Pumpkin salt-tolerant molecular marker as well as KASP primer combination and application thereof

Abstract

The invention discloses a salt-tolerant molecular marker of cucurbita moschata as well as a KASP primer combination and application of the salt-tolerant molecular marker, and belongs to the technical field of plant resistance breeding. The sequence of the pumpkin salt-tolerant molecular marker is as shown in SEQ ID NO.1, wherein n is T / C; when n is T, the phenotype corresponding to the genotype T is salt sensitivity; when n is C, the phenotype corresponding to the genotype C is tolerance; the invention further discloses application of the pumpkin salt-tolerant molecular marker in pumpkin salt-tolerant material screening or pumpkin salt-tolerant breeding. The invention also discloses a KASP primer combination for detecting the pumpkin salt tolerance molecular marker. The sequence of the KASP primer combination is as follows: a salt-sensitive site combined upstream primer is as shown in SEQ ID NO.2; a salt-tolerant site combined upstream primer is as shown in SEQ ID NO.3; and the downstream primer is as shown in SEQ ID NO. 4. According to the pumpkin salt-tolerant molecular marker and the KASP primer combination of the molecular marker, extreme salt-tolerant and salt-sensitive materials can be remarkably distinguished, and the molecular marker and the KASP primer combination can be used for salt-tolerant pumpkin germplasm resource creation and variety breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of plant resistance breeding, and in particular relates to an Indian pumpkin salt-tolerance molecular marker and a KASP primer combination and application thereof. Background Art

[0002] Pumpkin belongs to the genus Cucurbitaceae, an annual vine herb. It is native to Mexico and Central America, and is widely cultivated all over the world with rich genetic resources. Pumpkin has a well-developed root system, vigorous plant growth, strong disease resistance, can grow and develop normally in poor soil, and has strong adaptability. It is a good saline-alkali improvement crop. Salt stress is one of the most serious abiotic stresses. Excessive salt affects plant growth and development and even causes death. At present, there are large areas of saline-alkali land in my country, and the area is still expanding, which seriously restricts the development of modern agriculture in my country. Improving these saline-alkali lands with great potential in an economical and environmentally friendly way is of great significance to the sustainable development of the rural economy. At present, the commonly used improvement methods include irrigation to wash salt, spreading lime, and planting salt-alkali tolerant crops. Planting salt-tolerant crops to improve saline-alkali land has low cost and high utilization rate of saline-alkali land, which is an economical and feasible way.

[0003] However, the current breeding of pumpkin salt-tolerant varieties mainly relies on the application of conventional breeding technology, relying on field and laboratory salt stress treatment to identify its agronomic traits and physiological development changes, and then screen salt-tolerant materials for related variety breeding; there are problems such as long cycle, high cost and low accuracy. Molecular marker-assisted breeding technology that can significantly improve breeding efficiency and accuracy has not yet been applied. Therefore, it is of great significance to develop relevant molecular markers to improve the salt tolerance level of pumpkin. Summary of the invention

[0004] The purpose of the present invention is to provide a pumpkin salt tolerance molecular marker and its KASP primer combination and application, aiming to solve the problems of long pumpkin salt tolerance identification cycle, high cost, low accuracy, etc. The present invention overcomes the defects of low efficiency, high cost and insufficient related genes in the existing breeding of pumpkin salt tolerance varieties, and through genotyping and phenotypic identification, a site that can cause functional non-synonymous mutations different from the retrieved and published salt tolerance sites is excavated, and related molecular markers are developed, and experimentally verified that it has a significant effect in pumpkin salt tolerance screening.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] A salt-tolerance molecular marker for pumpkin, the sequence of which is shown in SEQ ID NO.1:

[0007] AATTCTTAGTAAATCATTAGTTATTTGGGGTTGGGATGTTGGGATGTTGGGTGTT nCTTTTTCT ACTTATTCTATGATTTGATTGTTTTCAGTTGTTTTTAGTGTTTGCA;

[0008] Where n is T / C; when n is T, the phenotype corresponding to the T genotype is salt-sensitive; when n is C, the phenotype corresponding to the C genotype is salt-tolerant.

