Molecular identification method for accelerating breeding of new soft rice variety
Through genomic DNA extraction and PCR amplification technology, combined with KASP marker for genotyping, the problem of complex and cost-effective detection of traditional rice amylose content detection methods is solved, and the efficiency and accuracy of breeding of new soft rice rice varieties is achieved, shortening the breeding cycle and reducing costs.
Patent Information
- Application Number
- CN202510333118.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-05-02
AI Technical Summary
The traditional rice amylose content detection method is complex and costly, resulting in the slow breeding process of new soft rice rice varieties, and it is impossible to complete the screening of target varieties in the contemporary era.
By extracting the genomic DNA of rice leaves, designing and synthesizing specific primers for Wx gene segments, using PCR amplification technology and KASP markers for genotyping, and quickly screening out new soft rice rice varieties with excellent food quality.
It improves the efficiency and accuracy of the breeding of new soft rice varieties, shortens the breeding cycle, reduces the breeding cost, and can screen target traits in the early stages of rice growth, avoiding the cumbersome process of multi-generation screening in traditional breeding methods.
Smart Images
Figure CN119913283A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of agricultural biological breeding, and in particular to a molecular identification method for accelerating the breeding of new soft rice varieties. Background Art
[0002] Soft rice is a new type of rice between glutinous rice and sticky rice. Its endosperm is turbid and opaque, the rice is moist and refreshing, the texture is soft and elastic, and it does not regenerate when cold. The content of amylose is the main indicator for breeding new varieties of soft rice, and different scholars have proposed different standards for the content of amylose. Some scholars proposed that the glutinous content is ≤2.0%, the extremely low content type is 2.1%-9%, the low content type is 9.1%-20%, the medium content type is 20.1%-25%, and the high content type is ≥25.0%; some scholars have proposed a standard of 9%-15% amylose content for indica soft rice. Combined with relevant research results, the new definition of soft rice is a stable variety with an average amylose content of 9%-13%, and it is no longer divided into indica and japonica.
[0003] Soft rice is highly favored in the international market for its unique cooking and taste qualities. The breeding of new varieties of soft rice has gradually attracted the attention of breeders. The breeding of new varieties of soft rice requires multiple generations of screening and identification through hybridization, backcrossing, and multiple crosses. In the traditional method of detecting the content of amylose in rice, the sample pretreatment steps are complicated and the cost is high. The rice needs to be stored for a period of time after harvest before it can be detected. Since the content of amylose cannot be evaluated visually in the field, the screening of varieties with target amylose content cannot be completed in modern times, which is the main reason for the slow progress of the breeding of new varieties of soft rice. Therefore, the rapid determination of the content of amylose in rice is the key to accelerating the breeding of new varieties of soft rice. Summary of the invention
[0004] 1. Technical issues to be resolved
[0005] In view of the shortcomings of the prior art, the present invention provides a molecular identification method for accelerating the breeding of new soft rice varieties, which solves the problems raised by the above-mentioned background technology.
[0006] (II) Technical solution
[0007] To achieve the above objectives, the present invention is implemented by the following technical scheme: a molecular identification method for accelerating the breeding of new soft rice varieties, comprising the following steps:
[0008] Step 1: Extract genomic DNA from rice leaves;
[0009] Step 2: Design and synthesize primers specific to the Wx gene (granule-bound starch synthase) segment;
[0010] Step 3: Amplify the genomic DNA of rice leaves using PCR (polymerase chain reaction) amplification technology;
[0011] Step 4: After PCR amplification is completed, ARAYA (inline fluorescence detection system) is used to scan the fluorescence signal of the reaction system, and then INTELLICS (data analysis software) is used for data analysis and genotyping;
[0012] Step 5: Based on the analysis results, select the intermediate materials for improving new soft rice varieties with excellent taste quality to accelerate the breeding process of new soft rice varieties.
[0013] Gene location:
[0014] Using the F2 genetic population prepared from Snow Pearl (the name of the rice variety) and Indica rice 9311 (the name of the rice variety), 42 low-amylose plants were used to preliminarily locate the Snow Pearl low-amylose trait to the 1.04M interval between SSR3 (a simple repeat sequence marker designed by oneself when locating the Lac1 gene) and SSR6 (a simple repeat sequence marker designed by oneself when locating the Lac1 gene) on the short arm of chromosome 6, and then 573 plants were used to further locate it to the approximately 105kb interval between IND20 (an insertion-deletion marker designed by oneself when locating the Lac1 gene) and dCAPS3 (a molecular marker designed by oneself when locating the Lac1 gene);
[0015] The Wx gene (LOC_Os06g04200) in this interval was identified as a candidate gene. The 513th base G from the start codon ATG in the third exon of the Wx gene of Snow Pearl was replaced by A, and the 134th Asp of the corresponding protein was replaced by Asn, named Lac1. It was compared with the database and was found to be a new allele.
