ETS1 inhibitor and application

Abstract

The invention relates to the technical field of diabetic microangiopathy, in particular to an ETS1 inhibitor and application. The ETS1 inhibitor comprises at least one of compounds as shown in a formula I and a formula II as shown in the specification as an active ingredient. The compounds as shown in the formula I and the formula II can inhibit ETS1 transcription factors in a targeted manner, have multiple effects of resisting angiogenesis, inhibiting endothelial cell senescence, promoting senescent cell apoptosis and the like, and provide a new prevention and treatment strategy for treatment of diabetic microangiopathy.

Description

Technical Field

[0001] The present application relates to the technical field of ETS1 in diabetic microangiopathy, specifically ETS1 inhibitors and applications. Background Art

[0002] Diabetic microangiopathy (DR) is a chronic complication of diabetes, mainly referring to the lesions of the capillary network between micro-arteries and micro-venules. ETS1 (E26 transformation–specific sequence-1) is a transcription factor that belongs to the ETS transcription factor family. It plays a key role in various physiological processes such as cell proliferation, differentiation, migration and apoptosis. Its structure contains a highly conserved DNA binding domain that can specifically recognize and bind to the ETS binding site in the promoter region of the target gene, thereby regulating gene transcription. Under normal physiological conditions, ETS1 participates in the angiogenesis process. It can regulate the expression of angiogenesis-related genes such as vascular endothelial growth factor (VEGF). For example, during embryonic development, ETS1 helps build a normal vascular network by promoting the proliferation and migration of vascular endothelial cells.

[0003] In diabetic microangiopathy, the expression level of ETS1 often changes. Studies have found that ETS1 expression is upregulated in microangiopathy tissues such as the retina and kidney of diabetic patients. This abnormally high expression may be a response of the body to chronic hyperglycemia and hypoxia.

[0004] Application Contents

[0005] The applicant of the present application creatively discovered a compound targeting ETS1, which can inhibit the abnormal expression and upregulation of ETS1 in diabetic microangiopathy to regulate the pathological process.

[0006] To this end, the embodiments of the present application disclose at least the following technical solutions:

[0007] In a first aspect, the embodiments disclose an ETS1 inhibitor, comprising at least one of the compounds represented by Formula I and Formula II as shown below as an active ingredient:

[0008]

[0009] In a second aspect, the embodiments disclose the use of the compounds represented by Formula I and / or Formula II in the preparation of drugs for preventing or treating diabetes.

[0010] In a third aspect, the embodiments disclose the use of the compounds represented by Formula I and / or Formula II in the preparation of drugs for preventing or treating diabetic microangiopathy.

[0011] In a fourth aspect, the embodiments disclose the use of the compounds represented by Formula I and / or Formula II in the preparation of drugs for preventing or treating diabetic inflammation.

[0012] In a fifth aspect, the embodiments disclose the use of the compounds represented by Formula I and / or Formula II in the preparation of drugs for inhibiting the proliferation of HRMEC cells.

[0013] In a sixth aspect, the embodiments disclose the use of the compounds represented by Formula I and / or Formula II in the preparation of a drug for promoting apoptosis of aged HRMEC cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The affinity test curves and KD values ​​of the compounds represented by Formula I and Formula II provided in the examples are shown.

[0015] Figure 2 A three-dimensional schematic diagram of the binding region of ETS1 of the compounds represented by Formula I and Formula II provided in the examples.

[0016] Figure 3 This is a three-dimensional schematic diagram of the binding site of the compounds represented by Formula I and Formula II in ETS1 provided in the examples.

[0017] Figure 4 A three-dimensional schematic diagram of the binding site of the compounds represented by Formula I and Formula II in ETS1 provided as another embodiment.

[0018] Figure 5 This is the HRMEC cell proliferation inhibition curve of the compounds represented by Formula I and Formula II provided in the examples.

[0019] Figure 6 The statistical results of the inhibition of HRMEC cell inflammatory expression factors by the compounds of Formula I and Formula II provided in the examples are shown.