[0009] The application of the above pumpkin salt-tolerance molecular markers in pumpkin salt-tolerance material screening or pumpkin salt-tolerance breeding.

[0010] Preferably, the pumpkin is at least one of Chinese pumpkin or Indian pumpkin.

[0011] A KASP primer combination for detecting a molecular marker for salt tolerance of pumpkin is designed for the above-mentioned molecular marker for salt tolerance of pumpkin, and its sequence is as follows:

[0012] The salt-sensitive site combined with the upstream primer is shown in SEQ ID NO.2:

[0013] 5'-GAAGGTGACCAAGTTCATGCTGGATGTTGGGATGTTGGGTGTTT-3';

[0014] The salt-tolerant site combined with the upstream primer is shown in SEQ ID NO.3:

[0015] 5'-GAAGGTCGGAGTCAACGGATTGGATGTTGGGATGTTGGGTGTTC-3';

[0016] The downstream primer is shown in SEQ ID NO.4:

[0017] 5'-TGCAAACACTAAAAACAACTGAAAACA-3'.

[0018] A kit for detecting salt tolerance of pumpkin comprises the above-mentioned KASP primer combination for detecting molecular markers of salt tolerance of pumpkin.

[0019] The application of the KASP primer combination for detecting molecular markers of pumpkin salt tolerance in pumpkin salt-tolerant material screening or pumpkin salt-tolerant breeding.

[0020] A method for screening pumpkin salt-tolerant materials, using the above-mentioned KASP primer combination for detecting pumpkin salt-tolerant molecular markers, comprises the following steps:

[0021] (1) extracting genomic DNA from the material parts of the pumpkin to be screened;

[0022] (2) using the above-mentioned KASP primer combination for detecting the molecular marker of pumpkin salt tolerance, amplifying and detecting pumpkin genomic DNA by fluorescence quantitative PCR instrument;

[0023] (3) The salt sensitivity of the pumpkin to be screened is determined by the amplification test results. If the mutation site detection results of the molecular marker are all C, the pumpkin to be screened is a homozygous salt-tolerant material; if the mutation site detection results of the molecular marker are all T, the pumpkin to be screened is a homozygous salt-sensitive material; if the mutation site detection results of the molecular marker are C and T, the pumpkin to be screened is a heterozygous salt-tolerant material.

[0024] Preferably, in step (3), the salt sensitivity of the pumpkin to be screened is determined by amplification detection results, specifically:

[0025] If the color of the fluorescent signal of the PCR amplification result is consistent with the color of the fluorescent linker of the salt-sensitive site bound to the upstream primer (SEQ ID NO.2), the pumpkin to be screened is a homozygous salt-tolerant material; if the color of the fluorescent signal of the PCR amplification result is consistent with the color of the fluorescent linker of the salt-tolerant site bound to the upstream primer (SEQ ID NO.3), the pumpkin to be screened is a homozygous salt-sensitive material; otherwise, the pumpkin to be screened is a heterozygous salt-tolerant material.

[0026] Preferably, the pumpkin material parts described in step (1) include detection parts such as leaves.

[0027] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0028] 1. The KASP primer combination for detecting molecular markers of pumpkin salt tolerance of the present invention is obtained by identifying salt tolerance of two parents (salt-tolerant and salt-sensitive) and their reciprocal cross F1 at the seedling stage, finding that salt tolerance is dominantly inherited, then resequencing the two parents, screening differential sites, constructing a genetic linkage map for the F2 generation, performing QTL positioning, performing bioinformatics analysis on the QTL interval, screening functional mutation sites, and verifying through natural populations, thereby obtaining primers designed for pumpkin salt tolerance-related gene sites.

[0029] 2. After searching the mutation sites of the present invention, no identical pumpkin salt tolerance sites were found in the literature.

