Application of ferrous sulfate in preparation of medicine for treating intrahepatic cholestasis in gestation period

Abstract

The invention discloses application of ferrous sulfate in preparation of a medicine for treating intrahepatic cholestasis in a gestation period, and belongs to the field of medicine. The invention finds that ferrous sulfate can improve intrahepatic cholestasis in the gestation period and relieve liver and placenta injury, and on the basis, placenta functions and filial generation development are improved. The invention provides a new treatment means for preparing the medicine for treating the intrahepatic cholestasis in the gestation period, and provides a new means and way for treating the intrahepatic cholestasis in the gestation period by applying the ferrous sulfate to the development process of the medicine related to the intrahepatic cholestasis in the gestation period.

Description

Technical Field

[0001] The invention relates to application of ferrous sulfate in preparing a medicine for treating intrahepatic cholestasis of pregnancy, and belongs to the field of medicine. Background Art

[0002] Intrahepatic cholestasis of pregnancy (ICP) is a liver disease limited to pregnancy, with typical symptoms such as itchy skin, jaundice, and increased bile acid levels. Although these symptoms and abnormal biochemical indicators usually disappear soon after delivery, ICP is very likely to reoccur in the second pregnancy or when estrogen and progesterone are used for contraception. This disease not only increases the possibility of maternal hepatobiliary diseases, but also easily leads to adverse perinatal consequences, such as intrauterine fetal ischemia and hypoxia, premature birth, meconium staining, neonatal respiratory distress syndrome, and even stillbirth.

[0003] At present, the main treatment strategies for ICP include: using topical moisturizers and oral antihistamines to temporarily relieve the rash-free itching caused by ICP; using intestinal bile acid binders such as activated carbon, guar gum, and cholestyramine to accelerate the excretion of bile acids and block their recirculation from the intestine to the liver; and using ursodeoxycholic acid (UDCA) and S-adenosylmethionine (SAMe) to detoxify bile acids or change their solubility state. However, these treatment measures can only slightly relieve the itching symptoms of ICP patients, and have no significant effect on improving intrahepatic cholestasis during pregnancy and preventing adverse perinatal consequences. There is currently no definite and effective treatment for problems such as spontaneous abortion, fetal respiratory distress, and neonatal developmental retardation that may occur during pregnancy.

[0004] Therefore, finding and screening effective drugs is particularly important for treating ICP and improving pregnancy outcomes. Summary of the invention

[0005] To solve the above problems, the present invention finds that the use of ferrous sulfate can improve liver and placental damage caused by ICP, and on this basis, improve pregnancy outcomes.

[0006] The main use of ferrous sulfate is as an iron supplement for the treatment and prevention of iron deficiency anemia. Ferrous sulfate is a common form of iron that is easily absorbed and utilized by the human body. When the human body lacks iron, it will lead to reduced hemoglobin synthesis, which in turn causes iron deficiency anemia. Taking ferrous sulfate can quickly replenish iron, promote hemoglobin synthesis, and improve anemia symptoms. Appropriate supplementation of ferrous sulfate can also help promote children's growth and development and improve physical fitness. However, no studies have yet reported the role of ferrous sulfate in the treatment of ICP.

[0007] The first object of the present invention is to provide the use of ferrous sulfate or a composition containing ferrous sulfate in the preparation of a medicament for treating ICP.

[0008] In one embodiment, the symptoms of intrahepatic cholestasis of pregnancy are manifested by pruritus and elevated total bile acid levels.

[0009] In one embodiment, the drug is in any pharmaceutically acceptable dosage form.

[0010] In one embodiment, the dosage form includes: tablets, oral solutions, injections, pills, powders or capsules.

[0011] In one embodiment, the composition further comprises an auxiliary material.

[0012] In one embodiment, the excipient is a pharmaceutically acceptable excipient; optionally, the excipient includes: one or more of probiotics, lactose, maltose, microcrystalline cellulose, carboxymethyl cellulose, hydroxypropyl methyl cellulose, starch, sucrose, glucose, aspartame, water, glycerol, whey protein powder, and chitosan oligosaccharide.

[0013] In one embodiment, the drug further comprises a drug carrier.

[0014] In one embodiment, the drug carrier comprises microcapsules, microspheres, nanoparticles and / or liposomes.

[0015] The second object of the present invention is to provide a pharmaceutical composition for treating intrahepatic cholestasis of pregnancy, wherein the pharmaceutical composition contains ferrous sulfate.

