Application of miRNA-5134-5p inhibitor in preparation of anti-breast cancer drugs

Abstract

The invention belongs to the technical field of biological medicine, and discloses application of a miRNA-5134-5p inhibitor in preparation of an anti-breast cancer drug, and the miRNA-5134-5p inhibitor can effectively inhibit invasion and migration ability of breast cancer cells and has a remarkable anti-breast cancer effect. The invention further provides a nucleotide sequence of the miRNA-5134-5p inhibitor, a probe sequence for detecting the expression level of the miRNA-5134-5p, a small molecule medicine for resisting breast cancer and a kit for evaluating the malignant degree of the breast cancer. Experiments prove that the miRNA-5134-5p inhibitor can significantly inhibit the malignant phenotype of breast cancer cells, and has potential clinical application value. The invention provides a new target and strategy for the treatment of breast cancer, and has important clinical development and application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically discloses the application of miRNA-5134-5p inhibitor in the preparation of anti-breast cancer drugs. Background Art

[0002] Breast cancer (BC) is one of the most common malignant tumors that affect women's survival. The symptoms of early breast cancer are not obvious, and are often local symptoms such as breast lumps, breast skin abnormalities, nipple discharge, nipple or areola abnormalities, etc., which are very easy to be ignored due to their subtle manifestations. In the middle and late stages of breast cancer, cachexia will appear, which may be accompanied by symptoms such as loss of appetite, anorexia, weight loss, fatigue, anemia and fever, which is an urgent problem to be solved in the treatment of breast cancer.

[0003] MicroRNA (miRNA for short) is a short non-coding RNA molecule with a length of approximately 18 to 25 nucleotides. As a core regulatory molecule in the development of tumors, miRNA has shown great potential as a clinical disease diagnostic tool and a new anti-cancer therapy biomarker. Current studies have revealed that a variety of miRNAs can specifically regulate the expression of genes closely related to cancer, and may play the role of oncogenes or tumor suppressor genes. In view of its small molecular weight, easy cell acceptance and relatively low synthesis cost, miRNA is regarded as a preferred target for tumor targeted therapy. In the preventive strategy of breast cancer, miRNA can regulate multiple biological processes related to the initiation and progression of breast cancer, covering key links such as epithelial-mesenchymal transition (EMT), programmed cell death (apoptosis) and cell cycle regulation. However, it is worth noting that, to date, the actual application of miRNA-5134-5p in the treatment of breast cancer has not been reported. Summary of the invention

[0004] In order to solve the above problems, the present invention provides the application of miRNA-5134-5p inhibitor in anti-breast cancer. The miRNA-5134-5p inhibitor disclosed in the present invention can effectively inhibit the invasion and migration ability of breast cancer and has obvious anti-liver cancer effect. At the same time, the present invention also discloses that by detecting the expression level of miRNA-5134-5p in breast cancer, the metastasis ability of breast cancer can be predicted, which has potential application value in the treatment of breast cancer.

[0005] The present invention is achieved through the following technical solutions:.

[0006] The present invention discloses for the first time the use of a miRNA-5134-5p inhibitor in the preparation of an anti-breast cancer drug.

[0007] Furthermore, in the above application, the breast cancer is triple-negative breast cancer.

[0008] Furthermore, in the above application, the nucleotide sequence of the miRNA-5134-5p is shown as SEQ ID No.1; the nucleotide sequence of the miRNA-5134-5p inhibitor is shown as SEQ ID No.2.

[0009] The present invention also discloses the use of biologically active fragments containing miRNA-5134-5p inhibitors in the preparation of anti-breast cancer drugs, characterized in that the biologically active fragments include but are not limited to recombinant plasmid vectors or recombinant viral vectors containing the nucleotide sequence of the miRNA-5134-5p inhibitor.

[0010] The invention also discloses a group of probes for detecting the expression level of miRNA-5134-5p, which have nucleotide base sequences as shown in SEQ ID No. 3 and 4.

[0011] The present invention also discloses a small molecule drug for anti-breast cancer, characterized in that the small molecule drug comprises a biologically active fragment containing a miRNA-5134-5p inhibitor.

