide sequence as shown in SEQ ID NO.6;

[0032] SEQ ID NO. 6: GAAAATGAGGTGACTGGAAAGGTG.

[0033] and / or, (VII) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (VI), but different from the nucleotide sequence shown in any one of (I) to (VI) due to the degeneracy of the genetic code;

[0034] and / or, (VIII) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in any one of (I) to (VII), and a nucleotide sequence having the same or similar functions as the nucleotide sequence shown in any one of (I) to (VII);

[0035] and / or, (IX) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in any one of (I) to (VIII);

[0036] And / or, the linker sequence includes the nucleotide sequence shown in SEQ ID NO.7 or SEQ ID NO.8;

[0037] SEQ ID NO.7: GAAGGTGACCAAGTTCATGCT(FAM);

[0038] SEQ ID NO. 8: GAAGGTCGGAGTCAACGGATT (HEX).

[0039] The third aspect of the present application provides the application of the primer set described in the second aspect in the following aspects:

[0040] (I), predicting, screening and / or identifying eggplant hybrid purity;

[0041] and / or, (II), improvement of eggplant;

[0042] and / or, (III), a kit for predicting, screening and / or identifying the purity of eggplant hybrids;

[0043] The improvement includes accelerating the selection of eggplant hybrids in progeny eggplants by molecular marker assisted selection breeding.

[0044] The fourth aspect of the present application provides a kit, characterized in that it includes the primer set described in the second aspect of the present application.

[0045] The fifth aspect of the present application provides the use of the kit described in the fourth aspect of the present application in the following aspects:

[0046] (I), predicting, screening and / or identifying eggplant hybrid purity;

[0047] and / or, (II), improvement of eggplant;

[0048] The improvement includes accelerating the selection of eggplant hybrids in progeny eggplants by molecular marker assisted selection breeding.

[0049] The sixth aspect of the present application provides a method for identifying the purity of eggplant hybrids, comprising the following steps: extracting eggplant genomic DNA, using the primer set described in the second aspect of the present application and / or the kit described in the fourth aspect of the present application to identify the genotype of the eggplant, and identifying the purity of the eggplant hybrids.

[0050] According to some embodiments of the present application, the standard for identifying the purity of eggplant hybrids according to the genotype is as follows:

[0051] (I) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a pseudohybrid of the paternal type;

[0052] (II) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a pseudohybrid of the paternal type;

[0053] (III) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is CC and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal type pseudohybrid;

[0054] (IV) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is CC and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal pseudohybrid;

[0055] (V) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid;

[0056] (VI) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid;

[0057] (VII) If other genotype combinations appear, they are judged to be other types of hybrids.

[0058] The seventh aspect of the present application provides a method for the purity of eggplant hybrids, comprising the following steps: extracting eggplant genomic DNA, using the primer set described in the second aspect of the present application and / or the kit described in the fourth aspect of the present application for PCR amplification, and determining based on the fluorescent signal of the PCR product to obtain the corresponding variety.

[0059] According to some embodiments of the present application, the standard for evaluating the purity of eggplant hybrids by judging the genotype based on the fluorescent signal is as follows:

[0060] (I) If it is determined by the fluorescent signal that the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a paternal type pseudohybrid;

[0061] (II) If it is determined by the fluorescent signal that the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a paternal type pseudohybrid;

[0062] (III) If it is determined by the fluorescent signal that the base pair at position 36453022 of chromosome 1 of the eggplant genome is CC and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal type pseudohybrid;

[0063] (IV) If the 36453022nd base pair of chromosome 1 of the eggplant genome is CC and the 98723146th base pair of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal type pseudohybrid;

[0064] (V) If it is determined by the fluorescent signal that the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid;

[0065] (VI) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC as determined by the fluorescent signal, it is determined to be a true hybrid;

[0066] (VII) If other genotype combinations appear, they are judged to be other types of hybrids.

[0067] According to some embodiments of the present application, the reaction procedure of the PCR amplification includes:

[0068] (I), pre-denaturation at 94°C-95°C for 14-15 min, denaturation at 94°C-95°C for 20-30 s, annealing and extension at 65°C-56°C for 60-70 s, 10-15 cycles, reducing the temperature by 0.6°C-0.8°C in each cycle;

[0069] And / or, (II), denaturation at 94°C-95°C for 20s-30s, annealing and extension at 55°C-57°C for 60s-70s, for 26-30 cycles. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] In order to more clearly illustrate the embodiments of the present drawings or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present drawings. For ordinary technicians in this field, other drawings can be obtained based on the structures shown in these drawings without paying any creative work.

[0071] Figure 1 These are the phenotypes of the female parent (left), male parent (middle) and hybrid (right) of “Hongxiu 3”.

[0072] Figure 2 Detect differences between maternal and paternal parents for the eggplant chip.

[0073] Figure 3 This is a genotyping diagram of the Chr01-36453022 and Chr01-98723146 molecular markers of the present invention in identifying true and false hybrids of "Hongxiu No. 3";

[0074] In the figure, A indicates: the PCR product is the fluorescence signal corresponding to primers Chr01-36453022 and Chr01-98723146, which is the male parent and male-type pseudohybrid;

[0075] B indicates: the PCR product is the fluorescence signal corresponding to primers Chr01-36453022 and Chr01-98723146, which are the female parent and the female type pseudohybrid;

[0076] C indicates that the PCR product has two fluorescent signals of primers Chr01-36453022 and Chr01-98723146, which is the hybrid F1.

[0077] The purpose, features and advantages of this figure will be further described in conjunction with the embodiments with reference to the accompanying drawings. DETAILED DESCRIPTION

[0078] Hereinafter, the reference electrode, lithium-ion battery, and the preparation method and application embodiments of the present application are specifically disclosed in detail with appropriate reference to the accompanying drawings. However, there may be cases where unnecessary detailed descriptions are omitted. For example, there are cases where detailed descriptions of well-known matters and repeated descriptions of actually the same structures are omitted. This is to avoid the following description from becoming unnecessarily lengthy and to facilitate the understanding of those skilled in the art. In addition, the drawings and the following descriptions are provided for those skilled in the art to fully understand the present application and are not intended to limit the subject matter described in the claims.

[0079] "Scope" disclosed in the present application is limited in the form of lower limit and upper limit, and a given range is limited by selecting a lower limit and an upper limit, and the selected lower limit and upper limit define the boundary of a special range. The scope limited in this way can be including end values ​​or not including end values, and can be arbitrarily combined, that is, any lower limit can be combined with any upper limit to form a scope. For example, if the scope of 60-120 and 80-110 is listed for a specific parameter, it is understood that the scope of 60-110 and 80-120 is also expected. In addition, if the minimum range values ​​1 and 2 are listed, and if the maximum range values ​​3, 4 and 5 are listed, the following scope can be all expected: 1-3, 1-4, 1-5, 2-3, 2-4 and 2-5. In the present application, unless otherwise specified, the numerical range "ab" represents the abbreviation of any real number combination between a and b, wherein a and b are real numbers. For example, the numerical range "0-5" means that all real numbers between "0-5" are listed in this document, and "0-5" is just an abbreviation of these numerical combinations. In addition, when a parameter is expressed as an integer ≥ 2, it is equivalent to disclosing that the parameter is, for example, an integer of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.

