SSR (Simple Sequence Repeat) core primer combination for identifying tea tree variety Danxia No.2, kit and application

Abstract

The invention discloses an SSR (Simple Sequence Repeat) core primer combination for identifying a tea tree variety 'Danxia No.2', a kit and application. According to the invention, three pairs of SSR core primers are screened by utilizing an SSR fluorescence labeling detection technology, and the three pairs of SSR core primers can be used for rapidly identifying and detecting the Danxia No.2 from other tea tree varieties. The SSR core primer combination disclosed by the invention can be used for identifying the variety of Danxia No.2, the uncertainty of identification based on external morphological characteristics is overcome, the result is reliable and visual, the detection efficiency is high, the operation is simple and convenient, and meanwhile, the popularization, utilization and protection of the variety of Danxia No.2 are also facilitated.

Description

Technical Field

[0001] The present invention relates to the technical field of variety resource identification and germplasm innovation, and in particular to an SSR core primer combination, a kit and an application thereof for identifying the tea variety "Danxia No. 2". Background Art

[0002] "Danxia No. 2" is an excellent tea tree variety selected from the Renhua Baimao tea population, belonging to a small tree. It is characterized by: medium leaves, half-opened tree posture, dense branches, neat sprouts, large density, strong buds and leaves, dark green leaves, many hairs, strong cold and drought resistance. The buds and leaves are rich in content, suitable for making famous red and white tea. The made black tea has a beautiful appearance, full of golden hairs, high and long strong floral fragrance, strong and refreshing taste, good aftertaste, and bright red soup color. The made white tea has a straight appearance, full of white hairs, rich and refreshing taste, and bright apricot yellow soup color. Strong resistance to adversity and wide adaptability.

[0003] Since tea trees are perennial plants with a long growth cycle, the current identification method relies solely on its morphological characteristics and the identification experience of the identifier to identify the authenticity of tea varieties. It is easily affected by the development stage, the identification ability of the identifier, cultivation measures and environmental conditions, and there is great uncertainty. Therefore, in order to better manage the variety of "Danxia No. 2", it is particularly important to establish a set of rapid and effective tea variety resource identification methods.

[0004] Molecular marker technology has become the future development direction of variety identification and protection due to its high polymorphism, short test cycle, and no environmental influence. Among them, simple sequence repeat (SSR) has the advantages of co-dominance, good repeatability, easy detection, and simple operation. Therefore, SSR molecular markers have good application prospects in variety-specific evaluation and protection. Summary of the invention

[0005] In order to overcome the above-mentioned defects and shortcomings in the prior art, the present invention provides an SSR core primer combination, a kit and an application for identifying the tea variety "Danxia No. 2".

[0006] The first object of the present invention is to provide an SSR core primer combination for identifying the tea variety "Danxia No. 2".

[0007] The second object of the present invention is to provide the use of the above-mentioned SSR core primer combination in the preparation of an identification product of the tea variety "Danxia No. 2".

[0008] The third object of the present invention is to provide a product comprising the above-mentioned SSR core primer combination for use in identifying the tea variety "Danxia No. 2".

[0009] The fourth object of the present invention is to provide a kit for identifying the tea variety "Danxia No. 2".

[0010] A fifth object of the present invention is to provide a method for identifying the tea variety "Danxia No. 2".

[0011] To achieve the above-mentioned purpose, the present invention provides an SSR core primer combination for identifying the tea variety "Danxia No. 2", the SSR core primer combination comprising SSR core primers represented by nucleotide sequences DX2.SSR-1-F, DX2.SSR-1-R, DX2.SSR-2-F, DX2.SSR-2-R, DX2.SSR-3-F and DX2.SSR-3-R; wherein: the primer sequence of DX2.SSR-1-F is: GTCCCTACCAGAACCTTGGC; DX2.SSR-2-F is: DX2.SSR-2-R, DX2.SSR-3-F is: DX2.SSR-3-R, DX2.SSR-3-R is: DX2.SSR-1-F is: GTCCCTACCAGAACCTTGGC; The primer sequence of R-1-R: GGAAGAGTGGTCTCCTGTGC; the primer sequence of DX2.SSR-2-F: TTCGCCATCATCACCACCAA; the primer sequence of DX2.SSR-2-R: TGAGCCTCTCCATTGCTTCG; the primer sequence of DX2.SSR-3-F: CGATCACCTCCTTCGTCACC; the primer sequence of DX2.SSR-3-R: TACCCCAAATCAGGCGATCC.