[0030] 3. The experimental results of the present invention show that the pumpkin salt-tolerance molecular marker and the KASP primer combination of the molecular marker of the present invention can achieve complete consistency between the gene detection result and the salt-tolerance phenotypic result in the pumpkin salt-tolerance screening and detection process; it can be seen that the pumpkin salt-tolerance molecular marker and the KASP primer combination of the molecular marker of the present invention can significantly distinguish between extremely salt-tolerant and salt-sensitive materials, and can be used for the creation of salt-tolerant Indian pumpkin germplasm resources and variety breeding.

[0031] 4. The molecular marker KASP primer combination of the present invention is used for the screening of pumpkin salt-tolerant materials and variety breeding, and has the characteristics of high efficiency, high accuracy and no pollution. DETAILED DESCRIPTION

[0032] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. In addition, the technical solutions between the various embodiments can be combined with each other, but they must be based on the ability of ordinary technicians in this field to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0033] At present, pumpkin salt tolerance identification has the disadvantages of long period, high cost and low accuracy. In order to solve the above technical problems, the present invention proposes a pumpkin salt tolerance molecular marker and its KASP primer combination and application.

[0034] Embodiment 1:

[0035] Experimental materials: a salt-tolerant pumpkin material P74, a salt-sensitive material P54 and their reciprocal cross F1, F2 obtained by self-pollination of F1 and derived F2:3 family population. The two parental materials are recorded in the article "Zhang Leichen, Xing Nailin, Ying Quansheng, et al. Screening of salt-tolerant materials of different types of pumpkins [J]. Chinese Vegetables, 2017, 30(6):5". The public can obtain the melon variety from the applicant within 20 years from the date of application, only for repeating the experiments related to the present invention.

[0036] Experimental steps: P74, P54, F1, and F2 were soaked and germinated. After sowing in plug trays, the salt tolerance of seedlings was identified at the 1-leaf 1-heart stage. The identification method was to treat with 240mmol / L sodium chloride for 1 week, and then investigate the salt damage index. It was found that pumpkin salt tolerance was dominant. The leaves of parents, F1, and F2 were sampled and DNA was extracted. The parents were resequenced to detect the difference sites between the parents. The segregation ratio chi-square test of the sites was performed based on the F2 population, and the markers with p<0.001 were filtered out to construct a high-density genetic linkage map consisting of 1968 sites. After F2 was planted, it was self-pollinated to obtain the F2:3 family population. After sowing, the salt tolerance of seedlings was identified again with the parents and F1, and the salt damage index was investigated. The phenotypes of the F2 and F2:3 family populations were combined with the genetic linkage map, and the phenotypic traits were scanned and located by QTL using the Interval Mapping method using the MapQTL5 software. The results repeatedly detected a site located at the SNP position of EcoRI-1740; the pumpkin salt tolerance molecular marker corresponding to the SNP site, the sequence of the molecular marker is shown in SEQ ID NO.1:

[0037] AATTCTTAGTAAATCATTAGTTATTTGGGGTTGGGATGTTGGGATGTTGGGTGTT n CTTTTTCT ACTTATTCTATGATTTGATTGTTTTCAGTTGTTTTTAGTGTTTGCA;

[0038] Where n is T / C; when n is T, the phenotype corresponding to the T genotype is salt-sensitive; when n is C, the phenotype corresponding to the C genotype is salt-tolerant.

[0039] Moreover, the pumpkin salt tolerance molecular marker is closely linked to the gene CmaCh04G000710.1, and the CmaCh04G000710.1 gene has a highly homologous domain with Gnk2, which is related to environmental stress and participates in active oxygen metabolism. Therefore, the gene was preliminarily identified as a pumpkin salt tolerance-related gene.

[0040] Specifically, the mutation site of the above molecular marker is located at the nucleotide C→T mutation at position 339451 on chromosome 4 of the pumpkin reference genome published in the document "Sun H et al. (2017) Karyotype stability and unbiased fractionation in the paleo-allotetraploid Cucurbitagenomes. Molecular Plant 10: 1293-1306".