[0020] Figure 7 The statistical results of the compounds of Formula I and Formula II provided in the examples on down-regulating the expression of ETS1 in HRMEC cells.

[0021] Figure 8 The statistical results of the compounds of Formula I and Formula II provided in the examples on down-regulating the expression of the pro-aging genes CDKN1A and CDKN2A in HRMEC cells.

[0022] Fig. 9 The statistical results of the compounds of Formula I and Formula II provided in the examples on down-regulating the expression of anti-apoptotic genes BCL-xL and BCL-2 in HRMEC cells.

[0023] Fig.10The statistical results of the compounds of Formula I and Formula II provided in the examples for reducing the percentage of senescent endothelial cells in the retina of diabetic mice.

[0024] Fig.11 The present invention provides the statistical results of the inhibition of retinal vascular proliferation and leakage after drug treatment of diabetic (DM) mice fed with the compounds of Formula I and Formula II provided in the examples, and retinal flat mounts of Evans blue perfusion angiography.

[0025] Fig.12 After the diabetic (DM) mice were fed with the compounds of Formula I and Formula II provided in the examples, PAS staining experiments showed that the number of retinal acellular capillaries was significantly reduced, and the statistical results of microvascular function improvement were found. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0027] Increased expression of ETS1 can lead to abnormal proliferation and migration of vascular endothelial cells. ETS1 is involved in regulating the metabolism of the extracellular matrix (ECM). In diabetic microangiopathy, it promotes the synthesis of ECM components such as collagen I, III, and IV. ETS1 can bind to the ETS binding site in the promoter region of the collagen gene, activate its transcription, and increase the synthesis of collagen. ETS1 plays a role in the regulation of inflammatory responses. It can activate the expression of some inflammation-related genes, such as interleukin (IL-6) and tumor necrosis factor-α (TNF-α). In diabetic microangiopathy tissues, ETS1 binds to the ETS binding site in the promoter region of the IL-6 and TNF-α genes, promotes their transcription, leads to the recruitment of inflammatory cells and the release of inflammatory mediators, and aggravates the inflammatory response.

[0028] From the perspective of oxidative stress, ETS1 can also affect the antioxidant enzyme system in cells. It may inhibit the expression of some antioxidant enzyme genes, such as superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px). By reducing the synthesis of antioxidant enzymes, the level of oxidative stress in cells increases, further damaging microvascular endothelial cells.

[0029] Therefore, the present application provides an ETS1 inhibitor that can inhibit the abnormal up-regulation of ETS1 expression in diabetic microangiopathy and regulate the pathological process from other aspects.

[0030] In one aspect, the embodiments disclose an ETS1 inhibitor, comprising at least one of the compounds represented by Formula I and Formula II as shown below as an active ingredient:

[0031]

[0032] In some test cases, Acetate 4.0 (BR100349, Cytiva) was used to dilute the ETS1 recombinant protein (WX00AB1A, ORIGENE) to a final concentration of 50 μg / mL, the ETS1 protein was fixed on the CM5 chip, the compound represented by formula (I) was formulated into 0.3 μM / L, 0.8 μM / L, 2.4 μM / L, 7.4 μM / L and 22 μM / L and passed through the experimental channel in sequence, and the compound represented by formula (II) was formulated into 0.3 μM / L, 0.8 μM / L, 2.4 μM / L, 7.4 μM / L, 22 μM / L and 67 μM / L and passed through the experimental channel in sequence, and an equal amount of solvent DMSO was used as a reference, and the detection was completed using the Biacore T200 SPR system (28975001, Cytiva). The data was analyzed and processed using the BIA evaluation software (BiaCore). The results are shown in FIG. Figure 1 shown.

[0033] like Figure 1 The affinity test with the ETS1 domain showed that the affinity KD value of the compound represented by formula (I) was 2.89E-06M, and the affinity KD value of the compound represented by formula (II) was 3.83E-06M, and the binding mode of these two compounds with the ETS1 domain was a rapid binding and rapid dissociation mode.