[0012] The 5' end of the SSR core primer shown in the nucleotide sequence DX2.SSR-1-F, the 5' end of the SSR core primer shown in the nucleotide sequence DX2.SSR-2-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence DX2.SSR-3-F is labeled with a fluorescent reporter group.

[0013] The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

[0014] Use of any of the above-mentioned SSR core primer combinations in preparing an identification product for the tea variety "Danxia No. 2".

[0015] Application of a product comprising any of the above-mentioned SSR core primer combinations in identifying the tea variety "Danxia No. 2".

[0016] A kit for identifying the tea variety "Danxia No. 2", comprising any of the above-mentioned SSR core primer combinations.

[0017] The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance, and ultrapure water.

[0018] A method for identifying the tea variety "Danxia No. 2" is provided, using any of the above-mentioned SSR core primer combinations or kits for identification.

[0019] The method comprises the following steps: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification is performed using any of the above-mentioned SSR core primer combinations; S3. Typing the PCR amplification product obtained in step S2, and performing band discrimination on the typing result: The SSR core primers shown by the nucleotide sequences of DX2.SSR-1-F and DX2.SSR-1-R amplify two characteristic bands of 116bp and 119bp, the SSR core primers shown by the nucleotide sequences of DX2.SSR-2-F and DX2.SSR-2-R amplify two characteristic bands of 187bp and 193bp, and the SSR core primers shown by the nucleotide sequences of DX2.SSR-3-F and DX2.SSR-3-R only amplify one characteristic band of 145bp, indicating that the tea tree sample to be tested is "Danxia No. 2"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 2".

[0020] The typing method described in step S3 is to perform capillary electrophoresis on the PCR amplification product; wherein the PCR amplification, the total reaction system is 10μL, including: 10×Buffer I 1μL, 2.5 mMdNTPs 0.8μL, 2.5μM upstream primer 0.6μL, 2.5μM downstream primer 0.6μL, TAKARA HSTaq 0.1μL, DNA 1μL, ddH2O filler 10μL; PCR amplification reaction conditions are: 95℃ pre-denaturation for 5min; 94℃ denaturation for 30s; 60℃ annealing for 30s for 35 cycles; 72℃ extension for 30s; and finally 60℃ extension for 30min.

[0021] Advantages and effects of the present invention: The present invention discloses an SSR core primer combination, a kit and an application for identifying the tea variety "Danxia No. 2". The present invention utilizes SSR fluorescent marker detection technology to screen and obtain three pairs of SSR core primers, which can quickly identify and detect "Danxia No. 2" from other tea varieties. The SSR core primer combination disclosed in the present invention can perform variety identification on "Danxia No. 2", overcomes the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, and is easy to operate. It is also beneficial to the promotion, utilization and protection of the variety "Danxia No. 2". BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Capillary electrophoresis bands of 23 tea varieties / lines amplified by the specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R in Example 1.

[0023] Figure 2 Capillary electrophoresis bands of 23 tea varieties / lines amplified by the specific SSR core primers DX2.SSR-2-F and DX2.SSR-2-R in Example 1.

[0024] Figure 3 Capillary electrophoresis bands of 23 tea varieties / lines amplified by the specific SSR core primers DX2.SSR-3-F and DX2.SSR-3-R in Example 1.

[0025] Figure 4 Capillary electrophoresis bands of 30 tea varieties / lines amplified by the specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R in Example 2.

[0026] Figure 5 Capillary electrophoresis bands of 30 tea varieties / lines amplified by the specific SSR core primers DX2.SSR-2-F and DX2.SSR-2-R in Example 2.

