InDel molecular marker primer related to muskmelon variety identity recognition and application of InDel molecular marker primer
Through the application of InDel molecular marker and specific primer MS179, the problems of identification of authenticity and hybrid purity of melon varieties were solved, and rapid and accurate identification was achieved, and the legitimate rights and interests of melon breeding units were protected.
Patent Information
- Application Number
- CN202510302591.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-14
- Publication Date
- 2025-05-02
AI Technical Summary
It is difficult to quickly and accurately identify the authenticity and hybrid purity of melon varieties, especially in the process of artificial hybrid seed production.
The authenticity and hybrid purity of the melon variety ‘Oriental Milk No. 4’ were identified by PCR amplification and agarose gel electrophoresis. The specific primer MS179 was able to distinguish ‘Oriental Milk No. 4’ from its parent and other melon varieties, with bands of PCR products of 276bp and 249bp in lengths for identification.
The rapid and accurate identity identification and hybrid purity identification of the melon variety "Oriental Mi 4" have been achieved, providing a scientific basis to protect intellectual property rights and avoiding the infringement of biological confounding and counterfeiting.
Smart Images
Figure FT_1 
Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology and crop breeding, and in particular relates to an InDel molecular marker primer related to the identification of melon varieties and an application thereof. Background Art
[0002] melon( Cucumis melo L. ) is among the world's "Top Ten Fruits". Due to its advantages such as short cultivation cycle and relatively high input-output, melon has become one of my country's important economic crops.
[0003] 'Oriental Honey No. 4' is a new hybrid first-generation thick-skinned melon variety independently bred by the Horticultural Research Institute of the Shanghai Academy of Agricultural Sciences. It has obtained the Plant Variety Rights Certificate of the Ministry of Agriculture and Rural Affairs of the People's Republic of China (Variety Rights No.: CNA20221006752). Its full growth period in spring cultivation is about 110 days, in summer and autumn cultivation is about 80 days, and the fruit development period is 40-45 days. The fruit is oval, with yellow skin and full net pattern, and the single fruit weighs about 2kg. The flesh is orange-red and about 4cm thick. The flesh is crispy, refreshing and juicy. The soluble solids content in the center is more than 16%, and the taste and flavor are good. This variety has good comprehensive resistance, easy fruit setting, good yield, moisture resistance, low temperature and weak light resistance, and is suitable for cultivation in various facilities and protected areas. Once launched, this variety has been widely welcomed by the market. It has been demonstrated and promoted in many places across the country and has good market development prospects.
[0004] At present, melon hybrids have been widely used in my country, but there are still many problems in the process of artificial hybrid seed production, such as lax isolation or untimely and incomplete artificial emasculation, and biological contamination caused by the mixing of maternal inbred line seeds or melon pollen from other unknown sources. Therefore, hybrids must pass purity identification before packaging and sales. In addition, during the circulation of seeds, counterfeiting occurs from time to time, which seriously infringes on the legitimate rights and interests of melon breeding units and breeders. Therefore, it is necessary to develop a method for quickly and accurately identifying the authenticity of melon hybrids and the purity of hybrids. Summary of the invention
[0005] The technical problem to be solved by the present invention is how to quickly and accurately identify the authenticity of melon varieties and the purity of hybrids.
[0006] To solve the above problems, the present invention first provides an application of an InDel molecular marker, wherein the InDel molecular marker is a DNA fragment having a nucleotide sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2, and the application is an application of the InDel molecular marker in any of the following: A1) Identify the authenticity of the melon variety 'Dongfangmi No. 4'; A2) Identification of the hybrid purity of the melon variety 'Dongfangmi 4'.
[0007] The present invention also provides an application of a substance for detecting an InDel molecular marker, wherein the InDel molecular marker may be the above-mentioned InDel molecular marker, and the application may be an application of the substance in any of the following: B1) Identify or assist in identifying the melon variety 'Dongfangmi 4'; B2) Preparation of products for identification or auxiliary identification of melon variety 'Dongfangmi 4'.
[0008] In the above application, the substance may contain PCR primers for amplifying a melon genomic DNA fragment including the InDel molecular marker.
[0009] The present invention also provides a reagent or a kit for identifying the melon variety 'Dongfangmi No. 4', wherein the reagent or the kit contains the PCR primers.