[0034] In some test cases, the structure of ETS1 protein (PDB ID: 1GVJ) was obtained from the PDB database (https: / / www.rcsb.org / ). PyMOL was used to preprocess the protein, including removing water molecules, adding hydrogen, and generating docking parameter files for receptors and ligands. The ETS domain (335-415) on the UniProt database (https: / / www.uniprot.org / uniprotkb / Q9BYJ9 / entry) was combined with a 3D convolutional model based on convolutional neural networks (CNN) to predict the binding pocket of ETS1 protein. Figure 2As shown, the center coordinates of the binding region of ETS1 are Combined with the box size of

[0035] AutoDockTools 1.5.6 and Vina 1.1.2 software were used for docking, and PyMOL 2.2.0 was used to visualize the results and analyze the binding modes and interactions.

[0036] like Figure 3 , 4 As shown, the binding energy of the compound represented by formula (I) in the ETS1 domain is -7.969 kcal / mol, and the binding energy of the compound represented by formula (II) in the ETS1 domain is -8.156 kcal / mol. This shows that the compound represented by formula (I) and the compound represented by formula (II) can form a specific binding with the ETS1 protein, and that TYR395, LEU337 and ARG391 at this site are the key amino acids for the binding of the ETS1 domain with the compound represented by formula (I) and the compound represented by formula (II).

[0037] In some test cases, the inhibitory effect of the compound shown in formula (I) and the compound shown in formula (II) on cell proliferation was tested. Specifically, HRMEC cells (human retinal microvascular endothelial cells, number: PC-036h, Saios) were grown in a cell culture bottle to a confluence of about 85%, and 5000 HRMEC cells were inoculated in each well of a 96-well plate after digestion, and 100 μL of complete culture medium was added to each well. After the cells adhered to the wall, different concentrations of drug solutions prepared in complete culture medium were added, and an equal amount of solvent DMSO was used as a control, and the cells were cultured in an incubator for 72 hours. The upper culture medium was removed, and 10 μL of CCK8 stock solution and 90 μL of the corresponding complete culture medium were added to each well, incubated in an incubator for 2 hours, and the absorbance at 450 nm was measured with an enzyme marker. The expression of IL-6, IL-1β, MMP-1, CXCL2, MCP-1, ICAM-1 and VCAM-1 in HRMEC cells was tested by qRT-PCR.

[0038] like Figure 5 As shown, with the increase of drug concentration, the number of surviving HRMEC cells decreased significantly. According to the test, the IC50 value of the compound represented by formula (I) is 389.3nM, and the IC50 value of the compound represented by formula (II) is 27.39μM.

[0039] like Figure 6 As shown, after the HRMEC cells were treated with the compound represented by formula (I) and the compound represented by formula (II), the secretion of inflammatory factors was inhibited.

[0040] like Figure 7 ,8 As shown in 9, the compound represented by formula (I) and the compound represented by formula (II) can down-regulate the expression of ETS1, CDKN1A, CDKN2A, BCL-xl and BCL-2 in HRMEC cells and promote the apoptosis of senescent endothelial cells.

[0041] Among them, the qRT-PCR test steps include:

[0042] HRMEC cells were extracted from each group and then analyzed by Vazyme Total RNA was extracted from cells according to the Cell / Tissue Total RNA Isolation Kit V2 reagent manual, and RNA concentration and purity were determined by NaNodrop. The cDNA was synthesized using the reverse transcription kit instructions: gDNA was removed, 4 μL 4×gDNAwiper Mix was added to 1 μg RNA, the total volume was made up to 20 μL with double distilled water, and the reaction was carried out at 42°C for 2 min; for cDNA synthesis, 5 μL 5×HiScriptIII qRT SuperMix was added to the sample from which DNA had been removed, and the reaction was carried out at 37°C for 15 min and then at 85°C for 5 s. According to ChamQ qPCR Master Mix (LowROX Premixed) kit instructions, take 5μL 2×ChamQ SYBR qPCR Master Mix (Low ROX Premixed), 0.4μL of 10μM upstream and downstream primers, 1μL cDNA and 3.2μL double distilled water for amplification. ThermoViiA TM 7Real-Time PCR system was used for amplification: 95℃30s pre-denaturation, 95℃10s, 60℃30s, for a total of 40 cycles, followed by 95℃15s, 60℃1min, and 95℃15s for melting curve analysis. Each sample was repeated 3 times. β-actin was used as the internal reference gene. According to the ct value, The calculations were performed separately. The primers involved are as follows:

