Nucleic acid nanotube delivery material as well as preparation method and application thereof

Abstract

The invention relates to a nucleic acid nanotube delivery material as well as a preparation method and application thereof, and belongs to the field of nucleic acid nano materials. According to the material, four single-stranded DNA molecules Y1, Y2, Y3 and Y4 with specific nucleotide sequences are self-assembled in agmatine sulfate aqueous solution to form a nanotube structure, and microRNA is carried. The molar ratio of Y1 to Y4 to microRNA is 1: 3: 3: 3: 3. The nucleic acid nanotube delivery material prepared by utilizing a agmatine sulfate system and a constant-temperature and gradient annealing process has good stability and biocompatibility. The preparation method comprises the following steps: preparing a DNA single-stranded aqueous solution, carrying out constant-temperature or gradient annealing self-assembly to form the nucleic acid nanotube, and then adding a microRNA solution. The pH value and the concentration of the agmatine sulfate aqueous solution can optimize self-assembly. The material has application potential in pharmaceutical preparations, and provides a new way for nucleic acid drug development and lung inflammation treatment.

Description

Technical Field

[0001] The present invention belongs to the field of nucleic acid nanomaterials, and relates to nucleic acid nanotube delivery materials and preparation methods and applications thereof. Background Art

[0002] The development of universal drug carriers is the most important research topic in nanomedicine. In the past, a variety of drug delivery carriers have been developed, such as cyclodextrin materials, cationic liposomes, viral capsids, polymer materials, etc., which have immunogenicity and some potential toxicity, and therefore cannot be well put into medical practice. In the face of the above problems, the emerging DNA nanotechnology has recently provided a good solution. DNA is a natural component in the human body. Short-chain DNA has no immunogenicity and potential toxicity, and is easily biodegradable. At the same time, according to the principle of complementary base pairing, DNA nanomaterials can achieve good programmability, can design specific nucleic acid aptamers to achieve targeted treatment, and can also carry interfering RNA. Therefore, self-assembled DNA nanomaterials have great potential in the field of gene therapy for diseases.

[0003] With the development of technology, the use of DNA nanomaterials for gene therapy of diseases faces some new challenges. The traditional method is the synthesis of DNA nanomaterials mediated by magnesium ions. The synthesis often requires a very complex annealing process, and the system for maintaining the stability of nanomaterials is very different from physiological conditions. At the same time, since the traditional synthesis system requires a high concentration of salt solution system, excessive magnesium ion concentration will reduce the activity of the enzyme or even make the enzyme inactive. DNA nanomaterials themselves have high negative charge, and the efficiency of cell uptake of materials is often not ideal, which limits the application of self-assembled nucleic acid nanomaterials to a certain extent. Therefore, the above problems need to be solved urgently.

[0004] The invention patent CN104546726A discloses a self-assembled nucleic acid nanotube preparation, preparation method and application. The nucleic acid nanotube makes siRNA double-helical and self-assembles into the nanotube system, making siRNA not easily degraded by nucleases, forming a composite nanotube structure, and taking advantage of the nanoparticles being easily taken up by cells. However, the stability of the nanotubes prepared by the invention under different physiological conditions is insufficient, and the cell transfection efficiency is insufficient.

[0005] MicroRNAs are a class of small single-stranded RNAs that negatively regulate gene expression, providing a potential strategy for regulating multiple signaling pathways. They have been successfully applied as therapeutic targets in the fields of nanomedicine and drug delivery. Studies have reported that microRNA-126b is highly correlated with HMGB1 expression. Zhu et al. revealed that overexpression of microRNA-126b can directly target and inhibit HMGB1 and its downstream pathways, such as tumor necrosis factor-α (TNF-α) and reactive oxygen species (ROS) in endothelial cells under inflammatory conditions. Xu et al. showed that microRNA-126b was downregulated in the plasma of patients with acute lung injury (ALI) caused by sepsis, further highlighting its role as an inflammatory regulator of lung injury. However, microRNA drug delivery faces difficulties in poor stability, low cellular uptake efficiency, and selection of delivery vectors. Viral vectors are highly efficient but have limited safety, while non-viral vectors are safe but have low delivery efficiency. In the process of clinical transformation, the production process is complex and the experimental cycle is long, which requires further research and development optimization. Summary of the invention