[0080] Unless otherwise specified, all embodiments and optional embodiments of the present application can be combined with each other to form a new technical solution.

[0081] Unless otherwise specified, all technical features and optional technical features of this application can be combined with each other to form a new technical solution.

[0082] If there is no special explanation, all steps of the present application can be performed sequentially or randomly, preferably sequentially. For example, the method includes steps (a) and (b), which means that the method may include steps (a) and (b) performed sequentially, or may include steps (b) and (a) performed sequentially. For example, the method may further include step (c), which means that step (c) may be added to the method in any order. For example, the method may include steps (a), (b) and (c), or may include steps (a), (c) and (b), or may include steps (c), (a) and (b), etc.

[0083] If there is no special explanation, the "include" and "comprising" mentioned in this application are open-ended or closed-ended. For example, the "include" and "comprising" may mean that other components not listed may also be included or only the listed components may be included or only the listed components may be included.

[0084] If not specifically stated, in this application, the term "or" is inclusive. For example, the phrase "A or B" means "A, B, or both A and B". More specifically, any of the following conditions satisfies the condition "A or B": A is true (or exists) and B is false (or does not exist); A is false (or does not exist) and B is true (or exists); or both A and B are true (or exist).

[0085] Before describing the present application in detail, it should be understood that the present application is not limited to specific embodiments, which can of course be varied. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to be limiting. As used in this specification and the appended claims, singular and singular forms of terms, such as "a", "a", and "the", include plural referents unless otherwise expressly stated in the text. Thus, for example, reference to "a plant", "the plant", or "a plant" also includes multiple plants; and, depending on the context, the use of the term "plant" can also include genetically similar or identical progeny of the plant; the use of the term "nucleic acid" actually optionally includes multiple copies of the nucleic acid molecule; similarly, the term "probe" optionally (and typically) covers many similar or identical probe molecules.

[0086] Unless otherwise specified, nucleic acids are written from left to right in a 5' to 3' direction. The numerical ranges mentioned in this specification include the numerical values ​​that limit the range, and include each integer or any non-integer part in the limited range. Unless otherwise defined, the meaning of all scientific and technological terms used herein is the same as that of ordinary technicians in the field to which the application belongs. Although any methods and materials similar or equivalent to those described herein can be used to test the practice of the application, preferred methods and materials are those described herein. In the description and claims of the application, the following terms will be used according to the definitions listed below.

[0087] Certain definitions used in the specification and claims are provided below. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given to such terms, the following definitions are provided:

[0088] "Agronomics", "agronomic traits", and "agronomic performance" refer to the traits (and underlying genetic factors) of a given plant variety that contribute to yield over the course of the growing season. Individual agronomic traits include emergence vigor, vegetative potential, stress tolerance, disease resistance or tolerance, insect resistance or tolerance, herbicide resistance, branching, flowering, seed set, seed size, seed density, lodging resistance, threshing rate, fruit browning, etc.

[0089] The term "allele" refers to any of one or more alternative forms of a gene sequence. For example, in a diploid cell or organism, two alleles of a given sequence typically occupy corresponding loci on a pair of homologous chromosomes. With respect to SNP markers, alleles refer to the specific nucleotide bases of the SNP locus present in the individual plant.

[0090] An allele is "associated with" a trait when the allele is part of or linked to a DNA sequence or allele that affects the expression of the trait. The presence of the allele is an indication of how the trait will be expressed.

[0091] The term "amplification" in the context of nucleic acid amplification is any process by which additional copies of (or transcribed from) a selected nucleic acid are produced. Typical amplification methods include a variety of polymerase-based replication methods, including polymerase chain reaction (PCR), ligase-mediated methods such as ligase chain reaction (LCR), and RNA polymerase-based amplification (e.g., transcription) methods. An "amplicon" is an amplified nucleic acid, e.g., a nucleic acid produced by amplifying a template nucleic acid by any available amplification method (e.g., PCR, LCR, transcription, etc.).

[0092] The term "chromosome segment" refers to a continuous linear segment of genomic DNA present on a single chromosome in plants.

[0093] The term "complementary sequence" refers to a nucleotide sequence that is complementary to a given nucleotide sequence, ie, the sequences are related by the Watson-Crick base pairing rules.

[0094] "Cultivar" and "variety" are used synonymously to refer to a group of plants within the same species (eg, eggplant) that share certain genetic traits that distinguish them from other possible varieties within that species.

[0095] "Elite lines" are agronomically superior lines resulting from many rounds of breeding and selection for superior agronomic performance. Many elite lines are available and known to those skilled in the art of eggplant breeding.

[0096] "Elite population" refers to a mixed group of superior individuals or lines that can be used to represent the state of the art in agronomically superior genotypes of a given crop species, such as eggplant.

[0097] "Favorable alleles" are alleles at specific loci that confer or contribute to an agronomically desirable phenotype (e.g., browning resistance trait) and allow identification of plants with the agronomically desirable phenotype. A marker's favorable allele is a marker allele that segregates with a favorable phenotype.

[0098] "Gene map" is a description of the gene linkage relationship between the loci on one or more chromosomes (or linkage groups) in a given species, usually expressed as a figure or table form. For each gene map, the distance between the loci is measured by how frequently their alleles appear together in the population (their recombination frequency). Using DNA or protein markers or observable phenotypes, alleles can be detected. Gene map is the product of the polymorphism possibility of each mark between the mapping population, the marker type used and different populations. Between a gene map and another, the genetic distance between the loci can be different. However, using a shared marker, information can be associated between a map and another. Those of ordinary skill in the art can use a shared marker position to identify the position of the marker and other loci of concern on each gene map. The order of the loci should be constant between the maps, but due to, for example, the marker detects alternative repeated loci in different populations, the difference, new mutation or experimental error of the statistical method for marking sorting, there is often a small change in the order of markers.

[0099] "Genetic recombination frequency" is the frequency of crossing over events (recombinations) between two loci. Recombination frequency can be observed by tracking the segregation of markers and / or traits after meiosis.

[0100] "Genome" refers to the total DNA or complete set of genes carried by a chromosome or group of chromosomes.

[0101] "Genotype" refers to the genetic makeup of a cell or organism.