[0016] In one embodiment, the pharmaceutical composition further comprises: one or more of S-adenosylmethionine, dexamethasone, Yinchenhao decoction, Sumetai, Yousifu, adenosylmethionine butadiene sulfonate, Yinzhihuang oral liquid, and probiotics.

[0017] In one embodiment, the probiotics include one or more of Bifidobacterium, Lactobacillus and Bacillus subtilis.

[0018] The third object of the present invention is to provide the use of ferrous sulfate or a composition containing ferrous sulfate in the preparation of a drug for improving placental function in intrahepatic cholestasis of pregnancy and promoting vascular development.

[0019] Beneficial effects:

[0020] The present invention finds that the use of ferrous sulfate can improve ICP and relieve liver and placental damage, and on this basis, improve pregnancy outcomes. Specifically, the administration of ferrous sulfate can: (1) significantly inhibit the abnormal increase of total bile acid (TBA) in ICP mice; (2) significantly improve liver damage in ICP mice, inhibit the abnormal increase of aspartate aminotransferase (AST) and alanine aminotransferase (AST) in the liver; (3) significantly improve the placental blood flow state of mice, increase the placental weight, fetal mouse weight and fetal mouse crown-rump length; (4) significantly improve the mRNA related to the placental function of mice.

[0021] The present invention provides a new treatment method for preparing drugs for treating ICP, and applies ferrous sulfate to the ICP-related drug development process to prepare a better method for treating ICP. The present invention provides a new idea for current drugs for treating ICP, broadens the selection field of drugs for treating ICP, and also contributes to the development of this technical field. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a schematic diagram showing that ferrous sulfate reduces the serum and placental TBA content in mice and reduces the liver AST and ALT activities, with TBA in serum and placental tissues, liver AST, and liver ALT as indicators.

[0023] Figure 2 Schematic diagram showing that ferrous sulfate improves the morphology of mouse liver and placenta, using H&E staining of liver and placenta, liver lipid droplet area and sinusoid area as indicators.

[0024] Figure 3 Schematic diagram showing how ferrous sulfate improves placental function in mice, with placental weight, fetal weight and crown-rump length as indicators, as well as a gross picture of the fetus after cesarean section.

[0025] Figure 4 Schematic diagram of mRNA related to ferrous sulfate improving mouse placental function. DETAILED DESCRIPTION

[0026] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0027] raw material:

[0028] Ferrous sulfate was purchased from Shanxi Lijiu Pharmaceutical Co., Ltd., and C57BL / 6 mice were from the Experimental Animal Center of Jiangnan University.

[0029] Detection method:

[0030] 1. Biochemical index detection

[0031] The AST content in liver tissue was detected using an aspartate aminotransferase detection kit (Nanjing Jiancheng Company);

[0032] Alanine aminotransferase detection kit (Nanjing Jiancheng Company) was used to detect the ALT content in liver tissue;

[0033] The total bile acid detection kit (Nanjing Jiancheng Company) was used to detect the TBA content in serum, placenta and liver tissue.

[0034] 2. Tissue pathological damage detection

[0035] Mouse placenta and liver tissues were first fixed by immersing them in 4% paraformaldehyde, and then dehydrated with gradient alcohol concentrations from 70% to 100%. After dehydration, the tissues were made transparent with 100% xylene, then placed in a wax tank for immersion in wax, and then embedded. Finally, paraffin sections were made, stained with an H&E staining kit (Nanjing Jiancheng Company), and observed and photographed under a microscope.

[0036] Example 1: Application of ferrous sulfate in the treatment of ICP

[0037] The therapeutic effect of ferrous sulfate on ICP was tested through animal experiments. The specific methods are as follows:

[0038] 1. Animal experiment (ICP model was established by feeding feed containing 0.5% w / w cholic acid (CA))