[0006] Polyamines have been extensively studied as in vitro condensing agents for DNA. Protonated polyamines neutralize the negative charge of nucleic acids. Under physiological conditions, polyamines in organisms such as agmatine, spermidine, and spermine are linear, protonated, high-valent ionic compounds, and can interact with negatively charged DNA or RNA through electrostatic interactions. Endogenous polyamines are natural DNA condensing agents. Therefore, polyamines can be used as a natural cationic compound to replace magnesium ions to neutralize the negative charge between DNA, thereby mediating the self-assembly of DNA nanomaterials. Agmatine is an endogenous polyamine. Agmatine sulfate is easily soluble in water, carries a positive charge in water, and is not cytotoxic at low doses.

[0007] The present invention uses agmatine sulfate and two different ways of controlling time and temperature (including gradient annealing and constant temperature self-assembly) to mediate the self-assembly of nucleic acid nanomaterials. The present invention also designs a new type of DNA nanotube, applies the preparation method of the present invention, and places the functional gene on the nanotube structure by base complementary pairing at a specific molar ratio to form a new type of nanocomposite preparation.

[0008] In view of this, the purpose of the present invention is to provide a method for agmatine sulfate-mediated self-assembly of nucleic acid nanomaterials and nanotubes carrying microRNA prepared by the method and applications. The method can achieve self-assembly under constant temperature and gradient annealing, and the cell uptake efficiency thereof is significantly improved. The prepared nucleic acid nanomaterial can exist more stably under physiological conditions than traditional ones, and can exist stably in serum for a longer period of time. At the same time, the preparation can effectively inhibit inflammatory response.

[0009] The nanotube carrying microRNA prepared by the method of agmatine sulfate-mediated nucleic acid nanomaterial self-assembly is composed of two hollow three-arm nanotube structures spliced ​​together to form a complete DNA nanotube structure. The three arm vertices of the three-arm nanotube are three functional sites that can carry microRNA. This DNA nanotube structure can deliver DNA nanoparticles containing six microRNAs, and agmatine sulfate is used instead of magnesium ions to mediate the self-assembly of nucleic acid nanomaterials.

[0010] In order to achieve the above object, the present invention provides the following technical solutions:

[0011] The present invention provides a nucleic acid nanotube delivery material, which is self-assembled by four DNA single strands: Y1, Y2, Y3, and Y4, and also includes a delivered compound microRNA, and the four DNA single strands and the microRNA are self-assembled in an agmatine sulfate aqueous solution to form the nucleic acid nanotube delivery material;

[0012] The molar ratio of Y1, Y2, Y3, Y4, and microRNA is 1:3:3:3:3;

[0013] The nucleotide sequences of Y1, Y2, Y3, Y4 and microRNA are SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:1 respectively;

[0014] Further, the preparation method of the nucleic acid nanotube delivery material comprises the following steps:

[0015] S1: preparing aqueous solutions of Y1, Y2, Y3 and Y4;

[0016] S2: Y1, Y2, Y3, and Y4 aqueous solutions are taken in an agmatine sulfate aqueous solution in a molar concentration ratio of 1:3:3:3, and the nucleic acid nanotubes are synthesized under a gradient annealing or / and constant temperature annealing program to obtain a nucleic acid nanotube solution.

[0017] S3: Add the microRNA solution to the nucleic acid nanotube solution in step S2, and leave it for another 30 minutes to obtain the nucleic acid nanotube delivery material solution.

[0018] Preferably, in step S2, the gradient annealing is performed at 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and then 22°C for 30 min.

[0019] Preferably, in step S2, the constant temperature annealing program is 37°C or 45°C, and the mixture is placed at the constant temperature for 30 to 90 minutes, the DNA solution is mixed, and then placed at the same constant temperature for 30 to 90 minutes;

[0020] In the step S2, the pH value of the agmatine sulfate aqueous solution is 5.0-10.0;

[0021] The concentration of the agmatine sulfate aqueous solution is 10mM-500mM;

[0022] Further, the use of nucleic acid nanotube delivery materials in the preparation of pharmaceutical preparations,

[0023] Application of the nucleic acid nanotube delivery material in preparing a drug for treating lung inflammation.