[0102] "Geroplasm" refers to the genetic material that forms the physical basis of the genetic qualities of an organism. As used herein, germplasm includes seeds and living tissue from which new plants can grow; or other plant parts that can be cultured into whole plants, such as leaves, stems, pollen, or cells. Germplasm resources provide a source of genetic traits that plant breeders use to improve commercial cultivars.

[0103] A "haplotype" is the genotype of an individual at multiple loci, i.e., a combination of alleles. Typically, the loci described by a haplotype are physically and genetically linked, i.e., located on the same chromosome segment. The term "haplotype" can refer to an allele at a specific locus, or to an allele at multiple loci along a chromosome segment.

[0104] If an individual has only one type of allele at a given locus, the individual is "homozygous" (e.g., a diploid individual has one copy of the same allele at a locus on each of two homologous chromosomes). If there is more than one type of allele at a given locus, the individual is "heterozygous" (e.g., a diploid individual has one copy of each of two different alleles). The term "homogeneity" means that the members of a population have the same genotype at one or more specific loci. In contrast, the term "heterogeneity" is used to indicate that the genotypes of individuals within a population at one or more specific loci are different.

[0105] The term "indel" refers to an insertion or deletion, wherein one strain may be referred to as having an inserted nucleotide or DNA segment relative to a second strain, or the second strain may be referred to as having a deleted nucleotide or DNA segment relative to a first strain.

[0106] "Introgression" refers to the infiltration or introduction of a gene, quantitative trait locus (QTL), marker locus, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.

[0107] "Strain" or "strain" is a group of individuals of the same kinship, which are usually inbred to a certain degree and are usually homozygous and homogeneous (isogenic or near-isogenic) at most loci. "Subline" refers to an inbred group of offspring that is genetically different from other similar inbred groups originating from the same ancestor. Conventionally, sublines are obtained by inbreeding seeds from a single eggplant plant selected in the F3 to F5 generation until the remaining segregating loci are "fixed" or are homozygous at most or all of the loci. Commercial eggplant varieties (or strains) are usually produced by aggregating ("converging") the self-pollination progeny of a single F3 to F5 plant from a controlled cross between two genetically different parents. Although the above varieties usually appear to be uniform, the varieties derived from the self-pollination of the selected plants will eventually (e.g., F8) become a mixture of homozygous plants that can be genotyped differently at any locus in the initially selected F3 to F5 plants. Sublines based on markers that differ from each other based on qualitative polymorphisms at the DNA level at one or more specific marker loci are obtained by genotyping a seed sample derived from a single self-pollination progeny of a selected F3-F5 plant. The seed sample can be directly genotyped as a seed or as a plant tissue grown from such a seed sample. Optionally, seeds that share a common genotype at a specific locus (or loci) are combined, providing sublines that are genetically homologous on the identified loci that are important for the trait being paid attention to (e.g., anther extrusion, flowering stage, heading stage and / or head blight resistance, etc.).

[0108] "Linkage" refers to the phenomenon that alleles on the same chromosome tend to co-segregate more often than expected by chance when their transmission is independent. Genetic recombination occurs at an assumed random frequency over the entire genome. The gene map is constructed by measuring the frequency of recombination between pairs of traits or markers. The closer traits or markers are to each other on the chromosome, the lower the frequency of recombination, and the higher the degree of linkage. If traits or markers are generally co-segregated, they are considered to be linked in this article. The recombination probability of 1 / 100 per generation is defined as a map distance of 1.0 centimorgan (1.0 cM).

[0109] The hereditary element or gene that are positioned at a single chromosome segment are physically linked. Advantageously, two locus positions are in close proximity so that the reorganization between the homologous chromosome pair in the meiotic process does not occur with high frequency between the two loci, for example, so that the linked loci are co-segregated at least about 90% of the time, for example 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.75% or more time. The hereditary element that is positioned at the chromosome segment is also hereditarily linked, usually in the genetic recombination distance that is less than or equal to 50 centimorgans (cM), for example about 49,40,30,20,10,5,4,3,2,1,0.75,0.5 or 0.25cM or less. That is, two genetic elements within a single chromosome segment recombine with each other during meiosis at a frequency of less than or equal to about 50%, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, or 0.25% or less.

[0110] In the present application, the phrase "tightly linked" about loci refers to the recombination between two linked loci occurring at a frequency equal to or less than 10% (i.e., separated by no more than 10 cM on the genetic map). In other words, tightly linked loci co-segregate at least 90% of the time. When marker loci show a significant possibility (linkage) of co-segregation with a desired trait (e.g., browning resistance), they are particularly useful in the present application. Tightly linked loci, such as marker loci and second loci, can show 10% or less, preferably about 9% or less, more preferably about 8% or less, more preferably about 7% or less, still more preferably about 6% or less, more preferably about 5% or less, still more preferably about 4% or less, more preferably about 3% or less, and still more preferably about 2% or less of inter-loci recombination frequency. In a highly preferred embodiment, the associated loci show a recombination frequency of about 1% or less, for example, about 0.75% or less, more preferably about 0.5% or less, or more preferably about 0.25% or less. Such two loci on the same chromosome that are located at a distance such that the recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25%, or lower) are also referred to as being "adjacent" to each other. In some cases, two different markers can have the same genetic map coordinates. In such cases, the two markers are so close to each other that the recombination between them occurs at a frequency so low that it is not detectable.

[0111] When it comes to the relationship between two genetic elements (such as a genetic element that contributes to antagonism and a neighboring marker), "coupling" state linkage refers to a state in which the "favorable" allele at the locus is physically associated with the "favorable" allele of the corresponding linked marker locus on the same chromosome chain. In the coupling state, the offspring to which the two favorable alleles are inherited together inherits the chromosome chain. In the "repulsive" state linkage, the "favorable" allele at the locus of interest is physically linked to the "unfavorable" allele at the neighboring marker locus, and the two "favorable" alleles are not inherited together (that is, the two loci are "anti-phase" to each other).

[0112] "Linkage disequilibrium" refers to when separating from parents to offspring, alleles tend to keep together in linkage groups with a higher frequency than expected from their respective frequencies. The state of being in linkage disequilibrium implies that the relevant loci are physically in sufficient proximity along the length of chromosome, so that they are separated together with a higher frequency than random (that is, non-random). The markers showing linkage disequilibrium are considered to be linked. The linked loci are more than 50% of the time co-segregated, for example, about 51% to about 100% of the time. In other words, two markers of co-segregation have a recombination frequency less than 50% (and by definition, less than 50cM apart on the same linkage group). As used herein, linkage can be between two markers, or between a marker and a locus that affects a phenotype. The marker locus can be "associated" (associated) with a trait. The linkage degree of the marker locus and the locus that affects a phenotypic trait is as, for example, the statistical probability (for example, F statistic or LOD score) of the co-segregation of the molecular marker and the phenotype is measured.