[0043] IL-6-F: ACTCACCTCTTCAGAACGAATTG, SEQ ID NO:1

[0044] IL-6-R: CCATCTTTGGAAGGTTCAGGTTG, SEQ ID NO: 2

[0045] IL-1β-F:ATGATGGCTTATTACAGTGGCAA, SEQ ID NO:3

[0046] IL-1β-R:GTCGGAGATTCGTAGCTGGA,SEQ ID NO:4

[0047] MMP-1-F:TGCTCTGCCTATCCTCTGAGT,SEQ ID NO:5

[0048] MMP-1-R:TCACATCCTTTTCGAGGTTGTAG,SEQ ID NO:6

[0049] CXCL2-F:GGCAGAAAGCTTGTCTCAACCC,SEQ ID NO:7

[0050] CXCL2-R:CTCCTTCAGGAACAGCCACCAA,SEQ ID NO:8

[0051] MCP-1-F:CAGCCAGATGCAATCAATGCC,SEQ ID NO:9

[0052] MCP-1-R:TGGAATCCTGAACCCACTTCT,SEQ ID NO:10

[0053] ICAM-1-F:ATGCCCAGACATCTGTGTCC,SEQ ID NO:11

[0054] ICAM-1-R:GGGGTCTCTATGCCCAACAA,SEQ ID NO:12

[0055] VCAM-1-F:GGGAAGATGGTCGTGATCCTT,SEQ ID NO:13

[0056] VCAM-1-R:TCTGGGGTGGTCTCGATTTTA,SEQ ID NO:14

[0057] CDKN1A-F:TGTCCGTCAGAACCCATGC,SEQ ID NO:15

[0058] CDKN1A-R:AAAGTCGAAGTTCCATCGCTC,SEQ ID NO:16

[0059] CDKN2A-F:GATCCAGGTGGGTAGAAGGTC,SEQ ID NO:17

[0060] CDKN2A-R:CCCCTGCAAACTTCGTCCT,SEQ ID NO:18

[0061] BCL-2-F: GGTGGGGTCATGTGTGTGG, SEQ ID NO: 19

[0062] BCL-2-R: CGGTTCAGGTACTCAGTCATCC, SEQ ID NO: 20

[0063] BCL-xL-F: GAGCTGGGTTGACTTTCTC, SEQ ID NO: 21

[0064] BCL-xL-R:TCCATCTCCGATTCAGTCCCT, SEQ ID NO:22

[0065] ETS1-F: GATAGTTGTGATCGCCTCACC, SEQ ID NO:23

[0066] ETS1-R:GTCCTCTGAGTCGAAGCTGTC, SEQ ID NO:24

[0067] β-actin-F: AATCGTGCGTGACATTAAGGAG, SEQ ID NO: 25

[0068] β-actin-R:ACTGTGTTGGCGTACAGGTCTT, SEQ ID NO:26

[0069] In some test cases, the gene expression regulation effect of the compound represented by formula (I) and the compound represented by formula (II) on diabetic microangiopathy model animals was also tested. The test process specifically includes:

[0070] 1) Experimental animals

[0071] Select 8-week-old C57BL / 6J mice of either sex to ensure that the mice are healthy before the experiment.