[0027] Figure 6 Capillary electrophoresis bands of 30 tea varieties / lines amplified by the specific SSR core primers DX2.SSR-3-F and DX2.SSR-3-R in Example 2. DETAILED DESCRIPTION

[0028] The present invention is further described below with reference to specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0029] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0030] Example 1 Screening and obtaining of specific primer sequences of “Danxia No. 2” 1. Experimental Methods 1. SSR primer design The genome sequence of the tea plant genome database (http: / / tpia.teaplants.cn / ) was searched using MISA software to retrieve the SSR sites in the genome sequence. Primer 5.0 was used to batch design 200 pairs of SSR primers, which were synthesized by Beijing Reader Gene Technology Co., Ltd.

[0031] 2. Extraction of DNA from tea varieties A preliminary screening was conducted using 23 tea varieties / lines with similar genetic and phenotypical characteristics, including “Danxia 2”, “Danxia 1”, and “Danxia 4”. The tea varieties / lines used in the preliminary screening are shown in Table 1 (taken from the Guangdong Tea Germplasm Resource Bank).

[0032] Table 1 23 tea varieties / lines used in the preliminary screening

[0033] DNA was extracted from the 23 tea varieties / lines (Table 1) used in the preliminary screening. The specific steps of DNA extraction were as follows: a) Take tea leaves and add liquid nitrogen to grind them thoroughly, and weigh about 100 mg of the ground powder.

[0034] b) Quickly add 400 μL of GPS buffer and 10 μL of RNase A to the ground powder, vortex quickly to mix, and place the centrifuge tube in a 65°C water bath for 15 min. Invert the centrifuge tube several times to mix the sample during the water bath.

[0035] c) Add 100 μL of buffer GPA, vortex for 1 min, centrifuge at 12,000 rpm for 5 min, transfer the supernatant to the filter column CS, then centrifuge at 12,000 rpm for 1 min, and transfer the filtrate to a new centrifuge tube.

[0036] d) Add an equal volume of anhydrous ethanol and mix thoroughly. Flocculent precipitation may appear at this time.

[0037] e) Transfer the solution and flocculent precipitate obtained in the previous step to RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0038] f) Add 550 μL of deproteinizing solution RD to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0039] g) Add 700 μL of rinse solution PW to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0040] h) Repeat step g.

[0041] i) Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the collection tube, and then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube and dry it at room temperature for 5-10 min.

[0042] j) Add 50-100 μL of elution buffer TB to the RNase-Free adsorption column CR2, place at room temperature for 3-5 minutes, centrifuge at 12000 rpm for 2 minutes, collect the solution into a centrifuge tube, and obtain the tea tree genomic DNA.

[0043] 3. PCR Amplification The tea tree genomic DNA extracted in step 2 is used as a template, and PCR amplification is performed using the SSR fluorescent marker detection technology, wherein the primers include an upstream primer with a fluorescent reporter group (the fluorescent reporter group is FAM, HEX, TAMRA, or ROX, and the FAM fluorescent marker is used in the present invention) labeled at the 5' end, and a downstream primer. The PCR amplification guided by the upstream primer with a fluorescent reporter group labeled at the 5' end produces a PCR product with fluorescence.

[0044] For PCR amplification, the total reaction system was 10 μL, including: 10×Buffer I 1 μL, 2.5 mM dNTPs 0.8 μL, 2.5 μM upstream primer 0.6 μL, 2.5 μM downstream primer 0.6 μL, TAKARA HSTaq 0.1 μL, DNA 1 μL, and ddH2O to make up 10 μL.

[0045] The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

[0046] 4. Typing test Capillary electrophoresis detection: 9 μL of molecular weight internal standard and formamide mixture (volume ratio of 0.5:8.5) and 1.0 μL of PCR product were added to each well of a 96-well plate; denaturation was performed at 95°C for 3 min, and typing was performed using a 3730XL DNA analyzer.

[0047] 5. Data Analysis The raw data files obtained by 3730XL DNA analyzer were imported into the analysis software genemapper ID 3.2 for band discrimination analysis.

[0048] 2. Experimental Results Three pairs of specific SSR core primers were screened out from 200 pairs of SSR primers, namely DX2.SSR-1-F, DX2.SSR-1-R, DX2.SSR-2-F, DX2.SSR-2-R, DX2.SSR-3-F and DX2.SSR-3-R. The primer sequences are shown in Table 2.