[0039] Experimental methods

[0040] The night before, the mice were paired and caged in a ratio of 3:1. The sperm was observed under a microscope through vaginal smear on the morning of the second day. The mice were considered to have successfully mated if a large number of sperm were observed to be swimming, which was recorded as the first day of pregnancy. The pregnant mice were fed a normal diet until the 12.5th day of pregnancy, and were divided into 4 groups according to the principle of consistent body weight: normal group (Normal), normal drug group (Normal+5mg / kgFeSO4), model group (0.5%CA) and treatment group (0.5%CA+5mg / kgFeSO4). From the 12.5th day, the pregnant mice in the model group and the treatment group were fed with a feed containing 0.5%CA until the end of pregnancy, thereby creating an ICP model; the treatment group was given 5mg / kgFeSO4 every day while the model was being established. The control group and the normal drug group always had a normal diet, and the normal drug group was given 5mg / kgFeSO4 every day from the 12.5th day. The pregnant mice underwent cesarean section on the 20.5th day of gestation, and the maternal serum and liver were removed to study whether the ICP model was successful; the placenta and fetuses were removed to study the effect of intrahepatic cholestasis on pregnancy outcomes.

[0041] 2. Treatment effect detection

[0042] (1) TBA content and liver function

[0043] The TBA content in mouse serum and placental tissue, as well as the activity of liver AST and ALT were detected. Figure 1 And as shown in Table 1.

[0044] The results showed that the serum TBA in the model group (0.5% CA) increased by 216% and the TBA in the placental tissue increased by 195% compared with the normal group; in the treatment group (0.5% CA + 5mg / kg FeSO4) administered with ferrous sulfate, compared with the model group, the serum TBA of mice decreased by 45% and the TBA in the placental tissue decreased by 29%, that is, ferrous sulfate has the effect of inhibiting the abnormal increase of TBA in ICP. In the model group (0.5% CA), the AST in the liver tissue of mice increased by 99% and the ALT increased by 98%; in the treatment group (0.5% CA + 5mg / kg FeSO4) administered with ferrous sulfate, compared with the model group, the AST in the liver tissue of mice decreased by 51% and the ALT decreased by 49%, indicating that ferrous sulfate has the effect of improving liver damage in ICP. There was no significant difference in various indicators between the normal administration group and the normal group, indicating that 5mg / kg FeSO4 did not cause damage to the serum and liver of the body.

[0045] Table 1 TBA content and AST activity

[0046]

[0047] (2) Pathological changes in the liver and placenta

[0048] AST / ALT index is an important biomarker for predicting ICP liver function. The AST and ALT values ​​in liver tissue are tested. The results are as follows: Figure 2 And as shown in Table 2.

[0049] The degree of vacuolization in mouse liver tissue and the area of ​​blood sinusoids in placenta were detected. Figure 2 And as shown in Table 2.

[0050] The results showed that H&E staining of the liver of mice in the model group (0.5% CA) showed uneven arrangement of liver cords, nuclear condensation, increased vacuolation of liver tissue, and 98% increase in lipid droplet area; while H&E staining of the liver of mice in the treatment group showed uniform arrangement of liver cords, reduced liver vacuolation and nuclear condensation, and 39% decrease in lipid droplet area compared with the model group. The area of ​​the placental sinusoids of mice in the model group (0.5% CA) decreased by 32%; while the area of ​​the sinusoids in the treatment group increased by 48% compared with the model group, indicating that ferrous sulfate has the effect of improving liver tissue damage and placental blood vessels in ICP. There was no significant difference in various indicators between the normal drug administration group and the normal group, indicating that 5mg / kg FeSO4 did not cause damage to the liver and placental tissues of the body.

[0051] Table 2 Liver lipid droplet area and placental sinusoid area

[0052]

[0053] (3) Development of mouse offspring

[0054] The placenta weight, fetal weight and crown-rump length of mice were tested. Figure 3 And as shown in Table 3.

[0055] The results showed that the placental weight of mice in the model group (0.5% CA) decreased by 20%, the fetal weight decreased by 34%, and the crown-rump length decreased by 23%; while in the treatment group (0.5% CA + 5mg / kg FeSO4), compared with the model group, the placental weight increased by 27%, the fetal weight increased by 28%, and the crown-rump length increased by 19%, that is, ferrous sulfate has the effect of improving the placental function in ICP. There was no significant difference in various indicators between the normal administration group and the normal group, indicating that 5mg / kg FeSO4 did not cause harm to the placenta and fetuses.

[0056] Table 3 Placental function

[0057]

[0058] (4) Placental function in mice

[0059] RT-qPCR was used to detect the relative expression of mouse placenta-related mRNA (Pgf, Fatp4, Glut1, Igf2, Snat2). The results are as follows: Figure 4And as shown in Table 4.

