Application of T1FR protein in inhibition of Klebsiella pneumoniae and salmonella enteritidis type I pilus

Abstract

The invention discloses an application of T1FR protein in inhibition of Klebsiella pneumoniae and salmonella enteritidis I-type fimbriae, and relates to the technical field of biology. Specifically, the T1fr gene is subjected to exogenous expression in klebsiella pneumoniae and salmonella enteritidis, and a biological factor T1FR protein coded by the T1fr gene can inhibit klebsiella pneumoniae and salmonella enteritidis adhesion factor I-type fimbriae, so that adsorption and colonization of pathogenic bacteria in human and animal tissues are inhibited through biological factors, and the use of antibiotics is effectively reduced; a theoretical basis is provided for relieving the drug resistance problem of klebsiella pneumoniae and salmonella, and an important reference scheme is provided for controlling bacterial infection and biofilm formation.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of a T1FR protein in inhibiting type I pili of Klebsiella pneumoniae and Salmonella enteritidis. Background Art

[0002] Klebsiella pneumoniae is a conditional pathogen in the intestinal and respiratory tracts of humans and animals. In recent years, drug-resistant Klebsiella pneumoniae has become one of the main pathogens of hospital infections. Fimbriae play an important role in the pathogenicity of Klebsiella pneumoniae. There are mainly type I and type III fimbriae. Type I fimbriae are protein protrusions on the surface of bacteria. The fimbriae protein consists of a group of fim ( A, B, C, D, E, F, G, H, K ) gene group. FimA constitutes the most important structural subunit of the pili. The pili adhesin protein FimH is connected to the pili rod composed of FimA through two minor structural subunits FimF and FimG. The epithelial tissues of humans and mammals contain glycoproteins containing mannose. FimH adhesins adhere to the host epithelium by recognizing glycoproteins containing mannose, and eventually colonize the host epithelium to cause infection. Similar to the expression regulation mechanism of Escherichia coli type I, the type I pili of Klebsiella pneumoniae are also located in fimA A phase change switch upstream of the gene" fimS "Directional inversion is used to regulate," fimS " is a 314bpd DNA sequence. When this switch is in the "on" state, the promoter will begin to transcribe and express to form pili. Type III pili of Klebsiella pneumoniae are important structures that affect the formation of biofilms in Klebsiella pneumoniae implanted medical materials. The genes encoding type III pili are mainly mrk ( E, A, B, C, D, F )in mrkA The gene encodes the main structural subunit of the pilus, accounting for more than 90% of the pilus protein composition.

[0003] Salmonella is a zoonotic pathogen of global concern. It has a very wide host spectrum and can cause intestinal diseases or systemic diseases in humans and animals. Salmonella type I pili are involved in mediating the process of bacterial adhesion to various cells and are the key to Salmonella colonization and invasion of hosts. It secretes adhesins through FimH at the tip of type I pili to recognize mannose-containing glycoproteins on eukaryotic cell membranes, adhere to human and mammalian epithelial tissues, and cause infection. fim (A, I, C, D, H, F) The gene cluster encodes an operon domain under the control of the fimA promoter. FimZ, FimY and FimW regulate the transcription and expression of type I fimbriae structural genes. FimZ is the main activator of type I fimbriae expression in Salmonella and can directly bind to fimA Promoter region, FimY promotes fimZ FimW can inhibit the expression of fimZ Express.

[0004] Klebsiella pneumoniae and Salmonella type I pili cause bacterial infections in humans and animals, and promote the adsorption of bacteria on biological or non-biological surfaces, leading to biofilm formation and significantly increasing bacterial resistance. The use of antibiotics has led to an increasingly serious problem of bacterial resistance. Although methods such as metal nanomaterials have been developed, which have a certain effect on the biofilm that has already formed, how to prevent bacterial infection and biofilm formation, using biological factors to block the adhesion of bacterial type I pili is an effective method. In this application, it was found that T1FR protein can inhibit the formation of Klebsiella pneumoniae and Salmonella type I pili, providing an important reference solution for preventing bacterial infection and biofilm formation. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a biological factor T1FR protein in inhibiting type I pili of Klebsiella pneumoniae and Salmonella enteritidis. The T1FR protein can prevent bacterial colonization in tissues and prevent the formation of bacterial biofilms, thereby providing a new approach and reference scheme for controlling bacterial infection and biofilm formation.

