SSR (Simple Sequence Repeat) core primer combination and kit for identifying tea variety Guangdong No.5 and application of SSR core primer combination and kit

Abstract

The invention discloses an SSR (Simple Sequence Repeat) core primer combination for identifying a tea tree variety Guangdong No.5, a kit and application. According to the invention, three pairs of SSR core primers are screened by using an SSR fluorescence labeling detection technology, and the three pairs of SSR core primers can be used for rapidly identifying and detecting Guangdong No.5 from other tea tree varieties. The SSR core primer combination disclosed by the invention can be used for identifying the variety of Guangdong tea No.5, the uncertainty of identification based on external morphological characteristics is overcome, the result is reliable and visual, the detection efficiency is high, the operation is simple and convenient, and meanwhile, the popularization, utilization and protection of the variety of Guangdong tea No.5 are also facilitated.

Description

Technical Field

[0001] The present invention relates to the technical field of variety resource identification and germplasm innovation, and in particular to an SSR core primer combination, a kit and an application thereof for identifying the tea variety Yueming No. 5. Background Art

[0002] Tea tree Yueming No. 5 is a new high-theanine tea tree variety obtained through single-plant system breeding from the Lingyun Baihao tea group in Guangxi. The dry matter of the steamed green sample of one bud and two leaves in spring contains 28.7% tea polyphenols, 8.7% amino acids (including 4.1% theanine), 3.7% soluble sugar, and 2.6% caffeine. It is suitable for making black tea and white tea. The black tea has a strong sweet and floral fragrance, and the taste is fresh and mellow; the white tea has a strong floral fragrance, and the taste is fresh, mellow and sweet. Theanine is an important flavor substance in tea, which is closely related to freshness and sweetness. In addition, theanine also has a variety of physiological health benefits, including sedation and tranquilization. Selecting and promoting functional tea varieties with high theanine content is one of the important tasks of Chinese tea breeding.

[0003] In 2014, the core tea germplasm resources in the Guangdong Tea Resource Garden were tested for biochemical components and new functional tea varieties were selected. A new high-theanine variety was selected from the Lingyun Baihao group introduced from Guangxi and named Yueming No. 5. Cutting propagation was carried out in the same year. In 2015, a variety comparison test was arranged in the garden, with the provincial fine variety Danxia No. 1 selected from the Baimao tea group as the control. From 2015 to 2017, the tea trial production, agronomic traits, biological characteristics, bud and leaf biochemical components (amino acids, theanine, tea polyphenols, caffeine, etc.) and other traits were comprehensively identified for three consecutive years. The results of the variety comparison test showed that the theanine content of 'Yueming No. 5' was higher than that of Danxia No. 1, and the tea production performance was excellent. Variety characteristics The plant grows vigorously, is a small tree type, the tree posture is semi-open, and the branches are dense. The leaves are obliquely arranged, large leaves, 16.2cm long and 4.9cm wide, mature leaves are oblong, green, slightly curled, raised, with sharp and dense teeth, gradually pointed tips, and flat leaf margins. The new shoots are green, with dense hairs, and strong tenderness. The corolla diameter is 3.7-4.1 cm, and the petals are white. It is an early-maturing variety, harvested in early March, and the weight of 100 buds in the one-bud and three-leaf stage is 132.2g.

[0004] At present, the identification of the tea variety Yue Ming No. 5 is based on the identifier's personal understanding of Yue Ming No. 5 and its external morphological characteristics. The identification results are easily affected by factors such as the developmental stage, cultivation measures, the identifier's personal ability, and the growth environment of Yue Ming No. 5, and there is great uncertainty.

[0005] Molecular marker technology has become the future development direction of variety identification and protection due to its high polymorphism, short testing cycle, and no environmental influence. Therefore, SSR molecular markers have good application prospects in variety-specific evaluation and protection. Summary of the invention

[0006] In order to overcome the above-mentioned defects and shortcomings in the prior art, the present invention provides an SSR core primer combination, a kit and an application for identifying the tea variety Yueming No. 5.

[0007] The first object of the present invention is to provide an SSR core primer combination for identifying the tea variety Yueming 5.

[0008] The second object of the present invention is to provide the use of the above-mentioned SSR core primer combination in preparing an identification product of the tea variety Yueming No. 5.

[0009] The third object of the present invention is to provide a product comprising the above-mentioned SSR core primer combination for use in identifying the tea variety Yueming No. 5.

[0010] The fourth object of the present invention is to provide a kit for identifying the tea variety Yueming No. 5.

[0011] The fifth object of the present invention is to provide a method for identifying the tea variety Yueming No. 5.

