Application of miR-let-7 in preparation of medicine for treating necrotic apoptosis of dendritic cells

Abstract

The invention relates to the technical field of biomedicine, in particular to application of miRNA-1 et-7 in preparation of a drug for treating necroptosis of dendritic cells, through regulation and control research of miRNA-1 et-7 on the dendritic cells, immune activation and inhibition performance can be more accurately and effectively regulated, immune response efficiency is improved, and the drug for treating necroptosis of the dendritic cells can be used for preparing drugs for treating necroptosis of the dendritic cells. And a new thought and a new method are provided for treatment of immune-related diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to application of miR-let-7 in preparing a drug for treating dendritic cell necroptosis. Background Art

[0002] Sepsis is usually caused by microbial infection, which triggers a systemic inflammatory response, leading to the activation of multiple cells and molecules and the release of inflammatory mediators. These mediators are originally used to fight infection, but in sepsis, the inflammatory response may get out of control, triggering fatal organ dysfunction. The incidence and mortality of sepsis are increasing year by year, causing huge medical burden and social pressure.

[0003] Prior art, such as the invention patent with patent application number 2016102794739, provides an exosome, a method for preparing exosomes, and their use in preparing drugs or preparations for treating sepsis, specifically involving optimizing the treatment of human umbilical cord mesenchymal stem cells with recombinant human IL-1β to enhance their immunosuppressive function, and extracting the exosomes produced for the treatment of sepsis. The exosomes can effectively alleviate sepsis symptoms and increase the survival rate of septic mice by inhibiting T cells and macrophages.

[0004] As an important component of MSC-Exo, miRNA is involved in regulating various processes such as cell proliferation, differentiation, renewal and apoptosis. With the rapid development of next-generation sequencing technology, researchers have identified more than 150 miRNAs carried in MSC-Exo, which can be delivered to target cells and exert various biological effects through different pathways. At present, some studies have conducted miRNA sequencing on exosomes secreted by hUCMSC, and many studies have reported that the expression levels of miR-let-7a and miR-let-7f in hUC-MSC-Exo are at the forefront.

[0005] Therefore, through the study of miRNA-let-7 regulation of dendritic cells, we can more accurately and effectively regulate immune activation and inhibition, improve the efficiency of immune response, and provide new ideas and methods for the treatment of immune-related diseases. Summary of the invention

[0006] In order to solve the problems in the above-mentioned background technology, the first object of the present invention is to provide the use of miR-let-7 in the preparation of a drug for treating necroptosis of dendritic cells in sepsis, so as to clarify that miR-let-7 can inhibit DC necroptosis under sepsis conditions.

[0007] The second purpose of the present invention is to provide the use of miR-let-7 in the preparation of a drug for reducing the level of necroptosis-related proteins in splenic dendritic cells.

[0008] The third object of the present invention is to provide the use of miR-let-7 in the preparation of drugs for reducing the level of molecular patterns associated with dendritic cell necroptosis.

[0009] The fourth object of the present invention is to provide the use of miR-let-7 in the preparation of drugs for reducing the levels of cytokines related to dendritic cell necroptosis.

[0010] In summary, the beneficial effects of the present invention are: miR-let-7 can inhibit DC necroptosis under sepsis conditions, and can reduce the levels of necroptosis-related proteins, molecular patterns and cytokines in splenic dendritic cells. The above verification facilitates us to more accurately and effectively regulate immune activation and inhibition performance, and provide new ideas and methods for the treatment of immune-related diseases.

[0011] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention, it can be implemented in accordance with the contents of the specification. In order to make the above and other purposes, features and advantages of the present invention more obvious and easy to understand, the following specifically cites a preferred embodiment and describes it in detail with the accompanying drawings as follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Alizarin red staining of osteogenic differentiation of human umbilical cord mesenchymal stem cells, scale bar 200 μm;

[0013] Figure 2 Oil red O staining for adipogenic differentiation of human umbilical cord mesenchymal stem cells, scale bar 200 μm;

[0014] Figure 3 Toluidine blue staining of human umbilical cord mesenchymal stem cells into chondrogenic differentiation, scale bar 20 μm;

[0015] Figure 4 This is an identification diagram of surface markers of human umbilical cord mesenchymal stem cells (hUCMSC);

[0016] Figure 5 The diameter and distribution of mesenchymal stem cell exosomes were analyzed for nanoparticle tracking;

[0017] Figure 6 This is a morphological diagram of mesenchymal stem cell exosomes identified by transmission electron microscopy;

[0018] Figure 7 It is the identification diagram of exosome positive protein markers (TSG101, CD9, CD63) and negative protein markers (Calnexin);

[0019] Figure 8Flow cytometry was used to detect the proportion of DC necrosis and apoptosis in each group under sepsis conditions (parents)

[0020] Fig. 9 SYTOX-Green staining was used to detect the proportion of DC necroptosis cells in each group under sepsis conditions (parents);

[0021] Fig.10 Western Blot was used to detect the expression levels of necroptosis-related proteins in DCs of different groups;

[0022] Fig.11 Laser confocal microscopy was used to observe the fluorescence intensity and positive cell ratio of p-MLKL in DCs of different groups;

[0023] Fig.12 The fluorescence intensity and positive cell ratio of p-RIPK3 in DCs of different groups were observed by laser confocal microscopy;

[0024] Fig.13 ELISA was used to detect the levels of necroptosis-related DAMPs and cytokines in the culture supernatant of DCs in different groups. DETAILED DESCRIPTION

[0025] In order to make the content of the present invention more clearly understood, the present invention is further described below based on specific embodiments in conjunction with the accompanying drawings.