[0113] "Linkage group" (LG) refers to a trait or marker that is generally co-segregated. A linkage group generally corresponds to a chromosomal region containing genetic material encoding the trait or marker. Thus, a linkage group can generally be attributed to a specific chromosome.

[0114] A "locus" is a defined segment of DNA. For example, it can refer to the position on a chromosome where a nucleotide, gene, sequence, or marker is located.

[0115] A "map position" is a designated location on a genetic map relative to linked genetic markers within a given species where a particular marker can be found.

[0116] "Mapping" is the process of defining the linkage relationships of genetic loci through the use of genetic markers, population segregation of markers, and standard genetic principles of recombination frequency.

[0117] "Marker" or "molecular marker" or "marker locus" is a term used to represent a nucleic acid or amino acid sequence that is unique enough to characterize a specific locus on a genome. Examples include restriction fragment length polymorphism (RFLP), simple sequence repeats (SSR), target region amplified polymorphism (TRAP), isozyme electrophoresis, random amplified polymorphic DNA (RAPD), random primer polymerase chain reaction (AP-PCR), DNA amplification fingerprint (DAF), sequence-specific amplified region (SCAR), amplified fragment length polymorphism (AFLP) and single nucleotide polymorphism (SNP). In addition, other types of molecular markers are known in the art, and phenotypic traits can also be used as markers in the method. All markers are used to define a specific locus on the eggplant genome. Therefore, each marker is an indication of a specific segment of DNA with a unique nucleotide sequence. The map position provides a measure of the relative position of a specific marker relative to each other. When a trait is described as being linked to a given marker, it should be understood that the actual DNA segment whose sequence affects the trait is generally co-separated with the marker. If markers are identified on both sides of a trait, a more precise and definitive localization of the trait can be obtained. By measuring the presence of the marker in the progeny of a cross, the presence of the trait can be detected by a relatively simple molecular test without actually assessing the presence of the trait itself, which can be difficult and time consuming because actual assessment of the trait requires growing the plant to a stage where the trait can be expressed.

[0118] "Marker-assisted selection" refers to the process of selecting one or more desired traits in one or more plants by detecting one or more nucleic acids from the plant (wherein the nucleic acid is associated with the desired trait), and then selecting plants or germplasm having the one or more nucleic acids.

[0119] In some examples, multiple marker loci or haplotypes are used to define a "marker profile". As used herein, a "marker profile" refers to a combination of two or more marker loci or haplotypes within the genome of a particular plant. For example, in one example, a specific combination of marker loci or a specific combination of haplotypes defines a marker profile for a particular plant.

[0120] The term "phenotype", "phenotypic traits" or "traits" can refer to the observable expression of a gene or series of genes. The phenotype can be observable by the naked eye or by any other evaluation method known in the art, for example, weighing, counting, measuring (length, width, angle, etc.), microscopy, biochemical analysis, or electromechanical determination. In some cases, the phenotype is directly controlled by a single gene or locus, that is, a "monogenic trait" or "simple genetic trait". In the absence of a large degree of environmental variation, monogenic traits can be separated in a population, producing a "qualitative" or "discrete" distribution, that is, the phenotype is divided into discrete categories. In other cases, the phenotype is the result of multiple genes and can be considered as a "polygenic trait" or "composite trait". Polygenic traits are separated in a population to produce a "quantitative" or "continuous" distribution, that is, the phenotype cannot be separated into discrete categories. Both monogenic and polygenic traits can be affected by the environment in which they are expressed, but polygenic traits tend to have a larger environmental composition.

[0121] A "favorable trait" or "favorable phenotype," such as, for example, resistance to fruit browning, is an agronomically desirable phenotype.

[0122] The term "plant" includes reference to the entire plant, whether immature or mature, including a plant from which seeds or grains or anthers have been removed. A seed or embryo that will produce a plant is also considered a plant.

[0123] "Plant part" refers to any part or piece of a plant, including leaves, stems, buds, roots, root tips, anthers, seeds, embryos, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, branches, stems, tissues, tissue cultures, cells, etc.

[0124] "Polymorphism" refers to a variation or difference between two related nucleic acids. "Nucleotide polymorphism" refers to a nucleotide that is different in one sequence compared to related sequences when two nucleic acids are aligned for maximum correspondence.

[0125] "Polynucleotide", "polynucleotide sequence", "nucleic acid sequence", "nucleic acid fragment" and "oligonucleotide" are used interchangeably herein. These terms encompass nucleotide sequences, among others. Polynucleotides can be polymers of RNA or DNA, which can be single-stranded or double-stranded, optionally containing synthetic, non-natural or modified nucleotide bases. A polynucleotide in the form of a DNA polymer can be composed of one or more chains of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.

[0126] "Primer" refers to an oligonucleotide (synthetic or naturally occurring) that can serve as a starting point for nucleic acid synthesis or replication along a complementary strand when placed under conditions where the complementary strand is synthesized by a polymerase. Typically, a primer is an oligonucleotide of 10 to 30 nucleic acids in length, but longer or shorter sequences can be used. Primers can be provided in double-stranded form, although single-stranded form is preferred. Primers can also contain a detectable label, such as a 5' end label.

[0127] "Probe" refers to an oligonucleotide (synthetic or naturally occurring) that is complementary (but not necessarily completely complementary) to a polynucleotide of interest and forms a double-stranded structure by hybridizing with at least one strand of the polynucleotide of interest. Typically, a probe is an oligonucleotide of 10 to 50 nucleic acids in length, but longer or shorter sequences can be used. The probe can also contain a detectable label.

[0128] The terms "label" and "detectable label" refer to molecules capable of detection, including but not limited to radioisotopes, fluorescent agents, chemiluminescent agents, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, chromophores, dyes, metal ions, metal sols, semiconductor nanocrystals, ligands (e.g., biotin, avidin, streptavidin or hapten), etc. Detectable labels can also include combinations of reporters and quenchers, such as those employed in FRET probes or TaqMan probes.

[0129] The term "reporter gene" refers to a substance or a portion thereof, which is capable of expressing a detectable signal, and the signal can be suppressed by a quencher. The detectable signal of the reporter gene is, for example, fluorescence within a detectable range.

[0130] The term "quencher" refers to a substance or a portion thereof that is capable of inhibiting, reducing, suppressing, etc., a detectable signal generated by the reporter gene.

[0131] As used herein, the terms "quenching" and "fluorescence energy transfer" refer to the process whereby, when a reporter gene and a quencher are in close proximity and the reporter gene is excited by an energy source, a major portion of the energy of the excited state is non-radiatively transferred to the quencher, where it is either dissipated non-radiatively or emitted at a wavelength different from the emission wavelength of the reporter gene.

[0132] The term "quantitative trait locus" or "QTL" refers to a region of DNA associated with differential expression of a quantitative phenotypic trait in at least one genetic background (e.g., in at least one breeding population). The region of a QTL encompasses or is closely associated with one or more genes that affect the trait under consideration.