[0012] To achieve the above-mentioned purpose, the present invention provides an SSR core primer combination for identifying the tea variety Yueming 5, which comprises SSR core primers with nucleotide sequences YM5.SSR-1L, YM5.SSR-1R, YM5.SSR-2L, YM5.SSR-2R, YM5.SSR-3L and YM5.SSR-3R; wherein: the primer sequence of YM5.SSR-1L is: CCTTGAGAGGGCAAGCTATTG; the primer sequence of YM5.SSR-1R is: CCTTGAGAGGGCAAGCTATTG; the primer sequence of YM5.SSR-2R is: YM5.SSR-3L and YM5.SSR-3R; The primer sequence of R-1R: TGAAGGATTTATGTGGGCAGC; the primer sequence of YM5.SSR-2L: CAGCTGACCCACCACCTG; the primer sequence of YM5.SSR-2R: GGGTAGTCATGGCGGCAG; the primer sequence of YM5.SSR-3L: ACCCCAACACCGGTCTCT; the primer sequence of YM5.SSR-3R: ACGAGGATCCACCCTACCT.

[0013] The 5' end of the SSR core primer shown in the nucleotide sequence YM5.SSR-1L, the 5' end of the SSR core primer shown in the nucleotide sequence YM5.SSR-2L and / or the 5' end of the SSR core primer shown in the nucleotide sequence YM5.SSR-3L are labeled with a fluorescent reporter group.

[0014] The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

[0015] The application of the SSR core primer combination in preparing an identification product of the tea variety Yueming No. 5.

[0016] The product of the SSR core primer combination is used in identifying the tea variety Yueming No. 5.

[0017] A kit for identifying the tea variety Yueming No. 5, comprising the SSR core primer combination described in any one of claims 1 to 3.

[0018] The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance, and ultrapure water.

[0019] A method for identifying the tea variety Yueming No. 5, using the SSR core primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 6 to 7 for identification.

[0020] A method for identifying tea variety Yueming No. 5, comprising the following steps: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification is performed using the SSR core primer combination described in any one of claims 1 to 3; S3. Typing the PCR amplification product obtained in step S2, and performing band discrimination on the typing result: The SSR core primers shown by the nucleotide sequences YM5.SSR-1L and YM5.SSR-1R amplified two characteristic bands of 209bp and 233bp, the SSR core primers shown by the nucleotide sequences YM5.SSR-2L and YM5.SSR-2R amplified two characteristic bands of 194bp and 200bp, and the SSR core primers shown by the nucleotide sequences YM5.SSR-3L and YM5.SSR-3R only amplified one characteristic band of 285bp, indicating that the tea tree sample to be tested is Yueming No. 5; the appearance of other bands indicates that the tea tree sample to be tested is not Yueming No. 5.

[0021] The typing method described in step S3 is to perform capillary electrophoresis on the PCR amplification product; wherein the PCR amplification, the total reaction system is 10μL, including: 1μL of 10×Buffer I, 0.8μL of 2.5 mM dNTPs, 0.6μL of 2.5μM upstream primer, 0.6μL of 2.5μM downstream primer, 0.1μL of TAKARA HSTaq, 1μL of DNA, and 10μL of ddH2O; the PCR amplification reaction conditions are: pre-denaturation at 95°C for 5min; denaturation at 94°C for 30s; annealing at 60°C for 30s for 35 cycles; extension at 72°C for 30s; and finally extension at 60°C for 30min.

[0022] Advantages and effects of the present invention: The present invention discloses an SSR core primer combination, a kit and an application for identifying the tea variety Yueming No. 5. The present invention utilizes SSR fluorescent marker detection technology to screen and obtain three pairs of SSR core primers, which can quickly identify and detect Yueming No. 5 from other tea varieties. The SSR core primer combination disclosed in the present invention can accurately identify the variety of Yueming No. 5, overcomes the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, and is easy to operate. It is also conducive to the promotion, utilization and protection of the variety Yueming No. 5. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Capillary electrophoresis bands of 16 tea varieties / lines amplified by the specific SSR core primers YM5.SSR-1L and YM5.SSR-1R in Example 1.

[0024] Figure 2 Capillary electrophoresis bands of 16 tea varieties / lines amplified by the specific SSR core primers YM5.SSR-2L and YM5.SSR-2R in Example 1.

[0025] Figure 3 Capillary electrophoresis bands of 16 tea varieties / lines amplified by the specific SSR core primers YM5.SSR-3L and YM5.SSR-3R in Example 1.