[0049] Table 2 Specific SSR core primer sequences

[0050] The statistical results of capillary electrophoresis bands of 22 tea varieties / lines (Table 1) amplified by these three pairs of specific SSR core primers are shown in Tables 3 and Figures 1 to 3 As shown in the figure, the results show that "Danxia 2" has characteristic bands, specifically: (1) The specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R amplified two characteristic bands of 116 bp and 119 bp respectively; (2) Specific SSR core primers DX2.SSR-2-F and DX2.SSR-2-R amplified two characteristic bands of 187 bp and 193 bp; (3) The specific SSR core primers DX2.SSR-3-F and DX2.SSR-3-R amplified a characteristic band of 145 bp.

[0051] The above results showed that the three pairs of specific SSR core primers could amplify characteristic bands for the tea variety "Danxia No. 2", so "Danxia No. 2" could be distinguished from the other 22 related and phenotypically similar tea varieties / lines.

[0052] Table 3 Statistics of capillary electrophoresis bands of 23 tea varieties / lines by three pairs of specific SSR core primers

[0053] Example 2

[0054] Further validation of 3 pairs of specific SSR core primers 1. Experimental Methods The three pairs of specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R, DX2.SSR-2-F and DX2.SSR-2-R, and DX2.SSR-3-F and DX2.SSR-3-R for identifying "Danxia No. 2" were further verified, and 29 tea varieties currently promoted and applied in production were selected for amplification detection simultaneously with "Danxia No. 2". The specific information of the 30 tea varieties is shown in Table 4.

[0055] Table 4 30 tea varieties currently being promoted and applied in production

[0056] The extraction method, PCR amplification, typing detection and data analysis method of tea variety DNA are carried out according to Example 1.

[0057] 2. Experimental Results The statistical results of capillary electrophoresis bands of 30 tea varieties (Table 4) amplified by 3 pairs of specific SSR core primers are shown in Tables 5 and Figures 4 to 6 As shown, the results show that only Danxia 2 has characteristic bands, specifically: (1) Specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R amplified two characteristic bands of 116 bp and 119 bp respectively; (2) Specific SSR core primers DX2.SSR-2-F and DX2.SSR-2-R amplified two characteristic bands of 187 bp and 193 bp respectively; (3) The specific SSR core primers DX2.SSR-3-F and DX2.SSR-3-R amplified a characteristic band of 145 bp.

[0058] The above results indicate that the three pairs of specific SSR core primers can amplify specific alleles for the tea variety "Danxia No. 2", and therefore can distinguish "Danxia No. 2" from the other 29 tea varieties currently being promoted and applied in production.

[0059] Table 5 Statistics of capillary electrophoresis bands of 30 tea varieties promoted and applied

[0060] Example 3 A method for identifying "Danxia 2" using specific SSR core primer combination 1. Extract DNA of tea variety "Danxia No. 2" according to the method of Example 1; 2. Using the DNA extracted in step 1 as a template, PCR amplification was performed using three pairs of specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R, DX2.SSR-2-F and DX2.SSR-2-R, DX2.SSR-3-F and DX2.SSR-3-R. The sequences of the three pairs of specific SSR core primers are as follows, wherein the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention): DX2.SSR-1-F:GTCCCTACCAGAACCTTGGC; DX2.SSR-1-R:GGAAGAGTGGTCTCCTGTGC; DX2.SSR-2-F:TTCGCCATCATCACCACCAA; DX2.SSR-2-R:TGAGCCTCTCCATTGCTTCG; DX2.SSR-3-F: CGATCACCTCCTTCGTCACC; DX2.SSR-3-R:TACCCCAAATCAGGCGATCC.

[0061] 3. PCR amplification method was carried out according to Example 1: The PCR product obtained in step 2 is subjected to typing detection and data analysis, and the typing detection and data analysis methods are both performed in accordance with Example 1.

[0062] 4. Interpretation of results: If the amplification products of the three pairs of specific SSR core primers show the following characteristic bands, it indicates that the tea variety to be tested is "Danxia No. 2"; if the following characteristic bands do not appear, it indicates that the tea variety to be tested is not "Danxia No. 2": (1) Specific SSR core primers DX2.SSR-1-F and DX2.SSR-1-R amplified two characteristic bands of 116 bp and 119 bp respectively; (2) Specific SSR core primers DX2.SSR-2-F and DX2.SSR-2-R amplified two characteristic bands of 187 bp and 193 bp respectively; (3) The specific SSR core primers DX2.SSR-3-F and DX2.SSR-3-R amplified a characteristic band of 145 bp.