[0026] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials and reagents used are all reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0027] In this example, mouse spleen DCs were cultured in cell culture flasks and divided into 7 groups according to different intervention conditions, namely G1: blank control group (no treatment), G2: model group (1 μg / mL LPS + 2 μg / mL z-VAD), G3: treatment group (1 μg / mL LPS + 2 μg / mL z-VAD + 10 μg / mL MSC-Exo), G4: miR-let-7 mimic group (1 μg / mL LPS + 2 μg / mL z-VAD + miR-let-7a mimic), G5: miR-let-7 mimic control group (1 μg / mL LPS + 2 μg / mL z-VAD + miR-let-7a mimic NC), G6: miR-let-7 inhibitor group (1 μg / mL LPS + 2 μg / mL z-VAD + 10 μg / mL MSC-Exo + miR-let-7a inhibitor), G7: miR-let-7 inhibitor control group (1 μg / mL LPS+2μg / mL z-VAD+10μg / mL MSC-Exo+miR-let-7a inhibitor NC), collect cells and cell culture supernatant 24h after stimulation (treatment) and freeze at -80℃ for subsequent processing.

[0028] The mature miRNA sequence of miR-let-7a-5p mimic is UGAGGUAGUAGGUUGUAUAGUU, as shown in SEQ ID NO.1; the mature miRNA sequence of miR-let-7a-5p inhibitor is UGAGGUAGGUUGUAUAGUU, as shown in SEQ ID NO.2.

[0029] Experiment 1: Culture and identification of mesenchymal stem cells

[0030] 1. Mesenchymal stem cell culture

[0031] The present application uses human umbilical cord mesenchymal stem cells (hUCMSC), which were purchased from Beijing Aiyi Biotechnology Co., Ltd. and are second-generation hUCMSCs. They were cultured in a T75 culture flask using MEM medium containing 10% mesenchymal stem cell nutrient additives and passaged using 0.25% trypsin, with each passage being counted as one generation.

[0032] 2. Identification of Mesenchymal Stem Cell Differentiation

[0033] (1) Directed induction of hUCMSC osteogenic differentiation

[0034] S1, culture the third generation hUCMSCs, seed the third generation hUCMSCs with good growth in a six-well plate, and ensure that the number of cells seeded in each well is the same;

[0035] S2, when the growth density of the third generation hUCMSCs is about 70%, replace the complete medium, add 2 ml of growth medium to each well, and continue to incubate in the cell culture incubator;

[0036] S3, when the cell density grows to 90%, replace the culture medium, add 2 ml of complete osteogenic induction medium to each well, continue to incubate in the cell culture incubator, and replace the culture medium every 3 days until the formation of bone nodules can be observed under a microscope;

[0037] S4, after the bone nodule structure was formed, the culture medium was removed, and then the samples were rinsed three times with sterile phosphate-buffered saline (PBS), and then fixed with 4% paraformaldehyde at room temperature for 30 min;

[0038] S5, Alizarin red staining for 1 h, rinsed three times with PBS;

[0039] S6, counterstain with nuclear fast red for 5 min, rinse three times with PBS, and observe under a microscope.

[0040] The results are as follows Figure 1 shown.

[0041] (2) Directed induction of hUCMSC adipogenic differentiation

[0042] S1, seed the third-generation hUCMSCs with good growth into a six-well plate, ensuring that the number of cells seeded in each well is the same;

[0043] S2, when the growth density of the third generation hUCMSCs is about 70%, replace the complete medium, add 2 ml of growth medium to each well, and continue to incubate in the cell culture incubator;

[0044] S3, when the cell density grows to 90%, replace the culture medium, add 2 ml of complete adipogenic induction medium to each well, continue to incubate in the cell culture incubator, and replace the culture medium every 3 days until lipid droplets can be observed under a microscope;

[0045] S4, after lipid droplets were formed, the culture medium was removed, the cells were rinsed with PBS, and fixed with 4% paraformaldehyde at room temperature for 30 min;

[0046] S5, stain with Oil Red O for 10 min, wash off the stain with 60% isopropanol, rinse three times with PBS, and observe under a microscope.

[0047] The results are as follows Figure 2 shown.

[0048] (3) Directed induction of hUCMSC into chondrogenic differentiation

[0049] S1, seed the third-generation hUCMSCs with good growth into a six-well plate, ensuring that the number of cells seeded in each well is the same;

[0050] S2, when the growth density of the third generation hUCMSCs is about 70%, replace the complete medium, add 2 ml of growth medium to each well, and continue to incubate in the cell culture incubator;

[0051] S3, when the cell density grows to 90%, replace the culture medium, add 2 ml of complete chondrogenic induction medium to each well, continue to incubate in the cell culture incubator, and replace the culture medium every 3 days until the formation of cartilage nodules can be observed under a microscope;

[0052] S4, after the cartilage nodules were formed, the culture medium was removed, the cells were rinsed with PBS, and the cells were fixed with 4% paraformaldehyde at room temperature for 30 min;

[0053] S5, stain with toluidine blue for 30 min at room temperature, rinse three times with PBS, and observe under a microscope.

[0054] The results are as follows Figure 3 shown.

[0055] 3. Identification of hUCMSC surface markers

[0056] S1, take well-grown third-generation hUCMSCs, digest them with 0.25% trypsin for 3 min, centrifuge at 1000 rpm for 10 min, and discard the supernatant;

[0057] S2, wash the cells twice with pre-cooled PBS, resuspend the cells, and dispense into different flow tubes, with a cell volume of about 105 / ul, 100ul per tube;

[0058] S3, add CD11b, CD34, CD44, CD45, CD90, CD105 antibodies and isotype control antibodies to the cells in the flow tube, and then vortex on a vortex oscillator for 10 seconds to mix them thoroughly. Take another flow tube as a blank control (no antibody is added);

[0059] S4, after adding the antibody, incubate at room temperature in the dark for 30 min, then centrifuge at 1000 rpm for 10 min, and discard the supernatant;

[0060] S5, add 1 ml PBS to resuspend the cells, centrifuge at 1000 rpm for 10 min, discard the supernatant, and repeat the centrifugation once;

[0061] S6, then add 200ul PBS to resuspend the cells, blow thoroughly and then test on the instrument.