[0026] Figure 4 Capillary electrophoresis bands of 25 tea varieties / lines amplified by the specific SSR core primers YM5.SSR-1L and YM5.SSR-1R in Example 2.

[0027] Figure 5 Capillary electrophoresis bands of 25 tea varieties / lines amplified by the specific SSR core primers YM5.SSR-2L and YM5.SSR-2R in Example 2.

[0028] Figure 6Capillary electrophoresis bands of 25 tea varieties / lines amplified by the specific SSR core primers YM5.SSR-3L and YM5.SSR-3R in Example 2. DETAILED DESCRIPTION

[0029] The present invention is further described below with reference to specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0030] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0031] Example 1 Screening and obtaining of specific primer sequences of Yueming No. 5 1. Experimental Methods 1. SSR primer design The MISA software was used to search the genome sequence of the tea variety Tieguanyin (https: / / www.tea-pangenome.cn / ), and the SSR loci in the genome sequence were retrieved. Primer 5.0 was used to batch design 200 pairs of SSR primers, which were synthesized by Beijing Reader Gene Technology Co., Ltd.

[0032] 2. Extraction of DNA from tea varieties Sixteen tea varieties / lines with similar genetic and phenotypical characteristics, including Yueming No. 5, Lingyun Baimao No. 4, Lingyun Baimao No. 7, Lingyun Baimao No. 10, and Lingyun Baimao No. 11, were initially screened. The tea varieties / lines used in the preliminary screening are shown in Table 1 (taken from the Guangdong Tea Germplasm Resource Bank).

[0033] Table 1 16 tea varieties / lines used in the preliminary screening

[0034] DNA was extracted from the 16 tea varieties / lines (Table 1) used in the preliminary screening. The specific steps of DNA extraction were as follows: a. Take tea leaves and add liquid nitrogen to grind them thoroughly. Weigh about 100 mg of the ground powder.

[0035] b. Quickly add 400 μL of buffer GPS and 10 μL of RNase A to the ground powder, vortex quickly to mix, and place the centrifuge tube in a 65°C water bath for 15 min. Invert the centrifuge tube several times to mix the sample during the water bath.

[0036] c. Add 100 μL of buffer GPA, vortex for 1 min, centrifuge at 12,000 rpm for 5 min, transfer the supernatant to the filter column CS, then centrifuge at 12,000 rpm for 1 min, and transfer the filtrate to a new centrifuge tube.

[0037] d. Add an equal volume of anhydrous ethanol and mix thoroughly. Flocculent precipitation may appear at this time.

[0038] e. Transfer the solution and flocculent precipitate obtained in the previous step to the RNase-Free adsorption column CR2, centrifuge at 12000rpm for 1min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0039] f. Add 550ul of deproteinized solution RD to the RNase-Free adsorption column CR2, centrifuge at 12000rpm for 1min, discard the waste liquid, and place the RNase-Free adsorption column CR2 into the collection tube.

[0040] g. Add 700uL of rinse solution PW to the RNase-Free adsorption column CR2, centrifuge at 12000rpm for 1min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0041] h. Repeat step g.

[0042] i. Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the collection tube, and then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube and dry it at room temperature for 5-10 min.

[0043] j. Add 50-100 μL of elution buffer TB to the RNase-Free adsorption column CR2, leave it at room temperature for 3-5 minutes, centrifuge it at 12000 rpm for 2 minutes, collect the solution into a centrifuge tube, and obtain the tea tree genomic DNA.

[0044] 3. PCR amplification

[0045] The tea tree genomic DNA extracted in step 2 is used as a template, and PCR amplification is performed using the SSR fluorescent marker detection technology, wherein the primers include an upstream primer with a fluorescent reporter group (the fluorescent reporter group is FAM, HEX, TAMRA, or ROX, and the FAM fluorescent marker is used in the present invention) labeled at the 5' end, and a downstream primer. The PCR amplification guided by the upstream primer with a fluorescent reporter group labeled at the 5' end produces a PCR product with fluorescence.

[0046] For PCR amplification, the total reaction system was 10 μL, including: 10×Buffer I 1 μL, 2.5 mM dNTPs 0.8 μL, 2.5 μM upstream primer 0.6 μL, 2.5 μM downstream primer 0.6 μL, TAKARA HSTaq 0.1 μL, DNA 1 μL, and ddH2O to make up 10 μL.

[0047] The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

[0048] 4. Typing test Capillary electrophoresis detection: 9 μL of molecular weight internal standard and formamide mixture (volume ratio of 0.5:8.5) and 1.0 μL of PCR product were added to each well of a 96-well plate; denaturation was performed at 95°C for 3 min, and typing was performed using a 3730XL DNA analyzer.