[0006] In order to achieve the above object, the present invention provides a use of a T1FR protein in inhibiting type I fimbriae of pathogenic bacteria, wherein the amino acid sequence of the T1FR protein is shown in SEQ ID NO.10.

[0007] Furthermore, the above-mentioned pathogenic bacteria are Klebsiella pneumoniae and Salmonella enteritidis, and the T1FR protein can inhibit the formation of biofilms of Klebsiella pneumoniae and Salmonella enteritidis.

[0008] The T1FR protein provided by the present invention can be used for infection prevention, control and treatment of Klebsiella pneumoniae and Salmonella enteritidis, wherein the amino acid sequence of the T1FR protein is shown in SEQ ID NO.10.

[0009] The present invention also provides a method for inhibiting type I fimbriae of Klebsiella pneumoniae and Salmonella enteritidis by using T1FR protein, which is specifically carried out by constructing a recombinant plasmid containing a nucleotide sequence such as the sequence shown in SEQ ID NO.9, and transferring the constructed recombinant plasmid into Klebsiella pneumoniae and Salmonella enteritidis for exogenous expression.

[0010] Furthermore, the above-mentioned recombinant plasmid is preferably selected from pUC19.

[0011] The present invention has the following advantages: The present invention discloses for the first time that the biological factor T1FR protein can inhibit the adhesion factor type I pili of Klebsiella pneumoniae and Salmonella enteritidis, can effectively reduce the adsorption and colonization of pathogenic bacteria in human and animal tissues, effectively reduce the use of antibiotics, can significantly alleviate the problem of drug resistance of Klebsiella pneumoniae and Salmonella in the process of antibiotic use, and provides a new way to control bacterial infection and biofilm formation. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Picture 1 Schematic diagram of TIFR protein inhibiting type I fimbriae of Klebsiella pneumoniae and Salmonella enteritidis.

[0013] Picture 2 The knockout of ATCC13883 strain in the present invention mrkA Upstream and downstream validation results of genes.

[0014] Picture 3 ATCC13883 strain and ATCC13883Δ mrkA strain fimA Gene expression test results.

[0015] Picture 4 For carrying T1fr Recombinant plasmid pUC19+ T1fr Structure diagram of .

[0016] Picture 5 for T1fr Gene in ATCC13883△ mrkA Validation results of expression in strains.

[0017] Picture 6 For the exogenous expression of the present invention T1fr Klebsiella pneumoniae fimA Gene expression test results.

[0018] Picture 7 The Klebsiella pneumoniae type I pili phase change switch in the present invention is fimS " and E. coli " fimS "Sequence alignment results of T1FR protein binding region in ".

[0019] Picture 8 The results of transmission electron microscopy observation of the inhibition of Klebsiella pneumoniae type I fimbriae by the T1FR protein of the present invention.

[0020] Picture 9 for T1fr Verification results of gene expression in Salmonella Enteritidis ATCC13076 strain.

[0021] Picture 10 For the exogenous expression of the present invention T1frSalmonella enteritidis fimA Gene expression test results.

[0022] Picture 11 Salmonella enteritidis fimA Promoters and the Escherichia coli type I fimbriae phase switch fimS "Sequence alignment results of T1FR protein binding region in ".

[0023] Picture 12 The results of transmission electron microscopy observation of the inhibition of the T1FR protein of the present invention on type I fimbriae of Salmonella enteritidis. DETAILED DESCRIPTION

[0024] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Note: The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0026] Example 1 1. Knock out the Klebsiella pneumoniae (ATCC13883) by Red homologous recombination technology mrkA Gene.

[0027] Homologous recombination primers were designed, the specific sequences were as follows, and pKD3 plasmid was used as a template for amplification. The amplified product was recovered and purified by gel recovery to obtain the chloramphenicol resistance gene containing the homologous arms.

[0028] Homologous recombination primer sequences: F (SEQ ID NO.1): ATTCACAGTGTGCTCATTGATTCGTAATTCACTCTGACAAGGAAATGGCAGGCATATGAATATCCTCCTTAG; R (SEQ ID NO.2): TTATTGTTATTAACTGCCCCATCGCGGGGCAGTTTTATTTTCTGACGGAATGTGTAGGCTGGAGCTGCTTCG.