[0062] The results are as follows Figure 4As shown, flow cytometry identified MSC-specific positive surface antigens CD44, CD90 and CD105, with an expression rate greater than 95%; flow cytometry identified MSC-specific negative surface antigens CD11b, CD34 and CD45, with an expression rate no more than 2%.

[0063] Experiment 2: Isolation and identification of exosomes from mesenchymal stem cells

[0064] 1. Isolation of Mesenchymal Stem Cell Exosomes (MSC-Exo) by Ultracentrifugation

[0065] S1, culture the fourth-generation hUCMSCs in complete medium until the cell density reaches more than 65%, discard the complete medium, wash once with PBS, replace with serum-free medium, and continue culturing;

[0066] S2, when the cell density reaches more than 90% after rapid growth, collect the supernatant in the culture medium, and then freeze the culture medium in a -80°C refrigerator for subsequent exosome isolation and use;

[0067] S3, the supernatant collected in step S2 was restored to room temperature, mixed evenly and poured into a 50 mL centrifuge tube, centrifuged at 3000 g for 10 min at 4°C, and then filtered out cell debris using a 0.45 μm vacuum filter, and then filtered out cell debris using a 0.22 μm vacuum filter;

[0068] S4, using a tangential flow filtration automatic concentrator to concentrate the supernatant treated in step S3 to obtain a clarified culture supernatant, and then filling the clarified culture supernatant into ultracentrifuge tubes, using a balance to balance, and ensuring that the weight difference between every two ultracentrifuge tubes does not exceed 1 g;

[0069] S5, placing the balanced supernatant in an ultracentrifuge for centrifugation at a centrifugal force of 100,000 g, a centrifugal temperature of 4° C., and a centrifugal time of 2 h to obtain a sample;

[0070] S6, remove the sample supernatant and resuspend all the precipitates in pre-cooled PBS to obtain exosomes;

[0071] S7, BCA method was used to detect the concentration of exosome protein. After dilution, the samples were packaged at 200 μg / tube and then frozen in a -80°C refrigerator.

[0072] 2. MSC-Exo Identification

[0073] (1) Detection of exosome particle size by nanoparticle tracking analysis (NTA):

[0074] In this application, ZetaView PMX 110 was used to measure the concentration of the isolated MSC-Exo, wherein the emission wavelength was 405 nm, and the MSC-Exo suspension was diluted to 1×10 7 Particles / mL-1×10 9 After 1000 granules / mL, the size and distribution of MSC-Exo particles were determined. The results were as follows Figure 5 shown.

[0075] (2) Electron microscopy observation of exosome morphology:

[0076] Take 10 μL of the separated MSC-Exo solution and drop it on the copper grid, incubate it at room temperature for 10 minutes; after the incubation is completed, wash it with sterile deionized water, and then absorb the excess liquid with absorbent paper; drop 10 μL of 2% uranyl acetate on the copper grid and negatively stain it for 1 minute; after the negative staining is completed, use absorbent paper to absorb the floating liquid and dry it for 2 minutes; place the copper grid under a transmission electron microscope, use 80kv imaging to observe the morphology of exosomes and take pictures and record the results. Figure 6 shown.

[0077] (3) Detection of exosome-specific proteins:

[0078] Step 1: Obtain denatured protein:

[0079] According to the protein quantification results of the BCA method, the loading amount of 20 μg of exosome protein was calculated, and the protein loading buffer was added to the exosomes. Then, the mixture was vortexed and mixed, and then placed in a 100°C metal bath for 10 min to obtain denatured protein.

[0080] Step 2, SDS-PAGE gel preparation:

[0081] Before the experiment, clean the utensils used for preparing glue with distilled water, install the glass plates in order on the glue tank and clamp them, fill the glass plates with distilled water and test for leaks for 15-20 minutes;

[0082] Add separation gel buffer A and separation buffer B in a ratio of 1:1 into a centrifuge tube to prepare 9 ml of separation gel / block, then add 90 μl of 10% ammonium persulfate and mix thoroughly with a disposable pipette to obtain separation gel;

[0083] Meanwhile, in a centrifuge tube, mix the stacking gel buffer A and the stacking gel buffer B at a ratio of 1:1 to prepare 3 ml of stacking gel / block, and add 30 μl of 10% ammonium persulfate, and mix thoroughly with a disposable pipette to obtain stacking gel;

[0084] Add separation gel to the gap of the leak-tested glass plate to 4 / 5 of the height, then slowly add concentrated gel on top of the separation gel along the edge (no need to wait for the separation gel to solidify), then quickly insert a 15mm thick comb, make sure there are no obvious bubbles, and let it stand at room temperature for 20-25 minutes. After solidification, obtain SDS-PAGE gel;

[0085] Step 3, electrophoresis:

[0086] Place the SDS-PAGE gel in an electrophoresis tank, add the prepared 1× electrophoresis buffer (1× electrophoresis buffer is a mixture of 50 ml of 10× electrophoresis buffer and 450 ml of distilled water), remove the comb teeth and check the integrity of the gel; ensure that the electrophoresis buffer in the gel tank exceeds the upper edge of the gel, and continue to add electrophoresis buffer to the outside to half the height of the separation gel; use a pipette to add the denatured protein into the well, and connect the electrophoresis tank to the power supply; use a constant voltage of 180V for electrophoresis for about 45 minutes; keep the electrophoresis tank in a low temperature environment during the electrophoresis process; after the electrophoresis is completed, remove the glass plates on both sides, take out the gel and soak it in the prepared 1× electrotransfer buffer (the 1× electrotransfer buffer is a mixture of 50 ml of 10× electrotransfer buffer, 350 ml of distilled water and 100 ml of anhydrous methanol added in sequence).