[0133] A "reference sequence" or "consensus sequence" is a defined sequence used as the basis for sequence comparison. A reference sequence for a PHM marker is obtained by sequencing multiple strains at the locus, aligning the nucleotide sequences in a sequence alignment program (e.g., Sequencher), and then obtaining the most common nucleotide sequence in the alignment. Polymorphisms that exist between individual sequences are annotated in the consensus sequence. A reference sequence is usually not an exact copy of any individual DNA sequence, but rather represents a mixture of available sequences and is used to design primers and probes for polymorphisms within the sequence.

[0134] "Recombination frequency" is the frequency of crossing over events (recombinations) between two loci. Recombination frequency can be observed by tracking the segregation of markers and / or traits during meiosis.

[0135] "Self-fertilization," "self-pollination," or "selfing" is the process by which a breeder mates a plant with itself; for example, a second generation hybrid F2 with itself produces progeny designated F2:3.

[0136] "SNP" or "single nucleotide polymorphism" refers to a sequence variation that occurs when a single nucleotide (A, T, C, or G) in a genomic sequence is altered or mutated. When a SNP is mapped to a site on the eggplant genome, a "SNP marker" exists. Many techniques for detecting SNPs are known in the art, including allele-specific hybridization, primer extension, direct sequencing, TM, and real-time PCR such as TaqMan assays.

[0137] "Transgenic plant" refers to a plant comprising exogenous polynucleotides in its cell. Generally speaking, exogenous polynucleotides are stably integrated into the genome so that the polynucleotides are passed to continuous generations. Exogenous polynucleotides can be integrated into the genome individually or as part of a recombinant expression cassette. "Transgenic" as used herein refers to any cell, cell line, callus, tissue, plant part or plant that has changed genotype due to the presence of exogenous nucleic acids, including transgenic organisms or cells that initially carry out such changes, and those transgenic organisms or cells produced by hybridization or asexual reproduction from initial transgenic organisms or cells. As used herein, the term "transgenic" does not encompass genomes (chromosomal genomes or extrachromosomal genomes) changes caused by conventional plant breeding methods (e.g., hybridization) or by naturally occurring events such as random cross-fertilization, non-recombinant virus infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutations.

[0138] An "unfavorable allele" of a marker is a marker allele that segregates with an unfavorable plant phenotype, thereby providing a beneficial effect in identifying plants that can be eliminated from a breeding program or germplasm.

[0139] The term "vector" is used to refer to a polynucleotide or other molecule that transfers a nucleic acid fragment into a cell. The vector optionally includes portions that mediate the maintenance of the vector and allow its intended use (e.g., sequences necessary for replication, genes that confer drug or antibiotic resistance, multiple cloning sites, operably linked promoter / enhancer elements that enable expression of cloned genes, etc.). Vectors are often derived from plasmids, bacteriophages, or plant or animal viruses.

[0140] Turning to the example here:

[0141] Identification of markers. Haplotypes and / or marker profiles associated with traits of interest.

[0142] A variety of methods well known in the art are available for detecting molecular markers or sets of molecular markers that are co-separated with the proterties (such as browning resistance) of interest. The basic idea behind these methods is the selection of markers, and for these markers, the available genotypes (or alleles) have significantly different average phenotypes. Therefore, people compare the magnitude of the difference between the available genotypes (or alleles) or the significance level of this difference between the marker loci. The trait gene is presumed to be located at the nearest place of the marker with the maximum associated genotype difference.

[0143] Two such methods for detecting the trait loci of interest are: 1) population-based association analysis and 2) conventional linkage analysis. In population-based association analysis, strains are obtained from existing populations with multiple founders, such as elite breeding strains. Population-based association analysis relies on the decline of linkage disequilibrium (LD) and the following concept: in an unstructured population, after so many generations of random mating, only the genes controlling the trait of interest and the correlation between the markers closely linked to these genes will be retained. In fact, most existing populations have population substructures.

[0144] Therefore, by using the data obtained from the randomly distributed marks in the genome, individuals are assigned to the population, thereby minimizing the imbalance caused by the population structure in each population (also referred to as subpopulation), and the use of structured association methods helps to control the population structure. For each strain in the subpopulation, the phenotypic value is compared with the genotype (allele) at each marker locus. Significant marker-trait correlations indicate close proximity between the marker locus and one or more loci participating in the expression of this trait.

[0145] The same principle exists behind conventional linkage analysis; However, LD is produced by constructing a population from a small amount of founders. Founders are selected to maximize the level of polymorphism in the constructed population, and assess the level of co-separation of polymorphic sites with a given phenotype. A variety of statistical methods have been used to identify significant marker-trait correlations. A type of such method is the interval mapping method, in which, for each of the many positions (e.g., at 1 cM intervals) along the gene map, the possibility of controlling the paid attention to trait gene being located at the position is tested. Genotype / phenotype data are used to calculate LOD scores (logarithm of probability ratio) for each test position. When the LOD score exceeds the threshold value, there is significant evidence that the gene controlling the paid attention to trait is located at the position on the gene map (it will fall between two specific marker loci).

[0146] The present disclosure provides marker loci that exhibit statistically significant co-segregation with at least one of the following traits: fruit browning resistance, as determined by population-based association analysis.

[0147] Detection of these loci or additional linked loci can be used in marker-assisted eggplant breeding programs to produce plants with favorable traits.

[0148] The molecular markers used for the purity of eggplant hybrid varieties in the present application include a first molecular marker and a second molecular marker;

[0149] The first molecular marker is a mutation from C to A occurring at position 36453022 bp on chromosome 1 of the eggplant genome;

[0150] >Chr01-36453022: The reference genome is SME-HQ_V2.0.

[0151] CTACATCTACGAGACCAAGTATGACTCATAGAATATTCTATGAGTCATAGACTGGGTCATAGATATGGTTCCAAATTTGAATTTCTGGAGGCATAGCCCTACAAGACCGGTCTACGCGTTGTAGACTACACTATGGCTCGTAAAGGTCTCTTCTGATAGAGTCCTAGAAACTCCTTGCCATTGGATCTACACACGAGGGG[C / A]AACTATGGCTCATGGAATATTTAATAGGCCATAGAAGACCCTT GTTTGTGTAAAATTTCTAGTAACATGGTTTTTTAAGCCTATCAAATGGGTCGTGACATGACATCATCAGACCACAATTAATTAAACCAGCACTGAAGCAAGAATTCTATGCACCCACATGATCCCAACATAATCCCAAATATCCCACATTCAATAATT.

[0152] The second molecular marker is a variation from T to C occurring at position 98723146 bp on chromosome 1 of the eggplant genome.

[0153] >Chr01-98723146: The reference genome is SME-HQ_V2.0.