[0010] The present invention also provides a method for identifying the authenticity of a melon variety, comprising the following steps: using the genomic DNA of the melon to be identified as a template, performing PCR amplification using the InDel primer pair shown by SEQ ID NO: 3 and SEQ ID NO: 4, detecting the obtained PCR product by agarose gel electrophoresis, and determining the melon variety to be identified according to the following method: If the PCR amplification product of the melon to be identified is shown as two bands in gel electrophoresis, with lengths of 276 bp and 249 bp respectively, the melon to be identified is or is a candidate for 'Dongfangmi 4'; otherwise, the melon to be identified is or is a candidate for non-'Dongfangmi 4'.
[0011] In the above method, the nucleotide sequences of the two bands with lengths of 276 bp and 249 bp may be a DNA fragment with a nucleotide sequence of SEQ ID NO: 1 and a DNA fragment with a nucleotide sequence of SEQ ID NO: 2, respectively.
[0012] The present invention also provides a method for identifying the authenticity of the melon variety 'Dongfang Mi No. 4', comprising using the genomic DNA of the melon to be identified as a template, performing PCR amplification using the InDel primers or the reagent or the kit to obtain a PCR product, if the PCR product is displayed as two DNA bands in gel electrophoresis, with lengths of 276 bp and 249 bp respectively, the melon to be identified is 'Dongfang Mi No. 4', otherwise, the melon to be identified is not 'Dongfang Mi No. 4'.
[0013] The present invention also provides a method for identifying the purity of melon seeds of the variety 'Dongfang Mi No. 4', comprising: using the genomic DNA of the melon seeds to be identified as a template, performing PCR amplification with the InDel primers or the reagent or the kit to obtain a PCR product, and identifying the purity of the melon seeds to be identified according to the agarose gel electrophoresis detection result of the PCR product; If the PCR product is shown as two DNA bands in gel electrophoresis, with lengths of 276 bp and 249 bp respectively, the melon hybrid to be identified is 'Dongfang Mi No. 4'; otherwise, the melon to be identified is not 'Dongfang Mi No. 4'.
[0014] The method comprises the steps of using the genomic DNA of the melon to be identified as a template, performing PCR amplification with the InDel molecular marker primer to obtain a PCR product, performing agarose gel electrophoresis on the PCR product and identifying it according to the imaging results of an ultraviolet gel imager.
[0015] In the above method, the lengths of the two DNA bands are 276 bp and 249 bp respectively; the nucleotide sequence corresponding to the band with a length of 276 bp is shown in SEQ ID NO: 1, and the nucleotide sequence corresponding to the band with a length of 249 bp is shown in SEQ ID NO: 2.
[0016] In the above, the melon to be identified can be selected from Dongfang Mi No. 4, M06-1-3, M15-3, Dongfang Mi No. 1, Dongfang Mi No. 3, Dongfang Mi No. 2, DM4, Jin Shuai, Huang Hua, Jin Miyue, Jin Milang, Jiutai No. 1, Dongfang Mi No. 5, Sunshine 86 King, Dongfang Mi No. 6, Du Mi No. 5, Xizhou Mi No. 25, Xizhou Mi No. 17, Du Mi Green 25, Dongfang Mi No. 7, Su Tian Bi Yu, Bachu Liuxiang Melon, Dongfang Mi No. 8, Pearl No. 7, Sanxiong No. 5, Pearl No. 3, Yu Gu, Pearl No. 4, Chinese Crisp Pear, Pearl No. 5, Su Tian No. 4, Xiboluoto No. 2, Qingmi No. 1, Zhengtai Net Pattern No. 5, Cuitian, Berg, Mario, Xinniu Meilong No. 3, Bingtang Xueli, Ansheng Tiantaro 101, Apo Gua, Miyuan 18, Jintian No. 1, Pearl No. 2, Pearl No. 6 and Huozhou Mi 186.
[0017] The present invention discloses a specific InDel molecular marker for rapid identification of a first-generation melon hybrid variety 'Dongfang Mi No. 4' and hybrid purity identification. The molecular marker can not only be used to rapidly and accurately distinguish the melon hybrid 'Dongfang Mi No. 4' from 43 common melon varieties currently on the market, but can also be used to rapidly and accurately identify the hybrid purity of 'Dongfang Mi No. 4', thereby providing a scientific basis for variety authenticity identification, hybrid purity and intellectual property protection of the new melon variety 'Dongfang Mi No. 4'. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 The amplification map of InDel primer MS179 in 'Dongfang Mi 4' and its parents and 43 different melon varieties. M is a 500bp ladder; P1 is the male parent of Dongfang Mi 4 M15-3; P2 is the female parent of Dongfang Mi 4 M06-1-3; 1 is Dongfang Mi 4; 2-44 are melon varieties, see Table 1 for details; CK is a negative control. DETAILED DESCRIPTION
[0019] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.