[0012] Furthermore, the above-mentioned small molecule drug also includes a medically acceptable carrier and / or excipient; preferably, the carrier and / or excipient is one or more of chitosan, cholesterol, liposome, cyclodextrin and microcapsule.

[0013] Furthermore, the above-mentioned small molecule drug is in the form of an oral agent or an injection; the injection includes but is not limited to an intravenous injection, an intramuscular injection or an intratumoral injection.

[0014] The present invention also discloses a kit for evaluating the malignancy of breast cancer. The kit comprises primers for specifically detecting the expression level of miRNA-5134-5p, and the primers comprise upstream primers and downstream primers.

[0015] Furthermore, in the above kit, the sequence of the upstream primer is shown as SEQ ID No.3, and the sequence of the downstream primer is shown as SEQ ID No.4.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The miRNA-5134-5p inhibitor disclosed in the present invention can significantly inhibit the invasion and migration of breast cancer cells in vivo and in vitro. We found in the embodiments that after overexpressing miRNA-5134-5p, the invasion and migration of breast cancer cells increased significantly, and transfection of miRNA-5134-5p inhibitors can inhibit the malignant phenotype of breast cancer cells. Therefore, the miRNA inhibitor provided by the present invention can be used to prepare anti-breast cancer drugs, improve the clinical treatment effect of malignant progressive tumors of breast cancer, and has good clinical development and application value. Further, the present invention also found that by detecting the expression level of miRNA-5134-5p in breast cancer, the metastatic ability of breast cancer can be predicted, which provides a new biomarker for early diagnosis and prognosis evaluation of breast cancer, and has important clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 To detect the expression of miRNA-5134-5p in cells by qPCR;

[0019] Figure 2 The transwell experiment was used to detect the effect of miRNA-5134-5p on the invasion ability of breast cancer cells;

[0020] Figure 3 The CCK8 experiment was used to detect the effect of miRNA-5134-5p on the proliferation ability of breast cancer cells;

[0021] Figure 4 The cell scratch assay was used to detect the effect of miRNA-5134-5p on the migration ability of breast cancer cells;

[0022] Figure 5 The plate cloning experiment was used to detect the effect of miRNA-5134-5p on the cloning ability of breast cancer cells;

[0023] Figure 6 The qPCR experiment was used to detect the effect of miRNA-5134-5p on the transcriptional levels of proteins in the EMP and apoptosis pathways of breast cancer cells;

[0024] Figure 7 The WB experiment was used to examine the effect of miRNA-5134-5p on the protein levels of EMP, apoptosis pathway and other proteins in breast cancer cells. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with the accompanying drawings and embodiments, and the contents of the embodiments are not intended to limit the protection scope of the present invention.

[0026] The nucleotide base sequence of the miRNA-5134-5p provided by the present invention is 5'-UUGGCAGAAAGGGCAGCUGUG-3' (as shown in SEQ ID NO.1), and the nucleotide base sequence of the miRNA-5134-5p inhibitor provided is CACAGCUGCCCUUUCUGCCAA (as shown in SEQ ID NO.2). The biologically active fragment of the miRNA-5134-5p inhibitor can be a recombinant plasmid vector or a recombinant viral vector of the nucleotide sequence of miRNA-5134-5p, but is not limited to.

[0027] The kit for evaluating the malignancy of breast cancer of the present invention comprises primers required for specifically detecting the expression level of miRNA-5134-5p, wherein the primers comprise an upstream primer and a downstream primer; the nucleotide base sequence of the upstream primer is 5'-CCAGGAGGCTGAGGTC-3' (as shown in SEQ ID NO.3) and the nucleotide base sequence of the downstream primer is 5'-GTCCAGTTTTTTTTTTTTTTTAGGGA-3' (as shown in SEQ ID NO.4).

[0028] The reagents, materials and instruments used in the experiments are shown in Tables 1 and 2 below:

[0029] Table 1: Relevant materials for cell culture experiments

[0030]

[0031]

[0032] Table 2: Instruments and equipment

[0033]

[0034]

[0035] The following is a detailed description through specific embodiments.