[0154] AGAATAACTAAAATAACAATTTATAAAAAGCTTATATTGCGCATGGGAAGATTATAAAGTTAGTCAGATCGATCATAAACCAGTAAAATCAAAAAGAGATGTAAAATGTTAAACATCAACCAACAACAAAAGGCAGATTATACACAAAAAATTATTTTACAATGAGTTCTAAGACTTCCTCCTAAACATACTTAGACG[T / C]CAGCATTCTTTCACTTTCCCCATGCTCATGATTGCTCATAGGATTACCAAACTTGTTAACCACCTTTCCAGTCACCTCATTTTCACTAATTGCACCTGAATCAATCTTCTTGTTTCCATAGTCCCATACCAATGTCCCATATCTCAATCGACAAAATGTTGGGTGAAATATTTTTCTTCCAATCTAGGCATAATCAT.

[0155] According to some embodiments of the present application, the eggplant variety includes a mid-late maturing eggplant variety.

[0156] According to some embodiments of the present application, the eggplant variety includes "Hongxiu No. 3".

[0157] According to some embodiments of the present invention, the present application includes the following primer sequences:

[0158] Chr01-36453022-F1 (primer sequence 5'-3'):

[0159] GAAGGTGACCAAGTTCATGCTATTGGATCTACACACGAGGGGC;

[0160] Chr01-36453022-F2 (primer sequence 5'-3'):

[0161] GAAGGTCGGAGTCAACGGATTATTGGATCTACACACGAGGGGA;

[0162] Chr01-36453022-C (primer sequence 5'-3'):

[0163] TCACGACCCATTTGATAGGCTTAA;

[0164] Chr01-98723146-F1 (primer sequence 5'-3'):

[0165] GAAGGTGACCAAGTTCATGCTACTTCCTCCTAAACATACTTAGACGT;

[0166] Chr01-98723146-F2 (primer sequence 5'-3'):

[0167] GAAGGTCGGAGTCAACGGATTACTTCCTCCTAAACATACTTAGACGC;

[0168] Chr01-98723146-C (primer sequence 5'-3'):

[0169] GAAAATGAGGTGACTGGAAAGGTG.

[0170] According to some embodiments of the present application, the 5' end of the primer Chr01-36453022-F1 is connected to a FAM fluorescent linker.

[0171] According to some embodiments of the present application, the 5' end of the primer Chr01-98723146-F1 is connected to a FAM fluorescent linker.

[0172] According to some embodiments of the present application, the 5' end of the primer Chr01-36453022-F2 is connected to a HEX fluorescent linker.

[0173] According to some embodiments of the present application, the 5' end of the primer Chr01-98723146-F2 is connected to a HEX fluorescent linker.

[0174] According to some embodiments of the present application, the FAM fluorescent linker sequence is:

[0175] FAM: GAAGGTGACCAAGTTCATGCT;

[0176] According to some embodiments of the present application, the HEX fluorescent linker sequence is:

[0177] HEX: GAAGGTCGGAGTCAACGGATT.

[0178] According to some embodiments of the present application, the molecular marker is used to identify true and false hybrids of the medium-late maturing eggplant variety "Hongxiu No. 3".

[0179] According to some embodiments of the present application, the method for identifying true and false hybrids of the medium-late maturing eggplant variety "Hongxiu No. 3" is:

[0180] (1) using the genomic DNA of the sample to be tested as a template, and performing amplification using two sets of primers corresponding to the molecular markers to obtain an amplified product;

[0181] (2) Performing fluorescence detection on the amplified product. If the FAM fluorescence signal corresponding to primers Chr01-36453022 and Chr01-98723146 is detected in the sample PCR product, the corresponding detection site is A:A, C:C genotype, and it is determined to be a paternal type pseudohybrid;

[0182] If the HEX fluorescence signal corresponding to primers Chr01-36453022 and Chr01-98723146 is detected in the sample PCR product, the corresponding detection site is C:C, T:T genotype, and it is determined to be a maternal type pseudohybrid;

[0183] If both FAM and HEX fluorescence signals are detected at the same time, the detection site is C:A, T:C genotype, and it is determined to be a true hybrid.

[0184] According to some embodiments of the present application, a method for identifying the purity of a hybrid of a medium-late maturing eggplant variety "Hongxiu No. 3" comprises the following steps:

[0185] (1) using the genomic DNA of the sample to be tested as a template and performing PCR amplification using primers corresponding to the molecular marker to obtain an amplified product;

[0186] (2) Perform fluorescence detection on the amplified product. If the HEX fluorescence signal corresponding to primers Chr01-36453022 and Chr01-98723146 is detected in the sample PCR product, the corresponding detection site is A:A, C:C genotype, and it is determined to be a paternal type pseudohybrid;

[0187] If the FAM fluorescence signal corresponding to primers Chr01-36453022 and Chr01-98723146 is detected in the sample PCR product, the corresponding detection site is C:C, T:T genotype, and it is determined to be a maternal type pseudohybrid;

[0188] If both FAM and HEX fluorescence signals are detected, the detection loci are of C:A, T:C genotype, and it is determined to be a true hybrid;

[0189] If no fluorescence signal is detected, it is another genotype combination and is determined to be another type of hybrid;

[0190] (3) By counting the ratio of true hybrids to the total tested samples, the purity of eggplant hybrid seeds can be calculated.

[0191] According to some embodiments of the present application, PCR amplification adopts Touchdown PCR; the Touchdown PCR amplification program is: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.

[0192] According to some embodiments of the present application, the molecular markers are used to identify the medium-to-late maturing eggplant variety "Hongxiu No. 3".

[0193] The present application also provides the application of the above molecular markers in identifying true and false hybrids of the medium-late maturing eggplant variety "Hongxiu No. 3".

[0194] Specifically, the method for identifying the true and false hybrids of the medium-late maturing eggplant variety "Hongxiu No. 3" is as follows:

[0195] (1) using the genomic DNA of the sample to be tested as a template, and performing amplification using two sets of primers corresponding to the molecular markers to obtain an amplified product;

[0196] (2) Performing fluorescence detection on the amplified product. If the HEX fluorescence signal corresponding to primers Chr01-36453022 and Chr01-98723146 is detected in the sample PCR product, the corresponding detection site is A:A, C:C genotype, and it is determined to be a paternal type pseudohybrid;

[0197] If the FAM fluorescence signal corresponding to primers Chr01-36453022 and Chr01-98723146 is detected in the sample PCR product, the corresponding detection site is C:C, T:T genotype, and it is determined to be a maternal type pseudohybrid;

[0198] If both FAM and HEX fluorescence signals are detected at the same time, the detection site is C:A, T:C genotype, and it is determined to be a true hybrid.