[0016] KASP (competitive allele-specific polymerase chain reaction) marker development:
[0017] OS905219_K01 and OS905219_K02 were developed for Lac1, and their primer sequences were specific;
[0018] The development and testing process includes sequence analysis, primer design and synthesis, Assay (data analysis software) verification and result analysis, analyzing sequence characteristics, designing primers and assembling PCR systems using specific software, and scanning and analyzing after conditional amplification;
[0019] Application detection:
[0020] For rice germplasm, after harvesting and drying, the seeds were crushed and sieved to obtain samples. The amylose content was measured according to the standard and the average value was taken. At the same time, the KASP marker was used to detect whether the Lac1 gene was carried and sequenced for verification.
[0021] Preferably, the specific primer is labeled with a KASP marker.
[0022] Preferably, the genomic DNA extraction step adopts the CTAB method (cetyltrimethylammonium bromide method) or a kit method.
[0023] Preferably, the PCR amplification technique includes conventional PCR or real-time fluorescence quantitative PCR.
[0024] (III) Beneficial effects
[0025] The present invention provides a molecular identification method for accelerating the breeding of new soft rice varieties, which has the following characteristics:
[0026] Beneficial effects:
[0027] 1. Improved the efficiency and accuracy of breeding new varieties of soft rice, shortened the breeding cycle, and reduced breeding costs. Through molecular marker-assisted selection, target traits can be screened at the early stage of rice growth, thus avoiding the cumbersome process of multi-generation screening in traditional breeding methods. In addition, this method can accurately identify new varieties of soft rice with excellent traits, providing strong technical support for the improvement of new varieties of soft rice and the development of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 It is a schematic diagram of gene location of the present invention;
[0029] Figure 2 A schematic diagram showing that base G is replaced by base A in the present invention;
[0030] Figure 3 It is a schematic diagram of the PCR amplification conditions of the present invention;
[0031] Figure 4 It is a schematic diagram of KASP typing of the present invention;
[0032] Figure 5 This is a schematic diagram of genotyping of 45 materials OS905219_K01 of the present invention;
[0033] Figure 6 This is a schematic diagram of genotyping of 45 materials OS905219_K02 of the present invention;
[0034] Figure 7 This is a schematic diagram of genotyping of 50 materials OS905219_K01 of the present invention;
[0035] Figure 8 This is a schematic diagram of genotyping of 50 materials OS905219_K02 of the present invention;
[0036] Fig. 9 This is a schematic diagram of genotyping of 92 materials OS905219_K01 of the present invention;
[0037] Fig.10 This is a schematic diagram of genotyping of 92 materials OS905219_K02 of the present invention. DETAILED DESCRIPTION
[0038] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0039] In order to clone the controlling gene of Snow Pearl's low amylose trait, the F2 genetic population prepared by Snow Pearl and indica rice 9311 was used for gene mapping. A preliminary linkage analysis was first performed using 42 low amylose plants, and the Snow Pearl low amylose trait was mapped to the 1.04M interval between markers SSR3 and SSR6 on the short arm of chromosome 6 ( Figure 1 A). Using 573 low-amylose plants from the F2 population, the gene controlling the low-amylose trait of Snow Pearl was further located in a physical interval of about 105 kb between markers IND20 and dCAPS3 ( Figure 1 B).
[0040] In the interval between markers IND20 and dCAPS3 ( Figure 1 B) contains a total of 16 annotated genes, among which the rice Wx gene (LOC_Os06g04200) that regulates amylose synthesis is located. Therefore, this gene is used as a candidate gene for regulating the low amylose trait of Snow Pearl. Sequencing analysis of the Wx gene of Snow Pearl found that its sequence was compared with Wxb, in which the base G at the 513th position from the start codon ATG in the third exon was replaced by the base A (e.g. Figure 2 ), resulting in the replacement of aspartic acid (Asp) at position 134 of the corresponding encoded protein by asparagine (Asn) ( Figure 1C). The single base variation of Snow Pearl's Wx gene may be the cause of its low amylose trait, so we named Snow Pearl's Wx genotype Lac1. Sequence alignment of Lac1 in the NCBI (https: / / www.ncbi.nlm.nih.gov / ) database and the Rice 3K (http: / / snp-seek.irri.org / ) database did not detect this allele variation, indicating that Lac1 is a new Wx allele that controls low amylose content.