[0036] Example 1

[0037] In this embodiment, breast cancer cells 4T1 were used as an experimental model, and the miRNA-5134-5p and miRNA-5134-5p inhibitor of the present invention were transfected into breast cancer cells to up-regulate or down-regulate the level of intracellular miRNA-5134-5p, and then the effect of miRNA-5134-5p on the invasion, migration, cell population dependence, and proliferation ability of breast cancer cells was detected.

[0038] Step 1: Construction of miRNA-5134-5p overexpression and knockdown cell lines

[0039] A. Prepare two 1.5mL EP tubes, add 250μL DMEM medium to each, and in the overexpression group, add 3μL NC mimics to one EP tube and 3μL miRNA-5134-5p mimics to the other EP tube. Similarly, in the knockdown group, add 3μL NC inhibitor to one EP tube and 3μL miRNA-5134-5p iinhibitor to the other EP tube.

[0040] B. Prepare 4 1.5mL EP tubes, each containing 250μL DMEM culture medium and 5μL Thermo Fisher Lip2000 transfection reagent, and mix well.

[0041] C. Combine the mixtures from steps A and B, flick to mix, and let stand at room temperature for 15-20 minutes away from light.

[0042] D. Select 4T1 cells in good condition (60-80% density), discard the old culture medium, and wash with PBS.

[0043] E. Add the mixture from step C to the cells, supplement with 1.5 mL of DMEM medium, and incubate at 37°C.

[0044] F. Check the cell status after 4-6 hours, remove the culture medium and wash the cells with PBS, then add new culture medium with 10% serum and continue culturing. Collect the cells 24-36 hours after transfection to detect the expression effect of miRNA-5134-5p.

[0045] Step 2: Prepare the reverse transcription reaction solution according to the following components

[0046] Table 3: miRNA reverse transcription reaction solution formula

[0047]

[0048] Table 4: miRNA reverse transcription PCR program

[0049] 37℃ 60min 95℃ 5min

[0050] After obtaining the cDNA product, the HG miRNA fluorescent quantitative PCR kit was used for miRNA quantitative detection.

[0051] Prepare 10 μl PCR reaction system according to the following composition:

[0052] Table 5: miRNA Real-Time PCR Reaction Solution Formula

[0053] 2×Hi SYBR Green qPCR Mix 5μl 1×miRNA Primer R (10μM) 0.4μl 1×miRNA Primer F (10μM) 0.4μl cDNA template 1–2.5 μg ddH2O Up to 10μl

[0054] Real-Time PCR reaction is usually carried out in two steps, the procedure is as follows:

[0055] Table 6: miRNA Real-Time PCR Reaction Schedule

[0056]

[0057] Get the test results. Figure 1 To detect the expression of miRNA-5134-5p in cells. We found that after transfection with miRNA-5134-5p-l analog, the expression of miRNA-5134-5p in cells increased significantly (P<0.05). In cells transfected with miR-5134-5p-inhibitor, the expression of miRNA-5134-5p decreased significantly. Data are expressed as mean±sd and were measured three times. The statistical significance levels are marked as follows: **p<0.01, *p<0.05 compared with the NC group.

[0058] Cell invasion ability detection experiment:

[0059] Pre-infiltrate the 24-well plate and Transwell chamber with PBS for 5 minutes to ensure that they are in a wet state. Recover the cells digested with trypsin by centrifugation and resuspend them to 3×10^5 cells / mL with low serum culture medium (about 2% serum) for use. Add about 5×10^4 cells to the chamber, and be careful not to generate bubbles when adding the cell suspension. Add high serum culture medium (about 20% serum) to the bottom layer, with three replicates in each group, and culture for 36 hours. Use a cotton swab to absorb the upper culture medium and cells, and wash three times with 1×PBS; then add an appropriate amount of anhydrous formaldehyde to each well and fix at room temperature for 15 minutes. Then wash three times with 1×PBS, add an appropriate amount of 2% crystal violet stain to each well, and leave for 15 minutes; after the time is up, wash again until colorless and air-dry. Place the chamber under a microscope to observe the results of membrane penetration.