[0020] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0021] Example 1: Mining InDel molecular marker primers related to melon variety identification and establishment of a detection method 1. Mining of InDel molecular marker primers related to melon variety identification 1.1 Genomic DNA extraction (1) Take 1 cm 2 About 10 ... (2) Place the 2 mL centrifuge tube in a 65°C water bath for 1 h, inverting and mixing every 15 min. (3) After the water bath is completed, add 900 μL of chloroform, shake vigorously to mix, and centrifuge at 12,000 rpm for 10 min; (4) Pipette 750 μL of supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol solution, mix well, and place at -20°C overnight; (5) Centrifuge at 12,000 rpm for 10 min, discard the supernatant, add 500 μL 75% ethanol to wash the precipitate, centrifuge at 12,000 rpm for 10 min, and discard the supernatant; (6) Place the 1.5 mL centrifuge tube in a fume hood to dry, add 30 μL of sterile water, tap the tube several times to ensure that all the DNA is dissolved, and place at -20°C until ready for use.
[0022] CTAB extraction solution (1 L)
[0023] 1.2 Whole-genome resequencing and InDel primer mining The seedling leaves of the first-generation melon hybrid variety 'Dongfangmi 4' and its male parent M15-3 and female parent M06-1-3 were quickly frozen in liquid nitrogen and sent to Shanghai Lingen Biotechnology Co., Ltd. for whole genome resequencing. After data quality control, clean data were obtained. The sequencing reads were compared with the melon whole genome melon DHL92 genome ( http: / / cucurbitgenomics.org / organism / 3 ) gene sequences were compared to screen for InDel sites that differed between the paternal and maternal parents. Primers were designed in the conservative regions on both sides of the differential sites using Primer Primer 5.0 software. The primer fragment length was between 20 and 25 bp, the PCR amplification product length was between 180 and 300 bp, and the annealing temperature was between 55 and 61 °C. A total of 200 pairs of InDel primers were designed and commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0024] 1.3 PCR amplification system and amplification procedure The PCR reaction system is shown in the table below. The reaction procedure is 94℃ pre-denaturation for 3min, then 94℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles, and finally 72℃ extension reaction for 10min. The PCR product was detected by electrophoresis using 4% agarose gel (preparation method: agarose 2g, TAE buffer 50ml), 100V constant voltage electrophoresis for 80min, and photographed by UV gel imager.
[0025] PCR reaction system
[0026] 2 Results and Analysis 2.1 InDel marker screening 200 pairs of synthetic InDel molecular marker primers were screened and verified, and a pair of specific primers MS179 was obtained, which can distinguish the melon hybrid variety 'Dongfangmi No. 4' from its parents and 43 other common melon varieties in the market. Figure 1Figure 1 is the amplification map of InDel primer MS179 in 'Dongfang Mi 4' and its parents and other 43 different melon varieties. Specifically, the melon variety 'Dongfang Mi 4' has two specific bands, which are 276bp and 249bp in length respectively; its male parent M15-3 only shows one band, which is 249bp in length; its female parent M06-1-3 only shows one band, which is 276bp in length; and the other 43 melon varieties all show only one band, which is 276bp in length, and there is no band of 249bp ( Figure 1 ), Figure 1 M in the middle represents 500bp ladder; P1 is the male parent M15-3 of 'Dongfang Mi 4', P2 is the female parent M06-1-3 of 'Dongfang Mi 4', and the melon varieties of 1-44 are shown in Table 1, and CK is the negative control.
[0027] The sequence information of the specific InDel primer MS179 is as follows:
[0028] After sequencing, the specific band of 276 bp in 'Dongfang Mi No. 4' and its parent 'M06-1-3' is sequence 1 (SEQ ID NO: 1) in the sequence list, as follows: 5'-CCCCTACCGTGCTCAAACTTTCGATGCCCCTACCATTCTTCGGATATAGCATCTCTTTGTTTAAGGGCATTTCGGTATACATATAAGAGCGACAAAAGGGAAGTCTGAGCGGCAAGGAAGAAATCCTTGCATGTTTAT CAAGAATCCTTCGAACATGCAAGGAAGGGTTTTGGAGGCAAGGTGGAAGCCCAATCATTCAACAAAACCAAATAGAGGGAGGAGAGGTTTCGGAGGCAACACGTGGATTGGAAGCCGCCAATGAAACGAAGGAC-3'.