[0049] 5. Data Analysis The raw data files obtained by 3730XL DNA analyzer were imported into the analysis software genemapper ID 3.2 for band discrimination analysis.

[0050] 2. Experimental Results Three pairs of specific SSR core primers were screened out from 200 pairs of SSR primers, namely YM5.SSR-1L and YM5.SSR-1R, YM5.SSR-2L and YM5.SSR-2R, and YM5.SSR-3L and YM5.SSR-3R. The primer sequences are shown in Table 2.

[0051] Table 2 Specific SSR core primer sequences

[0052] The statistical results of capillary electrophoresis bands of 16 tea varieties / lines (Table 1) amplified by these three pairs of specific SSR core primers are shown in Tables 3 and Figures 1 to 3 As shown, the results show that Yueming 5 has characteristic bands, specifically: (1) Specific SSR core primers YM5.SSR-1L and YM5.SSR-1R amplified two characteristic bands of 209 bp and 233 bp respectively; (2) Specific SSR core primers YM5.SSR-2L and YM5.SSR-2R amplified two characteristic bands of 194 bp and 200 bp; (3) The specific SSR core primers YM5.SSR-3L and YM5.SSR-3R only amplified a characteristic band of 285 bp.

[0053] The above results showed that the three pairs of specific SSR core primers could amplify characteristic bands for the tea variety Yueming 5, so Yueming 5 could be distinguished from the other 15 tea varieties / lines with similar genetic and phenotypical characteristics.

[0054] Table 3 Statistics of capillary electrophoresis bands of 16 tea varieties / lines by three pairs of specific SSR core primers

[0055] Example 2 Further validation of 3 pairs of specific SSR core primers 1. Experimental Methods The three pairs of specific SSR core primers YM5.SSR-1L and YM5.SSR-1R, YM5.SSR-2L and YM5.SSR-2R, and YM5.SSR-3L and YM5.SSR-3R for identifying Yueming No. 5 were further verified, and 24 tea varieties currently promoted and applied in production were selected for amplification detection simultaneously with Yueming No. 5. The details of the 25 tea varieties are shown in Table 4.

[0056] Table 425 Tea Varieties Currently Popularized and Used in Production

[0057] The extraction method, PCR amplification, typing detection and data analysis method of tea variety DNA are carried out according to Example 1.

[0058] 2. Experimental Results The statistical results of capillary electrophoresis bands of 25 tea varieties (Table 4) amplified by three pairs of specific SSR core primers are shown in Tables 5 and Figures 4 to 6 As shown, the results show that only Yueming 5 has characteristic bands, specifically: (1) Specific SSR core primers YM5.SSR-1L and YM5.SSR-1R amplified two characteristic bands of 209 bp and 233 bp respectively; (2) Specific SSR core primers YM5.SSR-2L and YM5.SSR-2R amplified two characteristic bands of 194 bp and 200 bp; (3) The specific SSR core primers YM5.SSR-3L and YM5.SSR-3R only amplified a characteristic band of 285 bp.

[0059] The above results showed that the three pairs of specific SSR core primers could amplify specific alleles for the tea variety Yueming 5, and therefore Yueming 5 could be distinguished from the other 24 tea varieties currently promoted and applied in production.

[0060] Table 5 Statistics of capillary electrophoresis bands of 25 tea varieties promoted and applied

[0061] Example 3 A method for identifying Yueming 5 using specific SSR core primer combination 1. Extract DNA from tea variety Yueming No. 5 according to the method of Example 1; 2. Using the DNA extracted in step 1 as a template, PCR amplification was performed using three pairs of specific SSR core primers: YM5.SSR-1L and YM5.SSR-1R, YM5.SSR-2L and YM5.SSR-2R, YM5.SSR-3L and YM5.SSR-3R. The sequences of the three pairs of specific SSR core primers are as follows, wherein the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention): YM5.SSR-1L:CCTTGAGAGGGCAAGCTATTG; YM5.SSR-1R:TGAAGGATTTATGTGGGCAGC; YM5.SSR-2L:CAGCTGACCACCACCTG; YM5.SSR-2R: GGGTAGTCATGGCGGCAG; YM5.SSR-3L:ACCCACACACCGGTCTCT; YM5.SSR-3R: ACGAGGATCCACCCTACCT; The PCR amplification method was performed according to Example 1: The PCR product obtained in step 2 is subjected to typing detection and data analysis, and the typing detection and data analysis methods are both performed in accordance with Example 1.