[0029] The pKD46-Tet plasmid and the purified DNA product were simultaneously electroporated into ATCC13883 bacteria, screened by LB solid medium containing 16 μg / mL chloramphenicol, and single clones were picked and amplified in LB liquid medium containing 16 μg / mL chloramphenicol. The knockout strain was verified by PCR, where the upstream verification primers mrkA-ko(check)-F1 (SEQ ID NO.3): ATACAAGCGGCGGACA, mrkA-ko(check)-R1 (SEQ ID NO.4): TGGCGATTCAGGTTCAT; the downstream verification primers mrkA-ko(check)-F2 (SEQ ID NO.5): CAACAGGGACACCAGGAT, mrkA-ko(check)-R2 (SEQ ID NO.6): CTTTGACGCCGATAGCA, and the upstream and downstream verification results are as follows: Picture 2 The verified strain was inoculated into liquid culture medium, shaken and cultured at 42°C to eliminate the pKD46-Tet plasmid, and named ATCC13883△ mrkA .

[0030] 2. ATCC13883 strain and ATCC13883△ mrkA strain fimA Detection of gene expression fimA The gene encodes the Klebsiella pneumoniae fimbrial protein FimA, which is the main structural protein of type 1 fimbriae and helps bacteria attach to host cells, leading to bacterial infection.

[0031] Detection of ATCC13883 strain and ATCC13883△ by PCR mrkA strain fimA Gene expression, detection primers are fimA- F (SEQ ID NO.7): GGCGTATGGTTTCGCTGTG; fimA- R (SEQ ID NO.8): TGCGTCCGTTTTGTCCG). The quantitative results are shown in Picture 3 As shown, the results showed that ATCC13883△ mrkA Compared with ATCC13883 strain fimA Gene expression was significantly increased.

[0032] 6. Build T1fr Gene expression vector pUC19+ T1fr The homologous recombination method was used to construct T1fr pUC19 plasmid containing the gene, T1fr The nucleotide sequence of the gene is shown in SEQ ID NO.9, and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO.10. The cloned plasmid obtained after successful sequencing verification is recorded as pUC19+ T1fr The schematic diagram of the cloning plasmid is shown in Picture 4 shown.

[0033] 7. T1fr Gene in ATCC13883△ mrkA Exogenous expression of strains ATCC13883△ mrkA The strain was cultured at 37°C with shaking until the logarithmic phase, and the pUC19 empty plasmid and pUC19+ T1fr Plasmid was transformed into ATCC13883△ mrkA strain and named ATCC13883△ mrkA / pUC19 strain and ATCC13883△ mrkA / pUC19+ T1fr strains, and the plasmid was verified by PCR in ATCC13883△ mrkA The transformation results in the strains are shown in Picture 5 The primers used included:

[0034] pUC19-F (SEQ ID NO. 11): GGCAACTATGGATGAACG pUC19-R (SEQ ID NO. 12): GCAAGCAGCAGATTACGC; T1fr -F (SEQ ID NO.13): TGTCCGCAGCAACCTTAC T1fr -R (SEQ ID NO. 14): ATTTGTTTCCTGGTCACTCA.

[0035] 5. Exogenous expression T1fr Klebsiella pneumoniae fimA Detection of gene expression PCR detection of ATCC13883△mrkA strain, ATCC13883△mrkA / pUC19 strain and ATCC13883△mrkA / pUC19+ T1fr In strains fimA The expression of the gene was detected using the primers described in SEQ ID NO.7-8 in (2). The quantitative results were as follows Picture 6 As shown, the results showed that exogenous expression T1frATCC13883△ mrkA / pUC19+ T1fr strains, which fimA Gene expression was significantly reduced.

[0036] 6. Comparative analysis of the phase change switch of type I pili of Klebsiella pneumoniae fimS " and E. coli " fimS "Sequence of the T1FR protein binding region in Escherichia coli" fimS "TAAATAAAGATAACAA" in the molecule inhibits the production of type I pili. The comparison results are shown in Picture 7 As shown, it can be seen that the phase change switch of type I pili of Klebsiella pneumoniae is fimS "TAAAATAGATATA and Escherichia coli" fimS The T1FR protein binding region is highly homologous.