[0087] Step 4: Electroporation:

[0088] Use the wet transfer method, prepare filter paper according to the size of the gel and soak it in 1× electrotransfer buffer. Take a PVDF membrane of appropriate size and soak it in anhydrous methanol for more than 5 minutes to charge the PVDF membrane. Place filter paper-SDS-PAGE gel-PVDF membrane-filter paper in order, remove bubbles and press tightly, and put it into the electrotransfer tank of 1× electrotransfer buffer. Transfer the membrane at a constant current of 200-300mA for 2-2.5h. Adjust the current size and transfer time according to the molecular weight of the target protein.

[0089] Step 5: Closing:

[0090] The PVDF membrane was blocked in a rapid blocking solution for 10 min, and then washed with the prepared 1×TBS-T (1×TBS-T is prepared by mixing 50 ml of 10×TBS-T with 450 ml of distilled water) for 3 times, each time for 15 min.

[0091] Step 6, incubate with antibodies:

[0092] Prepare the primary antibody with a dilution ratio of 1:1000, obtain the antibody diluent, place the PVDF membrane in the antibody diluent, and incubate overnight at 4°C; on the second day, wash the PVDF membrane three times with 1×TBS-T, incubate with anti-mouse or anti-rabbit HRP-coupled secondary antibody (secondary antibody dilution ratio of 1:5000) at room temperature for 60 minutes, and use 1×TBS-T for development after washing.

[0093] Step 7, protein blot development:

[0094] Prepare ECL developer and protect from light for subsequent use. Use ECL gel imaging system to detect protein expression, use β-actin expression as an internal reference, and use Image J software to analyze the gray value of the target band and perform statistical analysis.

[0095] The positive protein markers for exosome identification include CD9, CD63 and TSG101, and the negative protein marker is Calnexin. After incubation with the primary antibody of exosome protein marker and the secondary antibody of the corresponding species, the image was developed, exposed and recorded. The results are as follows: Figure 7 As shown in the figure, MSC is the human mesenchymal stem cell group, MSC-Exo is the mesenchymal stem cell exosome group, and EFs is the blank control group.

[0096] Experiment 3: Isolation and culture of mouse spleen DC

[0097] 1. Isolation of mouse spleen DCs using the STEMCELL EasySep method

[0098] S1, mice were killed by cervical dislocation, the abdominal skin was cut open after alcohol disinfection, and the spleen was bluntly separated and placed in a sterile centrifuge tube containing pre-cooled sterile phosphate-buffered saline (PBS);

[0099] S2, process spleen tissue in a clean bench, use forceps to remove connective tissue such as spleen capsule, carefully tear the spleen into pieces, and carefully transfer it to a cell filter (75 μm) to fully grind the spleen tissue. During the grinding process, rinse the filter with PBS intermittently. After the grinding is completed, mix the filtrate and transfer it to a centrifuge tube to obtain a spleen cell suspension;

[0100] S3, based on STEMCELL CD11c + Magnetic beads instructions, 1×10 8 Resuspend cells in 1 mL PBS; 8 The cells were blocked with 50 μL of rat serum, mixed by oscillation and incubated at room temperature for 5 min. The dosage of solution A and solution B was 25 μL / 10 8 For each cell, mix solution A and solution B in a ratio of 1:1, let stand at room temperature for 5 min after fully mixing, then add to the blocked spleen cell suspension, mix fully and incubate at room temperature for 5 min;

[0101] S4, after incubation, use a vortex mixer to fully shake the CD11c + Magnetic beads (RapidSpheres) 30s, 60μL / 10 8 The ratio of 10 cells was added to the cell suspension and incubated at room temperature for 3 minutes;

[0102] S5, transfer the incubated cell suspension to a 14 mL separation tube and resuspend it to the corresponding volume using PBS containing 2% fetal bovine serum (FBS) (if the cell suspension volume is <2 mL, the total volume after resuspension is 5 mL; if the cell suspension volume is ≥2 mL, the total volume after resuspension is 10 mL), place the separation tube in the EsaySep magnetic column, let it stand at room temperature for 3 minutes, then discard the liquid in the tube, take out the separation tube, and use PBS containing 2% FBS to carefully blow off the cells adsorbed on the tube wall and mix them, finally resuspend the total volume to 10 mL, repeat this step 3 times; after discarding the liquid in the separation tube for the last time, use 5 mL PBS to resuspend the cells in the tube, which is the mouse spleen CD11c + DC, counted and then processed.

[0103] 2. Isolation of mouse spleen DCs using Miltenyi CD11c magnetic beads

[0104] According to the instructions of Miltenyi CD11c magnetic beads, 1×10 7 Resuspend cells in 40 μL MACS buffer; adjust the volume at 10 μL / 10 7 CD11c magnetic beads were added to the spleen cell suspension and incubated at 4°C for 15 min;

[0105] After incubation, PBS was added to the spleen cell suspension for re-suspending, and then placed in a centrifuge for centrifugal separation at a speed of 1500 rpm for 5 min. After discarding the supernatant, the cells were resuspended in MACS buffer (the resuspension volume for MS separation column was 500 μL, and the resuspension volume for LS separation column was 1 mL). The separation column of the corresponding specification was selected according to the number of cells (the maximum number of cells separated by the MS separation column is 2×10 8 The maximum number of cells separated by the LS separation column is 2×10 9 ), put the separation column into the Miltenyi MiniMACS magnetic rack, rinse the separation column with a specified amount of PBS (MS: 500 μL; LS: 1 mL) before adding the cell suspension, add the spleen cell suspension when the PBS is about to drip off, add PBS for washing (MS: 500 μL; LS: 1 mL) when the spleen cell suspension is about to drip off, and repeat this step 3 times; after washing, carefully remove the separation column and place it in a 15 mL centrifuge tube, quickly add a specified amount of PBS (MS: 1 mL; LS: 3 mL), and then use the piston to push the liquid in the separation column out at a uniform speed, and the centrifuge tube is the mouse spleen CD11c + DC cell suspension, counted and ready for subsequent processing.