[0041] For Lac1, we developed KASP markers OS905219_K01 and OS905219_K02, which can quickly screen soft rice materials with an amylose content between 9% and 13% and carrying this gene.
[0042] KASP marker OS905219_K01 and OS905219_K02 marker sequence information
[0043] The sequence information of OS905219_K01 is as follows:
[0044] Primer_Allele X:
[0045] GAAGGTGACCAAGTTCATGCTGACCAGTACAAGGACGCTTGGG
[0046] Primer_Allele Y:
[0047] GAAGGTCGGAGTCAACGGATTGACCAGTACAAGGACGCTTGGA
[0048] Primer_Common:
[0049] ATATGCTCCTACCTCAGCCACAACG
[0050] The sequence information of OS905219_K02 is as follows:
[0051] Primer_Allele X:
[0052] GAAGGTGACCAAGTTCATGCTTACCTCAGCCACAACGCTGGTATC
[0053] Primer_Allele Y:
[0054] GAAGGTCGGAGTCAACGGATTTACCTCAGCCACAACGCTGGTATT
[0055] Primer_Common:
[0056] GTCATGGTGATCTCTCCTCGGTACG
[0057] KASP markers OS905219_K01 and OS905219_K02 marker development and testing process:
[0058] 1. Sequence analysis:
[0059] At least 150 bp of flanking sequences upstream and downstream of the development site were extracted, and the sequence copy number and sequence GC content of the Lac1 site were analyzed.
[0060] 2. Primer design and synthesis:
[0061] Bacthprimer 3 software was used to design KASP primers for SNP sites and flanking sequences. Each set of KASP markers consisted of 2 specific primers and 1 universal primer, and a fluorescent linker sequence (GAAGGTGACCAAGTTCATGCT was a FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT was a HEX fluorescent linker sequence) was connected to the 5' end of the specific primer.
[0062] 3. Assay verification and result analysis:
[0063] KASP marker validation was performed using 96 samples on the Douglas Scientific Array Tape system. The PCR system was assembled using NEXAR (inline liquid handling and analytical processing system), and the PCR reaction system is shown in Table 1 below:
[0064] Table 1. KASP reaction system
[0065] Final concentration Actual usage 100 μM Primer C 0.42μM 0.0033μl 100 μM PrimerX 0.17μM 0.0013μl 100 μM PrimerY 0.17μM 0.0013μl 2 × KASPMasterMix 1× 0.3945μl Ultrapure water 0.3995μl DNA (dry) 20ng-50ng Total volume 0.8μl
[0066] PCR amplification was performed using SOELLEX (an ultra-high throughput endpoint polymerase chain reaction (PCR) thermal cycler using a 3-chamber water bath). Touch down PCR (Touch down PCR means that the reaction annealing temperature is reduced by 1°C or 0.5°C every other cycle until the "Touch down" annealing temperature is reached, and then about 10 cycles are performed at this annealing temperature) The amplification conditions are as follows: Figure 3 As shown: (Note: PCR cycle number is appropriately increased according to the typing situation):
[0067] After the PCR reaction is completed, ARAYA is used to scan the fluorescence signal of the reaction system; then INTELLICS is used for data analysis and genotyping.
[0068] The schematic diagram of the marker typing is as follows Figure 4 As shown, type A typing indicates that the sample contains a homozygous A allele at this KASP marker site (located in the upper left corner of the figure, the same below), type B typing indicates that the sample contains a homozygous B allele at this KASP marker site (located in the lower right corner of the figure, the same below), and heterozygous typing indicates that the sample contains a heterozygous A and B allele at this KASP marker site (located near the 45-degree axis of the coordinate axis, the same below).