[0072] 2) Construction of diabetic microangiopathy model mice

[0073] Prepare 0.1M sodium citrate buffer (pH 4.5) and STZ (Sigma-Aldrich, CAS No.: 18883-66-4). Under sterile conditions, weigh STZ and prepare the solution according to the required dose (65 mg / kg) based on the weight of the mouse. The mice were adapted for 1 week to ensure that the mice were in good overall health before the experiment. Before the experiment, the mice were fasted (fasted for about 6-8 hours), but drinking water was available. STZ solution was injected intraperitoneally. The injection scheme was set as follows: 1 mL of STZ solution was injected per mouse per day, intraperitoneally, for 5 consecutive days (a total of 5 mL was injected). Starting from the 5th day after the STZ injection, the blood glucose level of the mice was tested using a blood glucose meter. The detection frequency was once every 1-2 days. If the blood glucose was ≥16.7 mmol / L (≥300 mg / dL) for two consecutive times, it indicated that the diabetic microangiopathy model mouse was successfully constructed.

[0074] 3) Group experiment

[0075] The mice with successfully constructed diabetic microangiopathy model were divided into model group (DM), positive group (DM+CMC-Na), treatment group I (DM+Formula I) and treatment group (DM+Formula II). In addition, normal C57BL / 6J mice were used as blank group (Non-DM). There were 10 mice in each group. The mice in the positive group were gavaged with 0.3% CMC-Na aqueous solution at a dose of 0.8 mg / kg / d for 6 consecutive months. The mice in the treatment group I were gavaged with a solution of the compound shown in Formula I for 6 consecutive months (the solvent was a 0.3% CMC-Na aqueous solution) at a dose of 0.8 mg / kg / d. The mice in the treatment group I were gavaged with a solution of the compound shown in Formula II for 6 consecutive months (the solvent was a 0.3% CMC-Na aqueous solution) at a dose of 0.8 mg / kg / d. The body weight and blood glucose level of the mice were regularly monitored during this period, and any adverse reactions were observed.

[0076] 4) SA-β-gal staining

[0077] The retinas of mice in each group after 6 months of drug intervention were taken for SA-β-gal staining examination. The mice were killed and the retinal tissue was peeled off. The retinal tissue was fixed in 4% paraformaldehyde, usually for 15-30 minutes, and rinsed with PBS. Retinal sections were obtained using a freezing microtome. SA-β-gal staining solution was prepared. The retinal sections were placed in the SA-β-gal staining solution and incubated at 37°C for 12 hours. After the incubation, the sections were removed and washed with PBS to terminate the staining reaction. The staining results were observed under an optical microscope. Senescent cells usually show blue staining. Image analysis software (ImageJ) was used to calculate the proportion of cells in the blue area in the sections of different mouse treatment groups, and then the percentage of SA-β-gal positive cells (Percentage of SA-β-gal positive cells) was calculated.

[0078] like Fig.10 As shown, the compound represented by formula (I) and the compound represented by formula (II) can reduce the percentage of senescent endothelial cells in the retina of diabetic mice.

[0079] 5) Evans blue staining test

[0080] The retinas of mice in each group were taken for Evans blue staining examination after 6 months of drug intervention.

[0081] Each group of mice was intravenously injected with 0.25mL 2% Evans blue dye solution. After 10-30min, the mice were killed and the retinas were removed. The blood vessel staining on the retina was observed under a microscope. The proliferation and leakage of blood vessels in the retina of each group of mice were recorded, and relevant images were taken and quantitatively analyzed. The sample tissue (retina) was quantitatively taken and its accurate weight (mg) was recorded. The tissue sample was placed in an appropriate amount of extract (DMSO) and incubated for 24 hours at room temperature or under appropriate conditions to extract Evans Blue. The absorbance of the extract was measured using a spectrophotometer, usually near a wavelength of 620nm (the maximum absorption peak of Evans Blue). The light absorption value (OD value) was recorded. A standard curve was prepared using an Evans Blue solution of known concentration (such as 0-100μg / mL). The absorbance values ​​at different concentrations were recorded, and a standard curve was prepared using an Evans Blue solution of known concentration (such as 0-100μg / ml). Record the absorbance values ​​at different concentrations, and use graphics software to draw a standard curve (concentration vs. absorbance), and use a linear regression equation to determine the slope (S) of the standard curve. Use graphics software to draw a standard curve (concentration vs. absorbance), and use a linear regression equation to determine the slope (S) of the standard curve. Normalize the Evans Blue concentration (μg / mL) to the sample tissue weight (mg) to obtain the Normalized Evans Blue concentration (μg / mg).