[0063] Example 4

[0064] A kit for identifying the tea variety "Danxia No. 2" 1. Composition (1) Three pairs of specific SSR core primers, wherein the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and the HEX fluorescent label is used in the present invention): DX2.SSR-1-F:GTCCCTACCAGAACCTTGGC; DX2.SSR-1-R:GGAAGAGTGGTCTCCTGTGC; DX2.SSR-2-F:TTCGCCATCATCACCACCAA; DX2.SSR-2-R:TGAGCCTCTCCATTGCTTCG; DX2.SSR-3-F: CGATCACCTCCTTCGTCACC; DX2.SSR-3-R:TACCCCAAATCAGGCGATCC.

[0065] (2) HSTaq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, and ultrapure water.

[0066] 2. Usage The detection and result interpretation were performed according to the method of Example 3.

[0067] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An SSR core primer combination for identifying the tea variety "Danxia No. 2", characterized in that: The SSR core primer combination comprises SSR core primers represented by nucleotide sequences of DX2.SSR-1-F, DX2.SSR-1-R, DX2.SSR-2-F, DX2.SSR-2-R, DX2.SSR-3-F and DX2.SSR-3-R; wherein: the primer sequence of DX2.SSR-1-F is GTCCCTACCAGAACCTTGGC; the primer sequence of DX2.SSR-1-R is GGAAGAGTGGTCTCCTGTGC; the primer sequence of DX2.SSR-2-F is TTCGCCATCATCACCACCAA; the primer sequence of DX2.SSR-2-R is TGAGCCTCTCCATTGCTTCG; the primer sequence of DX2.SSR-3-F is CGATCACCTCCTTCGTCACC; the primer sequence of DX2.SSR-3-R is TACCCCAAATCAGGCGATCC.

2. The SSR core primer combination according to claim 1, characterized in that The 5' end of the SSR core primer shown in the nucleotide sequence DX2.SSR-1-F, the 5' end of the SSR core primer shown in the nucleotide sequence DX2.SSR-2-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence DX2.SSR-3-F is labeled with a fluorescent reporter group.

3. The SSR core primer combination according to claim 2, characterized in that The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

4. Use of the SSR core primer combination described in any one of claims 1 to 3 in preparing an identification product of the tea variety "Danxia No. 2".

5. Use of a product comprising the SSR core primer combination described in any one of claims 1 to 3 in identifying the tea variety "Danxia No. 2".

6. A kit for identifying the tea variety "Danxia No. 2", characterized in that: Comprising the SSR core primer combination described in any one of claims 1 to 3.

7. The kit according to claim 6, characterized in that The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance, and ultrapure water.

8. A method for identifying the tea variety "Danxia No. 2", characterized in that: The identification is performed using the SSR core primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 6 to 7.

9. The method according to claim 8, characterized in that The following steps are involved: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification is performed using the SSR core primer combination described in any one of claims 1 to 3; S3. Typing the PCR amplification product obtained in step S2, and performing band discrimination on the typing result: The SSR core primers represented by the nucleotide sequences DX2.SSR-1-F and DX2.SSR-1-R amplified two characteristic bands of 116bp and 119bp, the SSR core primers represented by the nucleotide sequences DX2.SSR-2-F and DX2.SSR-2-R amplified two characteristic bands of 187bp and 193bp, and the SSR core primers represented by the nucleotide sequences DX2.SSR-3-F and DX2.SSR-3-R amplified only one characteristic band of 145bp, indicating that the tea tree sample to be tested is "Danxia No. 2"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 2".

10. The method according to claim 9, characterized in that The typing method in step S3 is to perform capillary electrophoresis on the PCR amplification product; For PCR amplification, the total reaction system was 10 μL, including: 10×Buffer I 1 μL, 2.5 mM dNTPs 0.8 μL, 2.5 μM upstream primer 0.6 μL, 2.5 μM downstream primer 0.6 μL, TAKARA HSTaq 0.1 μL, DNA 1 μL, and ddH2O 10 μL; the PCR amplification reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

Images