[0060] like Figure 2 As shown, the cell invasion experiment showed that compared with the negative control group, miRNA-5134-5p could increase the invasion ability of breast cancer cells, while under the treatment of inhibitors, the number of invasive cells was significantly reduced.

[0061] Cell proliferation ability detection experiment:

[0062] Treat cells to a concentration of 1.5×10^4cells / ml, inoculate in a 96-well plate (100μl / well), set up 3-5 replicates for each group of cells, and culture under normal conditions. Before each measurement, ensure that 1% CCK-8 reaction solution is added to each well, continue to culture in constant temperature culture for 1-4 hours, and read at 450nm wavelength with an enzyme reader at intervals of 12 hours to observe cell viability. Finally, generate a report chart using GraphPad Prism 5 software.

[0063] like Figure 3 The 4T1 cell CCK8 experiment showed that compared with the negative control group, miRNA-5134-5p could increase the proliferation ability of breast cancer cells, while under the treatment of inhibitors, the proliferation ability of cells decreased.

[0064] Cell migration ability detection experiment:

[0065] Treat the cells to be tested with trypsin, read the cell number and adjust the appropriate medium dilution and density using a cell counter; inoculate the prepared cell suspension into a 6-well plate with a density of 1×10 per well. 5 cells and incubate at 37°C with 5% CO2; when the cell fusion rate reaches 90%, use a sterile pipette tip to make scratches. Be sure to keep the pipette tip vertical during the scratching operation and try to apply force evenly; after washing the culture plate with 1×PBS, add DMEM culture medium with 2% FBS, observe and record the cell status at 0 hours under a microscope; after culturing for about 18-28 hours, rinse with 1×PBS, replace with new culture medium, and use a microscope to photograph and record the healing status.

[0066] like Figure 4 The 4T1 cell migration experiment showed that compared with the negative control group, miRNA-5134-5p could increase the migration ability of breast cancer cells, while the number of migrating cells was significantly reduced under the treatment of inhibitors.

[0067] Cell monoclonal ability detection experiment:

[0068] Take out the logarithmic phase cells, digest with trypsin and centrifuge, add DMEM culture medium containing only 10% serum, and count the cells. Add 500-1000 cells per well to the medium dish, and culture at a constant temperature for 10-14 days, changing the medium every 3 days. When the clones are visible, wash with PBS and fix with 4% glutaraldehyde for 20 minutes. Remove the fixative, wash twice with PBS, and then add crystal violet stain for 15 minutes. Aspirate the stain, wash the residue, observe under a microscope and record the number of clones.

[0069] like Figure 5The 4T1 cell migration experiment showed that compared with the negative control group, miRNA-5134-5p could increase the cloning ability of breast cancer cells, while the number of cell clones was significantly reduced under the treatment of inhibitors.

[0070] Example 2

[0071] In this example, breast cancer cells 4T1 were used as an experimental model, and the miRNA-5134-5p analogs and miRNA-5134-5p inhibitors of the present invention were transfected into breast cancer cells to up-regulate or down-regulate the level of miRNA-5134-5p in the cells. The qRT-RCP experiment was used to determine the effect of miRNA-5134-5p on the transcriptional levels of genes related to the EMT and apoptosis pathways of breast cancer cells.

[0072] Step 1. Extraction of miRNA:

[0073] Safely remove the cell sample from the culture environment and carefully remove the old culture medium. To avoid contamination and ensure the purity of the cells, gently wash the cells with PBS buffer. Subsequently, add an appropriate amount of RNA lysis buffer to the cells to ensure that the cells can be fully lysed to release RNA. Collect the lysed mixture into a centrifuge tube, label it properly, and then store it in an ultra-low temperature environment of -80°C to ensure the stability and integrity of the RNA.