[0041] According to the mutation site sequence of the molecular marker, a KASP primer combination for detecting the molecular marker of pumpkin salt tolerance was designed, and its sequence is as follows:

[0042] The salt-sensitive site combined with the upstream primer is shown in SEQ ID NO.2:

[0043] 5'-GAAGGTGACCAAGTTCATGCTGGATGTTGGGATGTTGGGTGTTT-3';

[0044] The salt-tolerant site combined with the upstream primer is shown in SEQ ID NO.3:

[0045] 5'-GAAGGTCGGAGTCAACGGATTGGATGTTGGGATGTTGGGTGTTC-3'

[0046] The downstream primer is shown in SEQ ID NO.4:

[0047] 5'-TGCAAACACTAAAAACAACTGAAAACA-3'.

[0048] Embodiment 2:

[0049] Experimental materials: 27 Indian pumpkin germplasm resources, recorded in the article "Zhang Leichen, Xing Nailin, Ying Quansheng, et al. Screening of salt-tolerant materials of different types of pumpkins [J]. Chinese Vegetables, 2017, 30(6):5".

[0050] After the 27 materials were sown, genomic DNA was extracted from leaves, and the concentration was measured using NanoDrop 2000. Each DNA stock solution was diluted to 20 ng / ul. The KASP primer combination for detecting molecular markers of pumpkin salt tolerance described in Example 1 was used to amplify the extracted genomic DNA.

[0051] The PCR reaction system was configured as follows: 2 μL of 2xTaq DNA Polymerase Mix, 1 μL of SNP Primer Mix (4x), and 2 μL of DNA sample.

[0052] The PCR steps are shown in Table 1.

[0053] Table 1 PCR steps

[0054]

[0055] SNP site detection uses the fluorophores FAM and VIC to distinguish two isogenic sites. Passive reference dye ROX is used to correct the signal difference between wells due to reaction volume errors. The relevant excitation and emission wavelengths are shown in Table 2. The reading software is OEM equipment from LGC.

[0056] Table 2 Related excitation and emission wavelengths

[0057]

[0058] The genotype reading software (Kluster Caller) of LGC_OMEGA was used to analyze the result data of PCR amplification. The relative fluorescence values ​​corresponding to VIC and FAM of each PCR reaction well were obtained. According to the relative fluorescence values, the samples were clustered and further determined according to the sample clusters and fluorescence types. The genotype and phenotype results of the tested samples are shown in Table 3.

[0059] Table 3 Sample genotypes and phenotypes

[0060]

[0061] The results showed that the genotype and phenotype were completely consistent. The salt damage index of 10 materials with genotype C / C was less than 10%, the genotypes of 10 materials with salt damage index between 10% and 20% were C / T, C / C and T / T, and the salt damage index of 7 materials with genotype T / T was greater than 20%. This showed that although there were other salt tolerance-related genes in Indian pumpkin besides the genes related to this marker, this marker could significantly distinguish between extremely salt-tolerant and salt-sensitive materials, and could be used for the creation of salt-tolerant Indian pumpkin germplasm resources and variety breeding.

[0062] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0063] 1. The KASP primer combination for detecting molecular markers of pumpkin salt tolerance of the present invention is obtained by identifying salt tolerance of two parents (salt-tolerant and salt-sensitive) and their reciprocal cross F1 at the seedling stage, finding that salt tolerance is dominantly inherited, then resequencing the two parents, screening differential sites, constructing a genetic linkage map for the F2 generation, performing QTL positioning, performing bioinformatics analysis on the QTL interval, screening functional mutation sites, and verifying through natural populations, thereby obtaining primers designed for pumpkin salt tolerance-related gene sites.

[0064] 2. After searching the mutation sites of the present invention, no identical pumpkin salt tolerance sites were found in the literature.

[0065] 3. The experimental results of the present invention show that the pumpkin salt-tolerance molecular marker and the KASP primer combination of the molecular marker of the present invention can achieve complete consistency between the gene detection result and the salt-tolerance phenotypic result in the pumpkin salt-tolerance screening and detection process; it can be seen that the pumpkin salt-tolerance molecular marker and the KASP primer combination of the molecular marker of the present invention can significantly distinguish between extremely salt-tolerant and salt-sensitive materials, and can be used for the creation of salt-tolerant Indian pumpkin germplasm resources and variety breeding.