[0029] The specific band of 249 bp in 'Dongfang Mi No. 4' and its male parent 'M15-3' is sequence 2 (SEQ ID NO: 2) in the sequence list, as follows: 5'-CCCCTACCGTGCTCAAACTTTCGATGCCCCTACCATTCTTCGGATATAGCATCTCTTTGTTTAAGGGCATTTCGGTATACATATAAGAGCGAGAAATCCTTGCATGTTTATCAAGAATCCTCTTC GAACATGCAAGGAAGGGTTTTGGAGGCAAGGTGGAAGCCCAATCATTCAACAAAACCAAATAGAGGGAGGAAGGGTTTCGGAGGCAACACGTGGATTGGAAGCCGCCAATGAAACGAAGGAC-3'.
[0030] The difference between sequence 1 and sequence 2 is that sequence 2 lacks nucleotides 92 to 118 in sequence 1.
[0031] The above experimental results show that the specific primer MS179 can distinguish 'Dongfang Mi 4' from its male parent 'M15-3' and female parent 'M06-1-3' as well as the 43 melon varieties in Table 1. The specific primer MS179 can be used to identify the authenticity of 'Dongfang Mi 4' and the purity of hybrids.
[0032] The authenticity identification method of 'Dongfang Mi No. 4' includes: using the genomic DNA of the melon to be tested as a template, using the specific InDel primer MS179 (the forward and reverse primer sequences are SEQ ID NO: 3 and SEQ ID NO: 4, respectively) to perform PCR amplification according to step 1.3 to obtain the PCR product of the melon to be tested, performing agarose gel electrophoresis detection on the PCR product of the melon to be tested according to step 1.3 and taking photos for observation, if the PCR amplification map of the melon to be tested contains two specific DNA bands (with lengths of 276 bp and 249 bp, respectively), the melon variety to be tested is 'Dongfang Mi No. 4', and other band types that do not meet the above conditions are not 'Dongfang Mi No. 4'.
[0033] The method for detecting the purity of a hybrid of the muskmelon variety 'Dongfang Mi No. 4' comprises taking the genomic DNA of the muskmelon hybrid to be detected as a template, performing PCR amplification according to step 1.3 using the specific InDel primer MS179 (the forward and reverse primer sequences are SEQ ID NO: 3 and SEQ ID NO: 4, respectively), performing agarose gel electrophoresis detection on the obtained PCR product according to step 1.3, if the PCR amplification map of the muskmelon hybrid to be detected contains two specific DNA bands (with lengths of 276 bp and 249 bp, respectively), the muskmelon seed to be identified is a hybrid of 'Dongfang Mi No. 4', otherwise other band types that do not meet the above conditions are not hybrids of 'Dongfang Mi No. 4', and the seed purity of the hybrid of 'Dongfang Mi No. 4' to be detected can be obtained according to the formula: 'Dongfang Mi No. 4' hybrid purity % = (the number of plants (seeds) containing two specific bands / the total number of detection groups (seeds)*100%).
[0034] This study selected 44 melon varieties commonly found in the market, including 22 types of Hami melons, 12 types of cantaloupe melons, 6 types of netted melons, and 4 types of thin-skinned melons. Detailed information is shown in Table 1.
[0035] Table 1 Information of 44 melon samples tested
[0036]
[0037]
[0038] Example 2: Identification of the Hybrid Purity of the Melon Variety 'Dongfangmi 4' A batch of hybrid samples of the melon variety 'Dongfang Mi No. 4' (one seed batch) was tested. Primary samples were taken from 10 points randomly distributed in the seed batch, 10g at each point, and mixed evenly to obtain a mixed sample. 200 seeds were randomly selected from the mixed sample as test samples. The test samples were sown in a 50-hole plug tray, one seed per hole. After the cotyledons were flattened, 1cm of each sample was taken. 2The genomic DNA was extracted from the left and right young cotyledons according to the step 1.1. The genomic DNA of each sample was used as a template and PCR amplification was performed with the specific InDel primer MS179 according to 1.3 (SEQ ID NO: 3 was used as the forward primer and SEQ ID NO: 4 was used as the reverse primer). The obtained PCR products were detected by electrophoresis according to 1.3. The detection results showed that among the 200 seeds detected, 198 seeds had 2 specific DNA bands (lengths of 276 bp and 249 bp, respectively) in the PCR product amplification map, and they were identified as the 'Dongfang Mi No. 4' hybrid; among the 200 seeds detected, 2 seeds had only 1 DNA band (length of 276 bp) in the PCR product amplification map, and they were identified as non-'Dongfang Mi No. 4' hybrids. The hybrid purity of this batch of 'Dongfang Mi No. 4' is 99% (calculation formula: 'Dongfang Mi No. 4' hybrid purity % = (number of plants (seeds) containing two specific bands of 276bp and 249bp / total number of tested populations (seeds)*100%).