[0106] Experiment 4: miRNA mimics and inhibitor transfection experiment

[0107] S1, Cell inoculation: Count the cells and inoculate mouse spleen DC into a 24-well culture plate containing complete culture medium at 5×105 cells / well and divide the plates into seven groups.

[0108] S2, the above six groups of cells were stimulated with LPS and z-VAD to establish a mouse spleen DC sepsis cell model, and the remaining group was not treated, which was G1: blank control group. The method for establishing an in vitro sepsis model by LPS stimulation in this embodiment is: 2 hours after the cells were inoculated in the cell culture flask, an in vitro sepsis model was established by LPS stimulation at a concentration of 1 μg / mL. The cells were pre-stimulated with the broad-spectrum caspase kinase inhibitor z-VAD-FMK (z-VAD) at a working concentration of 2 μg / mL, and the cells were pre-stimulated with z-VAD for 30 minutes and then combined with LPS stimulation to induce necroptosis in the cells.

[0109] S3, respectively dissolving the mimic, the negative control mimic (mimic NC), the inhibitor and the negative control inhibitor (inhibitor NC) in an RNase-free aqueous solution (RNase-free H2O) to prepare mimic storage solution, mimic NC storage solution, inhibitor storage solution and inhibitor NC storage solution with a concentration of 20 μM;

[0110] S4, then 30 μL 1X riboFECT TM Dilute 1.25 μL of 20 μM mimic stock solution, 1.25 μL of 20 μM mimic NC stock solution, 2.5 μL of 20 μM inhibitor stock solution, and 2.5 μL of 20 μM inhibitor NC stock solution with CP Buffer, and mix them by gently pipetting to obtain mimic dilution solution, mimic NC dilution solution, inhibitor dilution solution, and inhibitor NC dilution solution;

[0111] S5, preparation of mixed solution: add 5 μL INTERFERin siRNA Transfection Reagent to mimic dilution solution, mimic NC dilution solution, inhibitor dilution solution and inhibitor NC dilution solution respectively, mix them by gently pipetting, and incubate at room temperature for 10 min to obtain mimic mixed solution, mimic NC mixed solution, inhibitor mixed solution and inhibitor NC mixed solution;

[0112] S6, respectively add the mimic mixture and mimic NC mixture to the two groups of cells after stimulation, and gently pipette to mix, to obtain G4: miR-let-7 mimic group (1 μg / mL LPS + 2 μg / mL z-VAD + miR-let-7a mimic) and G5: miR-let-7 mimic control group (1 μg / mL LPS + 2 μg / mL z-VAD + miR-let-7a mimic NC);

[0113] S7, respectively add the inhibitor mixture and inhibitor NC mixture to the other two groups of cells after stimulation, then add 10 μg / mL MSC-Exo to the two groups of cells, gently pipette and mix, and obtain G6: miR-let-7 inhibitor group (1 μg / mL LPS + 2 μg / mL z-VAD + 10 μg / mL MSC-Exo + miR-let-7a inhibitor) and G7: miR-let-7 inhibitor control group (1 μg / mL LPS + 2 μg / mL z-VAD + 10 μg / mL MSC-Exo + miR-let-7ainhibitor NC);

[0114] S8, of the remaining two groups of cells stimulated by LPS and z-VAD, one was left untreated, namely G2: model group (1μg / mL LPS + 2μg / mL z-VAD), and the other group was added with 10μg / mL MSC-Exo, and after pipetting and mixing, G3: treatment group (1μg / mLLPS + 2μg / mL z-VAD + 10μg / mL MSC-Exo) was obtained.

[0115] S9, then the seven groups of complete culture medium were placed in a 37°C cell culture incubator for further culturing for 48 h, and the transfection effect was observed using a fluorescence microscope.

[0116] Experiment 5: miR-let-7 inhibits DC necroptosis under sepsis conditions

[0117] Seven experimental groups with different intervention conditions were set up as in Experiment 4, and the necroptosis of DCs in each group was detected by flow cytometry and SYTOX-Green staining.

[0118] 1Flow cytometry

[0119] S1, collect cells from each group and count them according to 2.5×10 5 The cells / tube were placed in a flow tube, and 1 ml of PBS was added to allow the cells to be evenly distributed in the flow tube, followed by centrifugation at a speed of 1500 rpm for 5 min;

[0120] S2, discard the supernatant and resuspend the cell pellet with 1 mL of Binding Buffer, centrifuge again at 1500 rpm for 5 min, discard the supernatant and resuspend the cell pellet with 100 μL of Binding Buffer;

[0121] S3, add 5 μL Annexin V and 2.5 μL 7-AAD dye to each flow tube, tap the tube wall to evenly disperse the cells after adding the reagents, and incubate at room temperature in the dark for 15 min;

[0122] S4, set up double-negative tubes (without Annexin V and 7-AAD), single-stained tubes (only Annexin V was added), and single-stained tubes (only 7-AAD was added) as controls;

[0123] S5. After incubation, add 200 μL Binding Buffer to each tube, flick the tube wall to mix, and then detect and analyze necrosis and apoptosis cells (Annexin V + 7-AAD + ) ratio; FlowJo V 10.0 software was used to reanalyze the data of each group.