[0066] 4. The molecular marker KASP primer combination of the present invention is used for the screening of pumpkin salt-tolerant materials and variety breeding, and has the characteristics of high efficiency, high accuracy and no pollution.

[0067] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker for salt tolerance of pumpkin, characterized in that: The sequence of the molecular marker is shown in SEQ ID NO.1: AATTCTTAGTAAATCATTAGTTATTTGGGTTGGGATGTTGGGATGTTGGGTGTT n CTTTTTCT ACTTATTCTATGATTTGATTGTTTTCAGTTGTTTTTAGTGTTTGCA; Where n is T / C; when n is T, the phenotype corresponding to the T genotype is salt-sensitive; when n is C, the phenotype corresponding to the C genotype is salt-tolerant.

2. Use of the pumpkin salt-tolerance molecular marker according to claim 1 in pumpkin salt-tolerance material screening or pumpkin salt-tolerance breeding.

3. The use of the pumpkin salt-tolerance molecular marker according to claim 2 in pumpkin salt-tolerance material screening or pumpkin salt-tolerance breeding, characterized in that: The pumpkin is at least one of Chinese pumpkin or Indian pumpkin.

4. A KASP primer combination for detecting molecular markers of salt tolerance in pumpkin, characterized in that: The salt-tolerance molecular marker for pumpkin described in claim 1 was designed and obtained, and the sequence is as follows: The salt-sensitive site binding upstream primer is shown in SEQ ID NO.2; The salt-tolerant site binding upstream primer is shown in SEQ ID NO.3; The downstream primer is shown as SEQ ID NO.

4.

5. A kit for detecting salt tolerance of pumpkin, characterized in that: The invention comprises the KASP primer combination for detecting the molecular marker of salt tolerance of pumpkin as described in claim 4.

6. Use of the KASP primer combination for detecting molecular markers of pumpkin salt tolerance according to claim 4 in pumpkin salt tolerance material screening or pumpkin salt tolerance breeding.

7. A method for screening pumpkin salt-tolerant materials, characterized in that: The use of the KASP primer combination for detecting the molecular marker of salt tolerance of pumpkin as described in claim 4 comprises the following steps: (1) extracting genomic DNA from the material parts of the pumpkin to be screened; (2) using the above-mentioned KASP primer combination for detecting the molecular marker of pumpkin salt tolerance, amplifying and detecting pumpkin genomic DNA by fluorescence quantitative PCR instrument; (3) The salt sensitivity of the pumpkin to be screened is determined by the amplification test results. If the mutation site detection results of the molecular marker are all C, the pumpkin to be screened is a homozygous salt-tolerant material; if the mutation site detection results of the molecular marker are all T, the pumpkin to be screened is a homozygous salt-sensitive material; if the mutation site detection results of the molecular marker are C and T, the pumpkin to be screened is a heterozygous salt-tolerant material.

8. The method for screening pumpkin salt-tolerant materials according to claim 7, characterized in that: In step (3), the salt sensitivity of the pumpkin to be screened is determined by the amplification test result, specifically: if the color of the fluorescent signal of the PCR amplification result is consistent with the color of the fluorescent linker of the salt-sensitive site combined with the upstream primer SEQ ID NO.2, the pumpkin to be screened is a homozygous salt-tolerant material; if the color of the fluorescent signal of the PCR amplification result is consistent with the color of the fluorescent linker of the salt-tolerant site combined with the upstream primer SEQ ID NO.3, the pumpkin to be screened is a homozygous salt-sensitive material; Otherwise, the pumpkins to be screened are heterozygous salt-tolerant materials.

9. The method for screening pumpkin salt-tolerant materials according to claim 7, characterized in that: The pumpkin material part described in step (1) includes a leaf detection part.

Images