[0199] If no fluorescence signal is detected, it is another genotype combination and is determined to be another type of hybrid;

[0200] In addition, the present application also discloses a method for identifying the purity of the hybrid of the medium-late maturing eggplant variety "Hongxiu No. 3", the method comprising the following steps:

[0201] (1) using the genomic DNA of the sample to be tested as a template and performing PCR amplification using primers corresponding to the molecular markers described in claim 3 to obtain an amplified product;

[0202] (2) Fluorescence detection of the amplified products. The HEX fluorescence signals corresponding to Chr01-36453022 and Chr01-98723146 indicate that the corresponding detection sites are A:A and C:C genotypes, and are determined to be paternal type pseudohybrids.

[0203] If the FAM fluorescence signal corresponding to primers Chr01-36453022 and Chr01-98723146 is detected in the sample PCR product, the corresponding detection site is C:C, T:T genotype, and it is determined to be a maternal type pseudohybrid;

[0204] If both FAM and HEX fluorescence signals are detected, the detection loci are of C:A, T:C genotype, and it is determined to be a true hybrid;

[0205] If no fluorescence signal is detected, it is another genotype combination and is determined to be another type of hybrid;

[0206] (3) By counting the ratio of true hybrids to the total tested samples, the purity of eggplant hybrid seeds can be calculated.

[0207] Preferably, PCR amplification uses Touchdown PCR; the Touchdown PCR amplification program is: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles. The components and amounts used in PCR amplification are shown in Table 1.

[0208] Table 1 Components and dosages used in PCR amplification

[0209]

[0210] The molecular markers of the present application can not only be used for the hybrid purity of a single variety of "Hongxiu No. 3" seeds, but also can effectively distinguish the medium and late-maturing eggplant variety of "Hongxiu No. 3" from other varieties.

[0211] This application uses the whole genome chip sequencing variation detection method to screen 2 SNP sites that differ between the two parents, and successfully develops SNP markers, and develops two pairs of KASP primers, using fluorescence detection technology to quickly distinguish between the male parent, the female parent and the hybrid, that is, the medium-late maturing eggplant variety "Hongxiu No. 3" variety, which can be directly used for the identification of the medium-late maturing eggplant variety "Hongxiu No. 3" variety of commercial varieties, and then rely on this molecular marker to evaluate the true and false hybrids of commercial varieties, and can effectively protect the rights and interests of this variety. By using this molecular marker at an early stage, the purity of the variety can be quickly identified, effectively reducing the losses caused by false hybrids, reducing possible disputes, improving identification efficiency and accuracy, and providing evidence for the protection of the variety. Therefore, this application has great application value in the identification and variety protection of the medium-late maturing eggplant variety "Hongxiu No. 3" hybrid.

[0212] The present invention is further described below in conjunction with specific examples, and the advantages and features of the present application will become clearer as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or implemented under the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0213] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0214] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0215] Example 1 Obtaining molecular markers for purity identification of late-maturing eggplant variety "Hongxiu No. 3"

[0216] 1. Whole genome chip sequencing variation detection

[0217] Variation detection refers to sequencing and differential analysis of the genome of an individual or group of a species through high-throughput sequencing technology, obtaining a large number of single nucleotide polymorphism sites (SNPs), insertion / deletion sites (InDel, Insertion / Deletion), structural variation sites (SV, Structure Variation) sites and copy number variation sites (CNV, copynumber variation). With the significant reduction in sequencing costs and the improvement in sequencing efficiency, whole genome chip sequencing variation detection has become one of the fastest and most effective methods for studying human diseases and animal and plant molecular breeding. After the sequencing data is downloaded from the machine, bioinformatics analysis is performed according to the following process.

[0218] (1) Perform quality control on the original data to obtain clean data for analysis; the raw data is used to obtain high-quality clean reads for subsequent analysis.

[0219] The steps for filtering sequencing data are as follows:

[0220] (a) Remove reads containing adaptor;

[0221] (b) remove reads with N greater than 3;

[0222] (c) Remove low-quality reads (the number of bases with quality value Q < 5 accounts for more than 20% of the entire read).

[0223] (2) Compare the clean data with the reference genome; after obtaining the clean reads, use BWA software to compare the clean reads with the reference genome. The initial comparison result is in sam format, and then use SAMtools software to convert the result to bam format and sort it. If the results of a sample contain multiple libraries, use SAMtools to merge the bam results of multiple libraries, use picard to annotate the repeated sequences, and perform basic data statistics;

[0224] (3) Perform SNP variation detection; use GATK software (v3.8 second-generation chip sequencing variation detection software https: / / software.broadinstitute.org / gatk / ) to detect SNPs;

[0225] (4) SNP screening: filter out sites with QUAL values ​​(base quality value) less than 30, MQ quality value less than 30, and DP value less than 2, and select SNP sites that are homozygous and different between parents as candidate sites.

[0226] 2. Molecular marker development

[0227] According to the difference between the sequencing sequences of the parents, the candidate SNP sites were selected, and the KASP primers (primers corresponding to the molecular markers of the present application) were designed using the online primer design software SNP Primer (www.snpway.com), which included a pair of specific primers (Primer A and Primer B) for SNP alleles containing different fluorescent linkers and a reverse common primer (Primer C), Primer A was a FAM fluorescent linker (GAAGGTGACCAAGTTCATGCT): Primer B was a HEX fluorescent linker (GAAGGTCGGAGTCAACGGATT). The primer pairs with appropriate specificity and annealing temperature were selected, and the primers were synthesized by Beijing Qingke Company.

[0228] When molecular markers are used, the following steps are specifically included:

[0229] (1) Using the genomic DNA of the sample to be tested as a template, a touchdown PCR amplification was performed using the molecularly labeled amplification primers to obtain the amplified product; the touchdown PCR was used, and the amplification program was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles;

[0230] (2) Detecting and analyzing the amplified products. If the HEX fluorescence signals corresponding to primers Chr01-36453022 and Chr01-98723146 are detected in the sample PCR products, the corresponding detection sites are A:A and C:C genotypes, and it is determined to be a paternal type pseudohybrid;

[0231] If the FAM fluorescence signal corresponding to primers Chr01-36453022 and Chr01-98723146 is detected in the sample PCR product, the corresponding detection site is C:C, T:T genotype, and it is determined to be a maternal type pseudohybrid;

[0232] If both FAM and HEX fluorescence signals are detected, the detection loci are of C:A, T:C genotype, and it is determined to be a true hybrid;

[0233] If no fluorescent signal is detected, it is another genotype combination and is determined to be another type of hybrid; (in actual testing, no fluorescent signal will be generated, which may be caused by pollen cross-pollination in actual production).

[0234] By counting the ratio of true hybrids to the total tested samples, the purity of eggplant hybrid seeds can be calculated.