[0060] The results showed that the relative mRNA expression levels of Pgf, Fatp4, Glut1, Igf2, and Snat2 were significantly lower than those in the normal group, and were only about 1 / 2 of that in the control group; while in the treatment group (0.5% CA + 5mg / kg FeSO4), compared with the model group, the relative mRNA expression levels of Pgf, Fatp4, Glut1, Igf2, and Snat2 in the model group were significantly increased, indicating that ferrous sulfate has the effect of improving placental function in ICP.

[0061] The q-PCR primer sequences are as follows:

[0062] Pgf:

[0063] Upstream primer: AGTGGAAGTGGTGCCTTTCAA;

[0064] Downstream primer: GTGAGACACCTCATCAGGGTA;

[0065] Fatp4:

[0066] Upstream primer: ACTGTTCTCCAAGCTAGTGCT;

[0067] Downstream primer: GATGAAGACCCGGATGAAACG;

[0068] Glut1:

[0069] Upstream primer: TCAAACATGGAACCACCGCTA;

[0070] Downstream primer: AAGAGGCCGACAGAGAAGGAA;

[0071] Igf2:

[0072] Upstream primer: CGTGGCATCGTGGAAGAGT;

[0073] Downstream primer: ACGTCCCTCTCGGACTTGG;

[0074] Snat2:

[0075] Upstream primer: GGGACATAAGGCGTATGGTCT;

[0076] Downstream primer: GGTAGCTTGACATAGCCCCAA.

[0077] Table 4 Relative expression of placental function-related mRNA

[0078]

[0079] Comparative Example 1 Increasing the dose of ferrous sulfate cannot treat ICP

[0080] This study also attempts to increase the dose of ferrous sulfate (FeSO4) to supplement the iron ion deficiency in the mother mouse. The specific implementation method refers to Example 1, the difference is that the dose of ferrous sulfate is changed to 10 mg / kg. The experimental results show that when the mother mouse is given 10 mg / kg of FeSO4, the cavitation phenomenon of the liver and the degeneration and necrosis of liver cells are not alleviated, but the degeneration of liver cells is aggravated. At the same time, this dose of FeSO4 did not improve the blood flow of the placenta, but caused the blood sinus area to further decrease. In addition, we tested the birth weight, placental weight and crown-rump length of the offspring mice in this dose group. The results showed that the birth weight and placental weight of the offspring mice did not improve, but the crown-rump length decreased. Judging from the gross pictures of the offspring mice, this dose did not show a significant improvement effect. The specific results are as follows Figure 2 and Figure 3 shown.

[0081] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. Use of ferrous sulfate or a composition containing ferrous sulfate in the preparation of a medicament for treating intrahepatic cholestasis of pregnancy.

2. The use according to claim 1, characterized in that: Symptoms of intrahepatic cholestasis of pregnancy include pruritus, elevated total bile acid levels, and elevated aspartate aminotransferase.

3. The use according to claim 1, characterized in that: The drug is in any pharmaceutically acceptable dosage form.

4. The use according to claim 3, characterized in that: The dosage forms include tablets, oral solutions, injections, pills, powders or capsules.

5. The use according to claim 1, characterized in that: The medicine also contains auxiliary materials.

6. The use according to claim 5, characterized in that: The excipients are pharmaceutically acceptable excipients; optionally, the excipients include: one or more of probiotics, lactose, maltose, microcrystalline cellulose, carboxymethyl cellulose, hydroxypropyl methyl cellulose, starch, sucrose, glucose, aspartame, water, glycerol, whey protein powder, and chitosan oligosaccharide.

7. The use according to claim 6, characterized in that: The medicine also contains a drug carrier.

8. The use according to claim 7, characterized in that: The drug carrier comprises microcapsules, microspheres, nanoparticles and / or liposomes.

9. A pharmaceutical composition for treating intrahepatic cholestasis of pregnancy, characterized in that: The pharmaceutical composition contains ferrous sulfate; the pharmaceutical composition also includes: one or more of S-adenosylmethionine, dexamethasone, Yinchenhao decoction, Sumetai, Yousifu, adenosylmethionine butadiene sulfonate, Yinzhihuang oral liquid, and probiotics; the probiotics include: one or more of bifidobacteria, lactobacilli and Bacillus subtilis.

10. Use of ferrous sulfate or a composition containing ferrous sulfate in the preparation of a drug for improving placental function in intrahepatic cholestasis of pregnancy and promoting vascular development.

Images