[0124] 2SYTOX-Green staining

[0125] S1, prepare SYTOX-Green dead cell nucleic acid dye: dilute the SYTOX-Green dead cell nucleic acid dye stock solution (5 mM) with DMSO at a dilution ratio of 1:10000 to a final concentration of 50 nM;

[0126] S2, in vitro experimental part, 100 nM SYTOX-Green dye was added during the cell culture process, and the cell culture process was continued after addition;

[0127] S3, collect cells, count the cells and calculate the value of 2.0×10 6 The cells / tubes were collected in flow tubes and then placed in a centrifuge for centrifugation at 1500 rpm, room temperature, and 5 min. The cell pellets were then resuspended in 1 mL PBS and centrifuged again. The centrifugation conditions were the same and repeated 3 times.

[0128] S4, after washing the cells in the flow tube, discard the supernatant completely, resuspend the cell pellet with 60-70 μL PBS, and repeatedly blow and beat with a pipette to obtain a cell suspension;

[0129] S5, take 35 μL of cell suspension and drop it on a glass slide, cover it with a cover slip, spread it flat in a wet box, and send it for examination and filming;

[0130] S6, SYTOX-Green positive cells were observed and photographed using a fluorescence microscope, and Image J software was used to count and analyze the ratio of positive cells to the total number of cells in the field of view.

[0131] The results are as follows Figure 8 and Fig. 9 As shown, the proportion of DCs undergoing necroptosis under in vitro sepsis conditions was significantly increased, and MSC-Exo treatment could significantly reduce the proportion of DCs undergoing necroptosis (flow cytometry: G1 vs G2, P < 0.0001; G2 vs G3, P < 0.00010; SYTOX-Green staining: G1 vs G2, P < 0.0001; G2 vs G3, P < 0.05);

[0132] Compared with the in vitro stimulation group, transfection of miR-let-7a mimic into DCs could reduce the proportion of DCs undergoing necroptosis after stimulation (flow cytometry: G4 vs G2, P < 0.0001; SYTOX-Green staining: G4 vs G2, P < 0.01), while the proportion of DCs undergoing necroptosis after stimulation in the miR-let-7a mimic NC transfection group was significantly increased;

[0133] Compared with the treatment group, transfection of miR-let-7a inhibitor into DCs could offset the protective effect of MSC-Exo, and the proportion of necroptotic DCs was significantly higher than that in the treatment group (flow cytometry: G6 vs G3, P < 0.001; SYTOX-Green staining: G6 vs G3, P < 0.0001). However, the proportion of necroptotic cells in DCs in the miR-let-7a inhibitor NC group did not increase significantly after in vitro stimulation and MSC-Exo treatment.

[0134] The results showed that miR-let-7a could effectively reduce the proportion of DC necroptosis in sepsis.

[0135] Experiment 6: MSC-Exo reduces the levels of DC necroptosis-related proteins under sepsis conditions

[0136] Seven experimental groups with different intervention conditions were set up as in Experiment 4, and the expression levels of necroptosis-related proteins in DCs of different groups were detected by Western Blot and laser confocal microscopy.

[0137] (1) Western Blot method to detect protein levels

[0138] Step 1, SDS-PAGE gel preparation:

[0139] Before the experiment, clean the utensils used for preparing glue with distilled water, install the glass plates in order on the glue tank and clamp them, fill the glass plates with distilled water and test for leaks for 15-20 minutes;

[0140] Add separation gel buffer A and separation buffer B in a ratio of 1:1 into a centrifuge tube to prepare 9 ml of separation gel / block, then add 90 μl of 10% ammonium persulfate and mix thoroughly with a disposable pipette to obtain separation gel;

[0141] Meanwhile, in a centrifuge tube, mix the stacking gel buffer A and the stacking gel buffer B at a ratio of 1:1 to prepare 3 ml of stacking gel / block, and add 30 μl of 10% ammonium persulfate, and mix thoroughly with a disposable pipette to obtain stacking gel;

[0142] Add separation gel to the gap of the leak-tested glass plate to 4 / 5 of the height, then slowly add concentrated gel on top of the separation gel along the edge (without waiting for the separation gel to solidify), then quickly insert a 15 mm thick comb, make sure there are no obvious bubbles, and let it stand at room temperature for 23 minutes. After solidification, obtain SDS-PAGE gel;

[0143] Step 2, electrophoresis:

[0144] Place the SDS-PAGE gel in an electrophoresis tank, add the prepared 1× electrophoresis buffer (1× electrophoresis buffer is a mixture of 50 ml of 10× electrophoresis buffer and 450 ml of distilled water), remove the comb teeth and check the integrity of the gel; ensure that the electrophoresis buffer in the gel tank exceeds the upper edge of the gel, and continue to add electrophoresis buffer to the outside to half the height of the separation gel; use a pipette to add the protein sample to the well, and connect the electrophoresis tank to the power supply; use a constant voltage of 180V for electrophoresis for about 45 minutes; keep the electrophoresis tank in a low temperature environment during the electrophoresis process; after the electrophoresis is completed, remove the glass plates on both sides, take out the gel and soak it in the prepared 1× electrotransfer buffer (the 1× electrotransfer buffer is a mixture of 50 ml of 10× electrotransfer buffer, 350 ml of distilled water and 100 ml of anhydrous methanol added in sequence).