[0039] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including changes that have departed from the disclosed scope in the application and are made with conventional techniques known in the art.
Claims
1. Application of InDel molecular markers, characterized in that: The InDel molecular marker is a DNA fragment having a nucleotide sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2, and the application is the application of the InDel molecular marker in any of the following: A1) Identify or assist in identifying the melon variety 'Dongfangmi 4'; A2) Preparation of products for identification or auxiliary identification of melon variety 'Dongfang Mi 4'.
2. Application of detecting substances labeled with InDel molecules, characterized in that: The InDel molecular marker is the InDel molecular marker according to claim 1, and the application is the application of the substance in any of the following: B1) Identify or assist in identifying the melon variety 'Dongfangmi 4'; B2) Preparation of products for identification or auxiliary identification of melon variety 'Dongfangmi 4'.
3. The use according to claim 2, characterized in that: The material contains PCR primers for amplifying a melon genomic DNA fragment containing the InDel molecular marker.
4. The use according to claim 3, characterized in that The PCR primers are a primer pair named MS179, which are composed of two single-stranded DNAs shown in SEQ ID NO: 3 and SEQ ID NO:
4.
5. A reagent or kit for identifying or assisting in identifying the melon variety 'Dongfangmi No. 4', characterized in that: The reagent or kit contains the PCR primers described in claim 3 or 4.
6. A method for identifying or assisting in identifying a melon variety, characterized in that: The method comprises the following steps: using the genomic DNA of the melon to be identified as a template, performing PCR amplification using a PCR primer pair consisting of two single-stranded DNAs shown in SEQ ID NO: 3 and SEQ ID NO: 4, detecting the obtained PCR products by gel electrophoresis, and determining the melon variety to be identified according to the following method: If the PCR amplification product of the melon to be identified shows two bands in gel electrophoresis, the melon to be identified is or is a candidate for 'Dongfang Mi 4'; if the PCR amplification product of the melon to be identified does not show two bands in gel electrophoresis, the melon to be identified is or is a candidate for non-'Dongfang Mi 4'.
7. The method according to claim 6, characterized in that The two bands are a DNA fragment having a nucleotide sequence of SEQ ID NO: 1 and a DNA fragment having a nucleotide sequence of SEQ ID NO:
2.
8. A method for identifying the authenticity of the melon variety 'Dongfang Mi No. 4', comprising using the genomic DNA of the melon to be identified as a template, performing PCR amplification using the PCR primers described in claim 3 or 4 or the reagent or kit described in claim 5 to obtain a PCR product, If the PCR product shows two DNA bands in gel electrophoresis, the melon to be identified is 'Dongfang Mi No. 4'; if the PCR product does not show two DNA bands in gel electrophoresis, the melon to be identified is not 'Dongfang Mi No. 4'.
9. A method for identifying the purity of seeds of the melon variety 'Dongfang Mi No. 4', comprising using the genomic DNA of the melon seeds to be identified as a template, performing PCR amplification using the PCR primers described in claim 3 or 4 or the reagent or kit described in claim 5 to obtain a PCR product, and identifying the purity of the melon seeds to be identified based on the PCR product; If the PCR product shows two DNA bands in gel electrophoresis, the melon to be identified is 'Dongfang Mi No. 4'; if the PCR product does not show two DNA bands in gel electrophoresis, the melon to be identified is not 'Dongfang Mi No. 4'.
10. The method according to claim 8 or 9, characterized in that: The lengths of the two DNA bands are 276 bp and 249 bp respectively; the band with a length of 276 bp is SEQ ID NO: 1, and the band with a length of 249 bp is SEQ ID NO: 2.