[0082] like Fig.11 As shown, after the compound represented by formula (I) and the compound represented by formula (II) were fed to diabetic (DM) mice for treatment, the vascular changes were observed by retinal flat mount using Evans blue perfusion angiography, and it was found that the proliferation and leakage of retinal blood vessels could be inhibited after treatment.

[0083] 6) PAS staining

[0084] The retinas of mice in each group after 6 months of drug intervention were taken for PAS staining examination. The mice in each group were surgically killed, and the retinal tissues were fixed in 4% paraformaldehyde solution for 1 hour, washed with PBS 3 times, dehydrated with 30%, 50%, 70%, 90% and 100% ethanol in sequence, treated with xylene, and then embedded in paraffin to make paraffin sections. The sections were dewaxed in pure ethanol and then rehydrated with 100%, 95%, and 80% ethanol in sequence. The sections were immersed in Periodic Acid (PA) solution (1%) and incubated at room temperature for 15 minutes to oxidize aldehydes in the tissue. Wash with deionized water to remove excess PA. The sections were immersed in Schiff's Reagent (1% Schiff reagent) and incubated in the dark for 15-30 minutes. The sections were washed with deionized water to remove unreacted Schiff reagent. The sections after PAS staining were observed under an optical microscope. The PAS-positive area appeared pink, representing the presence of glycogen and basement membrane. The PAS-positive and -negative areas in the retina were analyzed by optical microscopy, and the number and distribution of acellular capillaries were recorded. Different areas of the retina (such as the central and peripheral areas) were quantitatively compared, and the ratio of acellular capillaries (acellular vessels / fied) was calculated.

[0085] like Fig.12 As shown, after the compound represented by formula (I) and the compound represented by formula (II) were fed to diabetic (DM) mice, PAS staining experiments showed that the number of retinal acellular capillaries was significantly reduced and the microvascular function was improved.

[0086] In the embodiments of the present application, the ETS1 inhibitor further comprises at least one of a pharmaceutically acceptable excipient, adjuvant and prodrug, and the active ingredient is uniformly mixed with at least one of the pharmaceutically acceptable excipient, adjuvant and prodrug in an effective dose. An effective dose refers to a therapeutically effective amount, which refers to a dosage of the active ingredient of the embodiments of the present application sufficient to show benefits or clinical significance to an individual. It will be understood by those skilled in the art that the actual amount or dosage of administration and the administration schedule will depend on the nature and severity of the disease being treated, the age and general condition of the subject being treated, and the mode of administration, etc. The ETS1 inhibitor is administered to the subject via oral administration, intravenous injection, intravenous infusion, intraperitoneal injection, hepatic artery embolization chemotherapy, intramuscular injection and / or subcutaneous injection.

[0087] The pharmaceutically acceptable excipient refers to any excipient suitable for a specific mode of administration known to those skilled in the art. For example, in a specific embodiment, the pharmaceutically acceptable excipient may include one or more pharmaceutically acceptable carriers, solvents, excipients, buffers, and lubricants that are compatible with the active ingredients of the embodiments of the present application. Among them, the excipient should be non-toxic, not interfere with or impair the efficacy of the active ingredients of the embodiments of the present application, and the excipient can be flexibly selected according to the specific dosage form of the ETS1 inhibitor described in the above embodiments. The carrier includes but is not limited to sugars such as lactose, glucose and sucrose, starches such as corn starch and potato starch, cellulose and its derivatives such as sodium shuttle methyl cellulose, ethyl cellulose and cellulose acetate, etc. The excipient includes but is not limited to cocoa butter, suppository wax, oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil, glycols such as propylene glycol, esters such as ethyl oleate and ethyl dodecanoate, and agar, etc. The buffer includes but is not limited to at least one of magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethanol and phosphate buffer solution, etc. The lubricant includes but is not limited to sodium lauryl sulfate and magnesium stearate, etc. Further, according to the judgment of those skilled in the art, colorants, release agents, coating agents, sweeteners, flavoring agents, aromatics, preservatives and antioxidants can also be used as the auxiliary materials.