[0062] 4. Interpretation of results: If the amplification products of the three pairs of specific SSR core primers show the following characteristic bands, it indicates that the tea variety to be tested is Yueming No. 5; if the following characteristic bands do not appear, it indicates that the tea variety to be tested is not Yueming No. 5: (1) Specific SSR core primers YM5.SSR-1L and YM5.SSR-1R amplified two characteristic bands of 209 bp and 233 bp respectively; (2) Specific SSR core primers YM5.SSR-2L and YM5.SSR-2R amplified two characteristic bands of 194 bp and 200 bp; (3) The specific SSR core primers YM5.SSR-3L and YM5.SSR-3R only amplified a characteristic band of 285 bp.

[0063] Example 4

[0064] A kit for identifying tea variety Yueming No. 5 1. Composition (1) Three pairs of specific SSR core primers, wherein the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and the HEX fluorescent label is used in the present invention): YM5.SSR-1L:CCTTGAGAGGGCAAGCTATTG; YM5.SSR-1R:TGAAGGATTTATGTGGGCAGC; YM5.SSR-2L:CAGCTGACCACCACCTG; YM5.SSR-2R: GGGTAGTCATGGCGGCAG; YM5.SSR-3L:ACCCACACACCGGTCTCT; YM5.SSR-3R: ACGAGGATCCACCCTACCT; (2) HSTaq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, and ultrapure water.

[0065] 2. Usage The detection and result interpretation were performed according to the method of Example 3.

[0066] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. The SSR core primer combination for identifying the tea variety Yueming 5 is characterized by: The SSR core primer combination comprises SSR core primers represented by nucleotide sequences YM5.SSR-1L, YM5.SSR-1R, YM5.SSR-2L, YM5.SSR-2R, YM5.SSR-3L and YM5.SSR-3R; wherein: the primer sequence of YM5.SSR-1L is CCTTGAGAGGGCAAGCTATTG; the primer sequence of YM5.SSR-1R is TGAAGGATTTATGTGGGCAGC; the primer sequence of YM5.SSR-2L is CAGCTGACCCACCACCTG; the primer sequence of YM5.SSR-2R is GGGTAGTCATGGCGGCAG; the primer sequence of YM5.SSR-3L is ACCCCAACACCGGTCTCT; the primer sequence of YM5.SSR-3R is ACGAGGATCCACCCTACCT.

2. The SSR core primer combination according to claim 1, characterized in that The 5' end of the SSR core primer shown in the nucleotide sequence YM5.SSR-1L, the 5' end of the SSR core primer shown in the nucleotide sequence YM5.SSR-2L and / or the 5' end of the SSR core primer shown in the nucleotide sequence YM5.SSR-3L are labeled with a fluorescent reporter group.

3. The SSR core primer combination according to claim 2, characterized in that The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

4. Use of the SSR core primer combination described in any one of claims 1 to 3 in preparing an identification product of the tea variety Yueming No.

5.

5. Use of a product comprising the SSR core primer combination described in any one of claims 1 to 3 in identifying the tea variety Yueming No.

5.

6. A kit for identifying the tea variety Yueming No. 5, characterized in that: Comprising the SSR core primer combination described in any one of claims 1 to 3.

7. The kit according to claim 6, characterized in that The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance, and ultrapure water.

8. A method for identifying the tea variety Yueming No. 5, characterized in that: The identification is performed using the SSR core primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 6 to 7.

9. The method according to claim 8, characterized in that The following steps are involved: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification is performed using the SSR core primer combination described in any one of claims 1 to 3; S3. Typing the PCR amplification product obtained in step S2, and performing band discrimination on the typing result: The SSR core primers shown by the nucleotide sequences YM5.SSR-1L and YM5.SSR-1R amplified two characteristic bands of 209bp and 233bp, the SSR core primers shown by the nucleotide sequences YM5.SSR-2L and YM5.SSR-2R amplified two characteristic bands of 194bp and 200bp, and the SSR core primers shown by the nucleotide sequences YM5.SSR-3L and YM5.SSR-3R only amplified one characteristic band of 285bp, indicating that the tea tree sample to be tested is Yueming No. 5; the appearance of other bands indicates that the tea tree sample to be tested is not Yueming No.

5.

10. The method according to claim 9, characterized in that The typing method in step S3 is to perform capillary electrophoresis on the PCR amplification product; For PCR amplification, the total reaction system was 10 μL, including: 10×Buffer I 1 μL, 2.5 mM dNTPs 0.8 μL, 2.5 μM upstream primer 0.6 μL, 2.5 μM downstream primer 0.6 μL, TAKARA HSTaq 0.1 μL, DNA 1 μL, and ddH2O 10 μL; the PCR amplification reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

Images