[0145] Step 3, electroporation:

[0146] Use the wet transfer method, prepare filter paper according to the size of the gel and soak it in 1× electrotransfer buffer. Take a PVDF membrane of appropriate size and soak it in anhydrous methanol for more than 5 minutes to charge the PVDF membrane. Place filter paper-SDS-PAGE gel-PVDF membrane-filter paper in order, remove bubbles and press tightly, and put it into the electrotransfer tank of 1× electrotransfer buffer. Transfer the membrane at a constant current of 200-300mA for 2-2.5h. Adjust the current size and transfer time according to the molecular weight of the target protein.

[0147] Step 4: Closure:

[0148] The PVDF membrane was blocked in a rapid blocking solution for 10 min, and then washed with the prepared 1×TBS-T (1×TBS-T is prepared by mixing 50 ml of 10×TBS-T with 450 ml of distilled water) for 3 times, each time for 15 min.

[0149] Step 5, incubate with antibodies:

[0150] Prepare the primary antibody with a dilution ratio of 1:1000, obtain the antibody diluent, place the PVDF membrane in the antibody diluent, and incubate overnight at 4°C; on the second day, wash the PVDF membrane three times with 1×TBS-T, incubate with anti-mouse or anti-rabbit HRP-coupled secondary antibody (secondary antibody dilution ratio of 1:5000) at room temperature for 60 minutes, and use 1×TBS-T for development after washing.

[0151] Step 6, protein blot development:

[0152] Prepare ECL developer and protect from light for subsequent use. Use ECL gel imaging system to detect protein expression, use β-actin expression as an internal reference, and use ImageJ software to analyze the gray value of the target band and perform statistical analysis.

[0153] The experimental results are as follows Fig.10 As shown in the results, the phosphorylation levels of RIPK1, RIPK3 and MLKL in DC cells were significantly increased under in vitro sepsis conditions, and MSC-Exo treatment could significantly reduce the levels of p-RIPK1, p-RIPK3 and p-MLKL.

[0154] Compared with the in vitro stimulation group, transfection of miR-let-7a mimic into DCs could reduce the phosphorylation level of necroptosis-related proteins, while the phosphorylation level of necroptosis proteins in DCs transfected with miR-let-7a mimic NC group was significantly upregulated after stimulation.

[0155] Compared with the treatment group, transfection of miR-let-7a inhibitor into DCs could offset the protective effect of MSC-Exo, and the phosphorylation level of intracellular necroptosis-related proteins was significantly higher than that in the treatment group, while the phosphorylation level of necroptosis proteins in DCs in the miR-let-7ainhibitor NC group did not increase significantly after in vitro stimulation and MSC-Exo treatment.

[0156] The results showed that miR-let-7a could effectively reduce the phosphorylation level of necroptosis proteins in DCs during sepsis.

[0157] (2) Laser confocal microscopy

[0158] Laser confocal microscopy imaging technology

[0159] S1, cells from each group were collected and counted, and the cells were counted at 2.0×10 6 Cells / tubes were collected in flow tubes;

[0160] S2, place the flow tube in a centrifuge for centrifugation at a speed of 1500 rpm, at room temperature, for 5 min, discard the supernatant completely, add 1 mL of PBS to resuspend the cell pellet, and centrifuge again. Repeat 3 times to wash the cells;

[0161] S3, use 30 μL Trixon and 9970 μL deionized water to prepare a 0.3% Trixon solution for cell membrane permeabilization, and vortex to mix;

[0162] S4, weigh 0.1 g of BSA and dissolve it in 10 mL of deionized water to obtain a 1% BSA solution;

[0163] S5, add 500 μL of 0.3% Trixon solution to each flow tube treated in step S2, tap the tube wall to mix the cells, and let stand at room temperature in the dark for 10 min;

[0164] S6, after the cell membrane is broken, the flow tube is placed in a centrifuge for centrifugation at a speed of 1500 rpm, at room temperature, for 5 min. Then, the cell pellet is resuspended in 1 mL PBS and centrifuged again. Repeat this 3 times for cell washing.

[0165] S7, add 200 μL of primary antibody solution to 1% BSA solution to obtain a mixed primary antibody solution;

[0166] S8, add 200 μL of mixed primary antibody solution to the flow tube treated in step S6, tap the tube wall to mix the cells, seal with sealing film, and incubate in a 4°C refrigerator overnight;

[0167] S9, after the primary antibody incubation is completed, remove the sealing film, put the flow tube into the centrifuge for centrifugation, the speed of the centrifuge is 1500rpm, the centrifugation temperature is room temperature, the centrifugation time is 5min, use 1mL PBS to resuspend the cell pellet and centrifuge again, repeat 3 times to wash the cells;

[0168] S10, adding 200 μL of secondary antibody solution to 1% BSA solution to obtain a diluted mixed secondary antibody solution;

[0169] S11, add 200 μL of mixed secondary antibody solution to the flow tube treated in step S9, tap the tube wall to mix the cells, seal it with sealing film, and stand it at room temperature away from light for 1 hour;

[0170] S12, after the secondary antibody incubation is completed, remove the sealing film, put the flow tube into the centrifuge for centrifugation, the speed of the centrifuge is 1500rpm, the centrifugation temperature is room temperature, the centrifugation time is 5min, use 1mL PBS to resuspend the cell pellet and centrifuge again, repeat 3 times to wash the cells, pay attention to avoid light during this process, and prepare the slide and cover slip at the same time;

[0171] S13, after washing the cells in the flow tube, discard the supernatant completely, use 60-70μL PBS to resuspend the cell pellet, repeatedly blow and mix evenly with a pipette, take 35μL of the cell suspension and drop it on the slide, then add 5μLDA I solution to the cell droplet, carefully cover with a coverslip, spread it flat in a wet box, and send it for inspection and filming.