[0024] The beneficial effects of the present invention are:

[0025] Agmatine sulfate-mediated self-assembly of nanomaterials has the following advantages: 1) It can mediate the self-assembly of nucleic acid nanomaterials at a constant temperature, making the synthesis method simpler. 2) It can be taken up by cells without the assistance of transfection agents. 3) Agmatine sulfate-mediated self-assembled nucleic acid nanomaterials can stably exist in a system under physiological conditions, greatly increasing the possibility of their clinical application. 4) Agmatine sulfate-mediated self-assembled nucleic acid nanomaterials can stably exist in serum for a longer period of time, thereby ensuring that they are not degraded before reaching the target cells, so that they can perform their functions more safely and effectively.

[0026] This new type of nanomaterial not only retains the programmability and good biocompatibility of traditional nucleic acid nanomaterials, but also has higher serum stability under physiological conditions and can be taken up by cells more, thereby releasing more microRNA in the cross-linking system to better exert its biological effects. Based on the multiple advantages of agmatine sulfate-mediated nucleic acid self-assembly nanocarriers, it has great potential in genetic research and treatment.

[0027] Other advantages, objectives and features of the present invention will be described in the following description to some extent, and to some extent, will be obvious to those skilled in the art based on the following examination and study, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0029] Figure 1 Schematic diagram of agmatine sulfate-mediated self-assembly of nanotubular nucleic acid nanoformulations and their application in the treatment of lung inflammation;

[0030] Figure 2 Dynamic light scattering characterization of agmatine sulfate-mediated self-assembly of nanotubular nucleic acid nanomaterials;

[0031] Figure 3 PAGE image of the self-assembly of nanotubular nucleic acid nanomaterials mediated by agmatine sulfate gradient annealing;

[0032] Figure 4 PAGE images of the self-assembly of nanotubular nucleic acid nanomaterials mediated by gradient annealing of agmatine sulfate at different concentrations;

[0033] Figure 5 PAGE images of the self-assembly of nanotubular nucleic acid nanomaterials mediated by agmatine sulfate at different temperatures;

[0034] Figure 6 PAGE images of agmatine sulfate-mediated self-assembly of nanotubular nucleic acid nanomaterials at different pH values;

[0035] Figure 7 PAGE image of serum stability of agmatine sulfate-mediated nanotubular nucleic acid nanoformulation;

[0036] Fig. 8A Laser confocal microscopy was used to observe the cellular uptake of nanotubular nucleic acid nanoformulations mediated by agmatine sulfate and magnesium ions;

[0037] Figure 8B Flow cytometric analysis of agmatine sulfate-mediated and magnesium ion-mediated cellular uptake of nanotubular nucleic acid nanoformulations;

[0038] Fig. 9 Agmatine sulfate-mediated nanotubular nucleic acid nanoformulations for the expression level and quantitative analysis of microRNA-126b in RAW264.7 cells;

[0039] Fig. 10A , Fig. 10B To detect the inhibition of the expression level of inflammatory factors in RAW264.7 cells by agmatine sulfate-mediated nanotubular nucleic acid nanoformulation;

[0040] Fig.11 The temporal distribution of agmatine sulfate-mediated nanotubular nucleic acid nanoformulations in lung tissue;

[0041] Fig.12 H&E and immunohistochemistry images of agmatine sulfate-mediated nanotubular nucleic acid nanoformulations to alleviate lung tissue damage and inflammation. DETAILED DESCRIPTION

[0042] The following describes the embodiments of the present invention by specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments only illustrate the basic concept of the present invention in a schematic manner, and the following embodiments and features in the embodiments can be combined with each other without conflict.

[0043] Among them, the drawings are only used for illustrative explanations, and they only represent schematic diagrams rather than actual pictures, and should not be understood as limitations on the present invention. In order to better illustrate the embodiments of the present invention, some parts of the drawings may be omitted, enlarged or reduced, and do not represent the size of actual products. For those skilled in the art, it is understandable that some well-known structures and their descriptions in the drawings may be omitted.