[0088] Preferably, the dosage form of the ETS1 inhibitor includes at least one of a solution, a pill, a tablet, a capsule, a powder, a paste, an aerosol and a patch.

[0089] The above-mentioned ETS1 inhibitor provided in the embodiments of the present application has a good ETS1 transcriptional inhibitory effect, can inhibit the abnormal upregulation of ETS1 expression in diabetic microangiopathy, and can be used to prepare drugs for preventing or treating diabetes from other regulatory effects on the pathological process, and can also be used to prepare drugs for preventing or treating diabetic microangiopathy.

[0090] Accordingly, the present application provides the use of the compound represented by the above formula (I) and the compound represented by the above formula (II) in the preparation of drugs for preventing or treating diabetes.

[0091] Accordingly, the present application provides the use of the compound represented by the above formula (I) and the compound represented by the above formula (II) in the preparation of drugs for preventing or treating diabetic microangiopathy.

[0092] In the above test examples, the compound represented by formula (I) and the compound represented by formula (II) showed inhibitory effects on the expression of IL-6, IL-1β, MMP-1, CXCL2, MCP-1, ICAM-1 and VCAM-1 in HRMEC cells, and can be used to prepare drugs for preventing or treating diabetic inflammation.

[0093] Accordingly, the present application provides the use of the compound represented by the above formula (I) and the compound represented by the above formula (II) in the preparation of drugs for preventing or treating diabetic inflammation.

[0094] In the above test examples, the compound represented by formula (I) and the compound represented by formula (II) showed an inhibitory effect on HRMEC cell proliferation. Accordingly, the present application provides the use of the compound represented by formula (I) and the compound represented by formula (II) in the preparation of a drug for inhibiting HRMEC cell proliferation.

[0095] In the above test examples, the compound represented by formula (I) and the compound represented by formula (II) show an effect of promoting the aging of HRMEC cells. Accordingly, the present application provides the use of the compound represented by formula (I) and the compound represented by formula (II) in the preparation of a drug for promoting the aging of HRMEC cells.

[0096] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. An ETS1 inhibitor, comprising at least one of the compounds represented by Formula I and Formula II as shown below as an active ingredient:

2. The inhibitor according to claim 1, further comprising at least one of a pharmaceutically acceptable auxiliary material, an adjuvant and a prodrug.

3. The inhibitor according to claim 2, wherein the pharmaceutically acceptable excipient comprises one or more pharmaceutically acceptable carriers, solvents, excipients, buffers, and lubricants compatible with the active ingredient.

4. The inhibitor according to claim 3, wherein the carrier comprises at least one of sugars, cellulose and derivatives thereof, the excipient comprises at least one of cocoa butter, suppository wax, oils, glycols such as propylene glycol, esters such as ethyl oleate and ethyl dodecanoate and agar, the buffer comprises at least one of magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethanol and phosphate buffer solution, and the lubricant comprises at least one of sodium lauryl sulfate and magnesium stearate.

5. The inhibitor according to claim 2, wherein the auxiliary material comprises at least one of a colorant, a release agent, a coating agent, a sweetener, a flavoring agent, an aroma, a preservative and an antioxidant.

6. Use of the compounds represented by formula I and / or formula II in the preparation of drugs for preventing or treating diabetes.

7. Use of the compounds represented by formula I and / or formula II in the preparation of drugs for preventing or treating diabetic microangiopathy.

8. Use of the compounds represented by formula I and / or formula II in the preparation of drugs for preventing or treating diabetic inflammation.

9. Use of the compounds represented by formula I and / or formula II in the preparation of drugs for inhibiting HRMEC cell proliferation.

10. Use of the compounds represented by formula I and / or formula II in the preparation of drugs for promoting apoptosis of senescent HRMEC cells.

Images