[0172] The results are as follows Fig.11 and Fig.12 As shown, MSC-Exo treatment could significantly reduce the fluorescence intensity and positive cell ratio of p-MLKL and p-RIPK3 in DCs under sepsis conditions.

[0173] Compared with the in vitro stimulation group, transfection of miR-let-7a mimic into DCs could reduce the fluorescence intensity and positive cell ratio of p-MLKL and p-RIPK3 in DCs after stimulation, while the expression levels of p-MLKL and p-RIPK3 in DCs in the miR-let-7a mimic NC transfection group were significantly upregulated after stimulation.

[0174] Compared with the treatment group, transfection of miR-let-7a inhibitor into DCs could offset the protective effect of MSC-Exo, and the fluorescence intensity and positive cell ratio of p-MLKL and p-RIPK3 were significantly higher than those in the treatment group, while the expression levels of p-MLKL and p-RIPK3 in DCs in the miR-let-7ainhibitor NC group did not increase significantly after in vitro stimulation and MSC-Exo treatment.

[0175] The results showed that miR-let-7a could significantly reduce the upregulation of p-MLKL and p-RIPK3 in DC cells caused by sepsis.

[0176] Experiment 7: miR-tineilet-7 Reduce DC necroptosis-associated molecular patterns (DAMPs) and cytokine levels under sepsis conditions

[0177] Seven experimental groups with different intervention conditions were set up as in Experiment 4, and the levels of necroptosis-related DAMPs and cytokines in the DC culture supernatants of different groups were detected by ELISA.

[0178] S1, sample processing method: in the in vitro experiment part, after LPS+z-VAD combined stimulation, the culture medium was collected, and then the culture medium was placed in a centrifuge for centrifugation at room temperature, with a centrifugal speed of 1500 rpm and a centrifugal time of 5 min, and then the supernatant was retained;

[0179] S2, cytokine levels in cell culture supernatant were detected by ELISA kit;

[0180] S3, take out the pre-coated and sealed 96-well plate, equilibrate to room temperature, add the standard and specimen universal diluent to the blank wells, add 100 μL of the diluted cell culture supernatant of each group to the remaining wells, seal the reaction wells with sealing tape, place in a 37°C constant temperature box, and incubate in the dark for 90 minutes;

[0181] S4, after the incubation is completed, the reaction solution in the ELISA plate is aspirated, and the biotinylated antibody working solution is prepared 20 minutes in advance. 100 μL of the biotinylated antibody diluted at 1:100 is added to the reaction well, and the reaction well is sealed with sealing tape, and the plate is placed in a 37°C incubator and incubated for 60 minutes in the dark;

[0182] S5, wash the plate with washing buffer, soak for 1 min each time, repeat 5 times;

[0183] S6, after washing, add 100 μL of diluted peroxidase-labeled avidin into the reaction wells at a dilution ratio of 1:100, seal the reaction wells with sealing tape, place in a 37°C incubator, and incubate in the dark for 30 min;

[0184] S7, wash the plate with washing buffer, soak for 90 seconds each time, repeat 5 times;

[0185] S8, add 90 μL of chromogenic substrate to the reaction well, place in a 37°C incubator, and incubate for 20 min in the dark;

[0186] S9. After the incubation is completed, add 100 μL of reaction stop solution to the reaction well and mix gently. According to the microplate reader operation method, detect the OD value of each well at a wavelength of 450 nm within 3 minutes after adding the reaction stop solution, and calculate the concentration of the measured cytokine.

[0187] The results are as follows Fig.13 As shown in the results, the levels of HMGB1, IL-1α, IL-33, LDH and TNF-α in the culture supernatant of DCs under in vitro sepsis conditions were significantly upregulated, and the levels of necroptosis-related factors were significantly decreased after MSC-Exo treatment (HMGB1: P < 0.01; IL-1α: P < 0.01; IL-33: P < 0.05; TNF-α: P < 0.001; LDH: P < 0.01).

[0188] Compared with the in vitro stimulation group, transfection of miR-let-7a mimic into DCs could reduce the levels of necroptosis-related factors after stimulation (HMGB1: P < 0.05; IL-1α: P < 0.05; IL-33: P < 0.05; TNF-α: P < 0.01; LDH: P < 0.05), while the cytokine levels of DCs in the miR-let-7a mimic NC group after stimulation had no significant difference from those in the stimulation group (G2).

[0189] Compared with the treatment group, the protective effect of MSC-Exo disappeared after the miR-let-7a inhibitor was transfected into DCs, and the levels of necroptosis-related factors were significantly higher than those in the treatment group (HMGB1: P < 0.001; IL-1α: P < 0.05; IL-33: P < 0.05; TNF-α: P < 0.01; LDH: P < 0.001), while the cytokine levels of DCs in the miR-let-7a inhibitor NC group after in vitro stimulation and MSC-Exo treatment were not significantly different from those in the treatment group (G3).

[0190] The results showed that miR-let-7a could effectively reduce the levels of DAMPs and cytokines released by DC necroptosis during sepsis.

[0191] The embodiments described above are only preferred implementation modes of the present invention and cannot be used to limit the protection scope of the present invention. Any non-substantial changes and modifications made by those skilled in the art on the basis of the invention shall fall within the protection scope of the present invention.

Claims

1. Application of miR-let-7 in the preparation of drugs for treating dendritic cell necroptosis in sepsis.

2. Application of miR-let-7 in the preparation of drugs for reducing the levels of proteins related to necroptosis of splenic dendritic cells.

3. Application of miR-let-7 in the preparation of drugs for reducing the levels of molecular patterns associated with necroptosis in dendritic cells.

4. Application of miR-let-7 in the preparation of drugs for reducing the levels of cytokines related to dendritic cell necroptosis.

Images