[0235] 3. Specific application examples

[0236] Two SNP markers were used to detect 188 samples to be tested. The proportion of true hybrids in the samples to be tested was calculated based on the SNP marker test results. The primers were mutually corrected. When both pairs of primers were heterozygous for F1 detection, it was determined to be a true hybrid. The number of hybrids was determined as the number of single plants with the same genotype of the double marker loci as the male or female parent, and the purity of the seeds was calculated (Table 2 and Table 3). The primers were found to be stable in the field and were consistent with the field test results, so they could be used to identify the purity of eggplant hybrid varieties.

[0237] The detection method of this embodiment can complete the seed purity identification work within 2 hours, and has the advantages of being fast, low-cost, and easy to operate.

[0238] Table 2 Genotypes detected by Chr01-36453022 and Chr01-98723146 markers and determination of true and false hybrids

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245] Table 3 Purity identification results

[0246]

[0247]

[0248] In summary, in breeding, through molecular marker identification and screening, if the FAM fluorescence signal corresponding to the primers Chr01-36453022 and Chr01-98723146 is retained and detected, it can be determined as a maternal pseudo-hybrid; if the HEX fluorescence signal corresponding to the primers Chr01-36453022 and Chr01-98723146 is retained and detected, it can be determined as a paternal pseudo-hybrid; if both fluorescence signals are detected at the same time, the detection site is C:A, T:C genotype, and it is determined to be a true hybrid. Through the screening of molecular markers in the early stage, the purity of commercial varieties can be identified and the varieties can be protected. This method is simple and easy to operate, and can greatly improve the efficiency for breeders.

[0249] It should be noted that the present application is not limited to the above-mentioned embodiments. The above-mentioned embodiments are only examples, and the embodiments having the same structure as the technical idea and exerting the same effect within the scope of the technical solution of the present application are all included in the technical scope of the present application. In addition, without departing from the scope of the main purpose of the present application, various modifications that can be thought of by those skilled in the art to the embodiments and other methods of combining some of the constituent elements in the embodiments are also included in the scope of the present application.

Claims

1. The application of molecular markers in the following aspects is characterized in that: (I), predicting, screening and / or identifying eggplant hybrid purity; and / or, (II), improvement of eggplant; The molecular marker includes at least one of a first molecular marker and a second molecular marker; The first molecular marker is located at base 36453022 of chromosome 1 of the eggplant genome; The second molecular marker is located at base 98723146 of chromosome 1 of the eggplant genome; The improvement involves accelerating the selection of hybrid plants in progeny eggplants through molecular marker-assisted selection breeding.

2. A primer set, characterized in that: The primer set comprises: (I) a first forward primer set: The first forward primer set includes a nucleotide sequence as shown in SEQ ID NO.1; and / or, (II) a second forward primer set: The second forward primer set includes a nucleotide sequence as shown in SEQ ID NO.2; and / or, (III) a third forward primer set: The third forward primer set includes a nucleotide sequence as shown in SEQ ID NO.3; and / or, (IV) a fourth forward primer set: The fourth forward primer set includes a nucleotide sequence as shown in SEQ ID NO.4; and / or, (V) a first reverse primer set, The first reverse primer set has a nucleotide sequence as shown in SEQ ID NO.5; and / or, (VI) a second reverse primer set, The second reverse primer set has a nucleotide sequence as shown in SEQ ID NO.6; and / or, (VII) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (VI), but different from the nucleotide sequence shown in any one of (I) to (VI) due to the degeneracy of the genetic code; and / or, (VIII) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in any one of (I) to (VII), and a nucleotide sequence having the same or similar functions as the nucleotide sequence shown in any one of (I) to (VII); and / or, (IX) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in any one of (I) to (VIII); And / or, the linker sequence includes the nucleotide sequence shown in SEQ ID NO.7 or SEQ ID NO.

8.

3. Use of the primer set as claimed in claim 2 in the following aspects: (I), predicting, screening and / or identifying eggplant hybrid purity; and / or, (II), improvement of eggplant; and / or, (III), a kit for predicting, screening and / or identifying the purity of eggplant hybrids; The improvement includes accelerating the selection of eggplant hybrids in progeny eggplants through molecular marker assisted selection breeding.

4. A kit, characterized in that Comprising the primer set as claimed in claim 2.

5. Use of the kit as claimed in claim 4 in the following aspects: (I), predicting, screening and / or identifying eggplant hybrid purity; and / or, (II), improvement of eggplant; The improvement includes accelerating the selection of eggplant hybrids in progeny eggplants by molecular marker assisted selection breeding.

6. A method for identifying the purity of eggplant hybrids, characterized in that: The method comprises the following steps: extracting genomic DNA of eggplant, using the primer set as claimed in claim 2 and / or the kit as claimed in claim 4 to identify the genotype of the eggplant, and identifying the purity of the eggplant hybrid.

7. The method according to claim 6, characterized in that The criteria for identifying the purity of eggplant hybrids according to the genotypes are as follows: (I) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a pseudohybrid of the paternal type; (II) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a pseudohybrid of the paternal type; (III) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is CC and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal type pseudohybrid; (IV) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is CC and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal pseudohybrid; (V) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid; (VI) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid; (VII) If other genotype combinations appear, they are judged to be other types of hybrids.

8. A method for determining the purity of eggplant hybrids, characterized in that: The method comprises the following steps: extracting eggplant genomic DNA, performing PCR amplification using the primer set as claimed in claim 2 and / or the reagent kit as claimed in claim 4, and obtaining corresponding varieties according to the fluorescent signal of the PCR product.

9. The method according to claim 8, characterized in that The standard for judging the genotype and evaluating the purity of eggplant hybrids according to the fluorescent signal is as follows: (I) If it is determined by the fluorescent signal that the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a paternal type pseudohybrid; (II) If it is determined by the fluorescent signal that the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a paternal type pseudohybrid; (III) If it is determined by the fluorescent signal that the base pair at position 36453022 of chromosome 1 of the eggplant genome is CC and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal type pseudohybrid; (IV) If the 36453022nd base pair of chromosome 1 of the eggplant genome is CC and the 98723146th base pair of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal type pseudohybrid; (V) If it is determined by the fluorescent signal that the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid; (VI) If the base pair at position 36453022 of chromosome 1 of the eggplant genome is GA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC as determined by the fluorescent signal, it is determined to be a true hybrid; (VII) If other genotype combinations appear, they are judged to be other types of hybrids.

10. The method according to claim 8 or 9, characterized in that The reaction procedure of the PCR amplification includes: (I), pre-denaturation at 94°C-95°C for 14-15 min, denaturation at 94°C-95°C for 20-30 s, annealing and extension at 65°C-56°C for 60-70 s, 10-15 cycles, reducing the temperature by 0.6°C-0.8°C in each cycle; And / or, (II), denaturation at 94°C-95°C for 20s-30s, annealing and extension at 55°C-57°C for 60s-70s, for 26-30 cycles.

Images