[0069] Embodiment 1:
[0070] The amylose content of 45 rice germplasms was tested. The field breeding test varieties were harvested and dried to a moisture content of about 14%. 50g of full seeds were selected, and the rice flour after grinding the polished rice sample was passed through a 0.15mm aperture sieve to obtain 3g of the test sample; the amylose content was determined according to the method shown in the standard NY / T83-1988 recommended by the Ministry of Agriculture and Rural Affairs. Each sample was measured twice and the average value was taken (see Table 2). KASP markers OS905219_K01 and OS905219_K02 were used to test whether 45 rice germplasms carried the Lac1 gene (see Table 3), and the Wx gene segments of 45 rice germplasms were sequenced for the first generation (see Table 2). The results showed that OS905219_K01 and OS905219_K02 could accurately detect the Lac1 gene. The genotyping was shown in Table 2. Figure 5 , Figure 6 , and the amylose content of rice germplasm carrying this gene is 9.4%.
[0071] Table 2. Amylose content and Wx allele sequencing results of 45 rice germplasms
[0072]
[0073]
[0074]
[0075] Table 3. Results of KASP marker detection of Wx alleles in 45 rice germplasms
[0076]
[0077]
[0078]
[0079] Five rice germplasms carrying the Lac1 gene were added to the above 45 rice germplasms, and the KASP markers OS905219_K01 and OS905219_K02 were used again to detect the site in various germplasms accurately. Figure 7 , Figure 8 shown.
[0080] Test results: KASP markers OS905219_K01 and OS905219_K02 can accurately detect the G / A mutation at the 513th base from the start codon ATG in the third exon of the Wx gene in 45 rice germplasms, and this site is closely related to the amylose content of rice. One of the 45 rice germplasms was detected to carry the Lac1 gene.
[0081] Embodiment 2:
[0082] LAC1 gene detection was performed on 92 RIL (recombinant inbred line) populations constructed from Snow pearl and 9311. Among the 92 RIL populations, 21 RIL populations had turbid and opaque rice endosperm, while 71 RIL populations had transparent rice endosperm.
[0083] The amylose content (AC) of 92 RIL populations was tested. The field propagation test varieties were harvested and dried to a moisture content of about 14%. 50g of full seeds were selected, and the rice flour after the polished rice sample was crushed was passed through a 0.15mm aperture sieve to obtain 3g of test sample; the amylose content (AC) was determined according to the method shown in the standard NY / T83-1988 recommended by the Ministry of Agriculture and Rural Affairs. Each sample was measured twice and the average value was taken (see Table 4). KASP markers OS905219_K01 and OS905219_K02 were used to detect whether 92 RIL populations carried the Lac1 gene (see Table 4). The results showed that OS905219_K01 and OS905219_K02 could accurately detect the Lac1 gene. The genotyping was shown in Table 4. Fig. 9 , Fig.10 , and the amylose content of rice germplasm carrying this gene is between 9% and 13%.
[0084] Table 4. Amylose content and KASP marker sequencing results of 92 RIL populations
[0085]
[0086]
[0087]
[0088]
[0089]
[0090] Test results: KASP markers OS905219_K01 and OS905219_K02 can accurately detect the G / A mutation at the 513th base from the start codon ATG in the third exon of the Wx gene in 92 RIL populations constructed from Snow Pearl and 9311, and this site is related to the transparency of rice endosperm. Two of the 92 RIL populations were detected to carry the Lac1 gene.
[0091] In summary, the present invention improves the efficiency and accuracy of breeding new varieties of soft rice, shortens the breeding cycle, and reduces breeding costs. Through molecular marker-assisted selection, target traits can be screened at an early stage of rice growth, thereby avoiding the cumbersome process of multi-generation screening required in traditional breeding methods. In addition, the method can also accurately identify new varieties of soft rice with excellent taste quality, providing powerful technical support for the improvement of new varieties of soft rice and the development of new varieties.
[0092] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. A molecular identification method for accelerating the breeding of new soft rice varieties, characterized in that: The following steps are involved: Step 1: extracting genomic DNA from rice leaves, wherein the genomic DNA extraction step adopts a CTAB method or a kit method; Step 2: designing and synthesizing specific primers for the Wx gene segment, wherein the specific primers are marked with a KASP marker; Step 3: amplifying the genomic DNA of rice leaves using PCR amplification technology, wherein the PCR amplification technology includes conventional PCR or real-time fluorescence quantitative PCR; Step 4: After PCR amplification is completed, use ARAYA to scan the fluorescence signal of the reaction system, and then use INTELLICS for data analysis and genotyping; Step 5: Based on the analysis results, select the intermediate materials for improving new soft rice varieties.