[0074] Take out the pre-frozen cell lysate and wait for it to thaw. Next, add RNAExtraction Agent to the lysate and mix it thoroughly by shaking until there is no visible precipitate. At room temperature, place the mixture on a vortexer for a short vortex to further promote the separation of RNA from impurities. Subsequently, RNA will be enriched in the upper aqueous phase by centrifugation.

[0075] Transfer the separated upper liquid into a new EP tube, add an appropriate volume of ice-cold isopropanol, invert it upside down several times to mix it evenly, and let it sit quietly for 15 minutes to allow the RNA to fully precipitate. Centrifuge again to separate the RNA precipitate from the supernatant. After discarding the supernatant, wash the RNA precipitate with 75% ethanol to remove residual impurities and salt. After centrifugation, place the centrifuge tube in a ventilated place to dry, and dry it at room temperature for about 5-10 minutes. Be careful not to dry it for too long, otherwise the RNA will be difficult to dissolve. Finally, add an appropriate amount of enzyme-free water to dissolve the RNA precipitate, and use a concentration meter to accurately measure the concentration of RNA. Store the RNA sample again in an ultra-low temperature environment of -80°C for subsequent experiments.

[0076] Step 2. RNA reverse transcription

[0077] Thaw the template RNA and reagents on ice. Before use, flick or vortex each solution to mix well. Centrifuge briefly to collect the liquid remaining on the tube wall to the bottom of the tube.

[0078] Prepare the following reaction system on ice in an RNase free tube:

[0079] Table 6: RNA reverse transcription reaction solution formula

[0080]

[0081] Use a pipette to gently mix, put it into the PCR instrument and run the following program

[0082] Table 7: RNA reverse transcription reaction schedule

[0083]

[0084] Usually, a fast program can be selected for reverse transcription reaction; if the template has a complex secondary structure or a high GC region, use the standard program. The obtained cDNA product can be used for qPCR reaction immediately, or stored at -20℃ and used within half a year; for long-term storage, it is recommended to store at -80℃ after aliquoting. Repeated freezing and thawing of cDNA should be avoided.

[0085] Step 3. Fluorescence quantitative PCR detection:

[0086] First, go to the NCBI website and search for the CDS sequence of the gene to be measured based on the gene name or ID. Enter this sequence into the Primer-BLAST module and select the appropriate species so that the system can automatically design primers. Select the primer that is far from the 5' end and send the selected primer to a biological company for synthesis.

[0087] Prepare the qPCR reaction solution according to the table below, accurately add to the 96-well plate, seal it, and place it in the qPCR instrument. Set the program according to Table 9 and ensure accurate spotting on ice. Use Piko Real Software to analyze the data and GraphPad Prism 5 to display the qRT-PCR results. The results are shown in the figure. Figure 6As shown. After overexpression of miRNA-5134-5p, the expression of EMT-promoting genes (N-cadherin, Zeb2) in cells increased, and the expression of EMT-inhibiting genes (E-cadherin) in cells decreased, which promoted the EMT process. At the same time, the expression of anti-apoptotic protein Bcl2 increased, inhibiting cell apoptosis. Knocking down miRNA-5134-5p achieved the opposite result, inhibiting the EMT process of cancer cells and promoting cell apoptosis. The data are expressed as mean±sd and were measured three times. The statistical significance levels are marked as follows: **p<0.01, *p<0.05 compared with the NC group.

[0088] Table 8: qPCR reaction system table

[0089] Component Volume 2X SGExcel FastSYBR Mixture 5μL Forward Primer, 2.5 μM 0.5μL Reverse Primer, 10 μM 0.5μL Template DNA 1μL Nuclease-Free Water 3μL

[0090] Table 9: qPCR reaction procedure

[0091]