[0037] 7. Inhibition results of T1FR protein on type I pili of Klebsiella pneumoniae ATCC13883△ mrkA Strain, ATCC13883△ mrkA / pUC19 strain and ATCC13883△ mrkA / pUC19+ T1fr The strains were inoculated into LB solid medium, cultured overnight at 37°C, and single clones were picked and stained with 2% phosphotungstic acid for 3-10 seconds, dried at room temperature, and then observed with a JEM-1400FLASH transmission electron microscope. Picture 8 As shown, exogenous expression T1fr Gene ATCC13883△ mrkA / pUC19+ T1fr The type I pili of the strain were significantly inhibited.

[0038] 8. T1fr Gene exogenous expression in Salmonella Enteritidis (ATCC13076) The ATCC13076 strain was cultured at 37°C with shaking until the logarithmic phase, and pUC19 and pUC19+ T1fr The plasmid was transformed into ATCC13076 strain by electroporation and named ATCC13076 / pUC19 strain and ATCC13076 / pUC19+ T1fr strain, and the transformation result of the plasmid in the ATCC13076 strain was verified by PCR. The detection primers were as described in SEQ ID NO.11~14 in (4) above. The detection results were as follows Picture 9 shown.

[0039] 9. Exogenous expression T1frGene, Salmonella Enteritidis fimA Detection of gene expression PCR detection of ATCC13076 strain, ATCC13076 / pUC19 strain and ATCC13076 / pUC19+ T1fr strain fimA The expression of genes was detected by primers fimA -F (SEQ ID NO.15): TGCCTTTCTCCATCGTC, fimA -R (SEQID NO.16): TTGCGGTAGTGCTATTGTC. The quantitative results are as follows Picture 10 As shown, the results showed that exogenous transformation T1fr ATCC13076 / pUC19+ T1fr strain fimA Gene expression was significantly reduced.

[0040] 8. Salmonella Enteritidis fimA Promoters and the Escherichia coli type I fimbriae phase switch fimS " Sequence alignment of T1FR protein binding region in .

[0041] The comparison results are as follows Picture 11 As shown, Salmonella Enteritidis can be seen fimA The promoter 'TAAATAAAAAATAGCC' is similar to the promoter ' fimS The T1FR protein binding region of the mitochondria is highly homologous to that of FimZ, the major activator of type I fimbriae expression. fimA The binding regions of the promoters overlap.

[0042] 11. Determination of the inhibitory effect of T1FR protein on type I fimbriae of Salmonella ATCC13076 strain, ATCC13076 / pUC19 strain and ATCC13076 / pUC19+ T1fr The strains were inoculated into LB solid medium, cultured overnight at 37°C, and single clones were picked and stained with 2% phosphotungstic acid for 3-10 seconds, dried at room temperature, and then observed with a JEM-1400FLASH transmission electron microscope. Picture 12 As shown, exogenous expression T1fr Gene ATCC13076 / pUC19+ T1fr The type I pili of the strain were significantly inhibited.

[0043] In summary, through exogenous expression T1fr The gene, the T1FR protein expressed by it can effectively inhibit the type I pili of Klebsiella pneumoniae and Salmonella enteritidis. The schematic diagram of TIFR protein inhibiting type I pili of Klebsiella pneumoniae and Salmonella enteritidis is shown in Picture 1 The technical solution provided by the present invention has application prospects in the prevention, control and treatment of Klebsiella pneumoniae and Salmonella enteritidis infections, and at the same time provides an important basis and approach for rationally reducing the use of antibiotics.

[0044] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. An application of T1FR protein in inhibiting type I pili of pathogenic bacteria, characterized in that: The amino acid sequence of the T1FR protein is shown in SEQ ID NO.

10.

2. The use according to claim 1, characterized in that: The pathogenic bacteria are Klebsiella pneumoniae and Salmonella enteritidis.

3. The use according to claim 2, characterized in that: The T1FR protein can inhibit the formation of biofilms of Klebsiella pneumoniae and Salmonella enteritidis.

4. A use of T1FR protein in infection prevention, control and treatment of Klebsiella pneumoniae and Salmonella enteritidis, characterized in that: The amino acid sequence of the T1FR protein is shown in SEQ ID NO.

10.

5. A method for inhibiting type I pili of Klebsiella pneumoniae and Salmonella enteritidis using T1FR protein, characterized in that: A recombinant plasmid containing a nucleotide sequence as shown in SEQ ID NO.9 is constructed, and the recombinant plasmid is transferred into Klebsiella pneumoniae and Salmonella enteritidis for exogenous expression.

6. The method according to claim 5, characterized in that The recombinant plasmid is selected from pUC19.

Images