[0092] Example 3

[0093] This embodiment uses the miR-5134-5p in the present invention, and takes breast cancer cell 4T1 as the experimental model. According to the instructions of the transfection reagent, 20nM miR-5134-5p inhibitor and mimics are transferred into the cells, and WB (Western-blot) experiments are performed. The experimental steps are as follows: SDS-PAGE protein lysate is added to each group of cells, lysed on ice for 10 minutes, and then bathed in 100°C water for 10 minutes. Take 30μl of protein sample, separate the protein by 10% SDS-PAGE gel electrophoresis, and transfer to a PVDF membrane; then use TBST to prepare 5% skim milk powder to block at room temperature for 1h, incubate with primary antibody, and shake at 4°C overnight. Wash three times with TBST, each time for 10 minutes, incubate with secondary antibody according to the type of primary antibody, and shake at room temperature for 1h. Use ECL to develop, use Image J software to calculate the grayscale value of the band, and analyze the relative expression of the protein. Observe the effect of miRNA-5134-5p on the EMT and apoptosis pathways of breast cancer cells, such as Figure 7As shown. After overexpression of miRNA-5134-5p, the expression of E-cadherin protein, an inhibitor of EMT in cells, decreased, promoting the EMT process, while the expression of Bcl2 protein increased, inhibiting cell apoptosis. After transfection of miRNA-5134-5p inhibitor, the opposite result was achieved. The expression of E-cadherin protein, an inhibitor of EMT in cells, increased significantly, inhibiting the EMT process, while the expression of Bcl2 protein decreased, and the anti-apoptosis ability decreased. Data are expressed as mean±sd and were measured three times. The statistical significance levels are marked as follows: **p<0.01, *p<0.05 compared with the NC group.

[0094] In the present invention, breast cancer cells are used as experimental subjects to prove that overexpression of miRNA-5134-5p promotes tumor invasion and migration. In contrast, miRNA-5134-5p inhibitors can inhibit malignant phenotypes such as tumor invasion and migration. Therefore, inhibiting the biological activity of miRNA-5134-5p can be used as an adjuvant treatment for breast cancer. At the same time, the present invention also provides a method for using standard primers of miRNA-5134-5p to detect the expression level of miR-5134-5p in tumor samples and breast cancer cells by quantitative PCR, which is simple to operate and has accurate results.

[0095] The above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is impossible to list all the embodiments here. Any obvious changes or modifications derived from the technical solution of the present invention are still within the scope of protection of the present invention.

Claims

1. Application of miRNA-5134-5p inhibitors in the preparation of anti-breast cancer drugs.

2. The use according to claim 1, characterized in that: The breast cancer is triple-negative breast cancer.

3. The use according to claim 1, characterized in that: The nucleotide sequence of the miRNA-5134-5p is shown in SEQ ID No.1; the nucleotide sequence of the miRNA-5134-5p inhibitor is shown in SEQ ID No.

2.

4. Use of a biologically active fragment containing a miRNA-5134-5p inhibitor in the preparation of an anti-breast cancer drug, characterized in that: The biologically active fragments include but are not limited to recombinant plasmid vectors or recombinant viral vectors containing the nucleotide sequence of the miRNA-5134-5p inhibitor.

5. A set of probes for detecting the expression level of miRNA-5134-5p, characterized in that: The nucleic acid has the nucleotide base sequences shown in SEQ ID No. 3 and 4.

6. A small molecule drug for breast cancer, characterized in that: The small molecule drug comprises a biologically active fragment containing a miRNA-5134-5p inhibitor as described in claim 4.

7. The small molecule drug for anti-breast cancer according to claim 6, characterized in that: It also includes medically acceptable carriers and / or excipients; preferably, the carriers and / or excipients are one or more of chitosan, cholesterol, liposomes, cyclodextrin and microcapsules.

8. The small molecule drug according to claim 6, characterized in that: The dosage form of the small molecule drug is an oral agent or an injection; the injection includes but is not limited to an intravenous injection, an intramuscular injection or an intratumoral injection.

9. A kit for evaluating the malignancy of breast cancer, characterized in that: The kit comprises primers for specifically detecting the expression level of miRNA-5134-5p, and the primers comprise upstream primers and downstream primers.

10. A kit for evaluating the malignancy of breast cancer according to claim 9, characterized in that: The sequence of the upstream primer is shown in SEQ ID No.3, and the sequence of the downstream primer is shown in SEQ ID No.4.

Images