[0044] The same or similar numbers in the drawings of the embodiments of the present invention correspond to the same or similar parts; in the description of the present invention, it should be understood that if the terms "upper", "lower", "left", "right", "front", "rear", etc. indicate the orientation or position relationship, they are based on the orientation or position relationship shown in the drawings, which is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operate in a specific orientation. Therefore, the terms describing the position relationship in the drawings are only used for illustrative purposes and cannot be understood as limiting the present invention. For ordinary technicians in this field, the specific meanings of the above terms can be understood according to specific circumstances.

[0045] 1. Materials

[0046] RAW264.7 cells were purchased from the American Type Culture Institute;

[0047] Fetal bovine serum and phosphate-buffered saline (PBS) were purchased from Hyclone, USA;

[0048] Y1, Y2, Y3, Y4, and microRNA-126b sequences were synthesized by Shanghai Sangon Biotechnology Co., Ltd.;

[0049] Hoechst 33432 was purchased from Shanghai Shenggong Biological Co., Ltd.;

[0050] DMEM medium was a product of Gibco;

[0051] NaOH, NaCl, KCl, Tris base, acetic acid, EDTA, magnesium acetate, HCl, and phenol were purchased from Shanghai Times Biotechnology Co., Ltd.;

[0052] Primers for microRNA-126b, IL-6, IL-1β, U6, β-actin, and GAPDH were synthesized by Shanghai Bioengineering Co., Ltd.;

[0053] The miRNA first-strand cDNA synthesis (tailing method) kit was a product of Shanghai Bio-Industry Co., Ltd.;

[0054] The RT-PCR kit was provided by Thermo Company, USA;

[0055] LPS was purchased from Sigma, USA.

[0056] 2. Embodiment

[0057] Example 1: Agmatine sulfate mediated self-assembly of DNA nanotubes carrying microRNA-126b nanoformulations via gradient annealing

[0058] A certain mass of agmatine sulfate was weighed and dissolved in deionized water to a final concentration of 100 mM. The dry powder samples of microRNA-126b (SEQ ID NO: 1), Y1 (SEQ ID NO: 2), Y2 (SEQ ID NO: 3), Y3 (SEQ ID NO: 4) and Y4 (SEQ ID NO: 5) were diluted with sterile enzyme-free deionized water, and then the concentration of each tube was measured using Nanndrop. The amount required for the corresponding proportion was calculated according to the concentration. Y1, Y2, Y3, and Y4 were added to a sterile enzyme-free centrifuge tube in a molar ratio of 1:3:3:3, and a certain amount of agmatine sulfate aqueous solution was added to make the concentration of agmatine sulfate in the system 10 mM, and the rest was supplemented with water to finally prepare a 30 μL system. The nanotube structure was self-assembled and synthesized under the following conditions: 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and then 22°C for 30 min. Then add a determined dose of microRNA-126b into the system and place it at 37°C for 30 minutes. A nanoparticle solution with a molar ratio of Y1, Y2, Y3, Y4, and microRNA-126b of 1:3:3:3 is obtained. It is referred to as DNA nanotube preparation. The data analysis diagram of the dynamic light scattering particle size measurement of the DNA nanotube preparation structure is shown in Figure 2 A small amount of synthesized sample was electrophoresed in 6% non-denaturing PAGE gel and the image was scanned by a scanner. The electrophoresis image of the DNA nanotube preparation is shown in Figure 3 , with higher purity.

[0059] microRNA-126b

[0060] AUUAUUACUCACGGUACGAGUU(SEQ ID NO:1)

[0061] Y1

[0062] GTAGGTTTTTTCTTGCCAGGCACCATCGTAGGTTTTTTTCTTGCCAGGCA

[0063] CCATCGTAGGTTTTTTCTTGCCAGGCACCATC(SEQ ID NO:2)

[0064] Y2

[0065] AACTCGTACCGTGAGTAATAATGCAAGCCTACGATGGACACGGTAACG

[0066] AC (SEQ ID NO:3)

[0067] Y3

[0068] ACCGTGTGGTTGCTAGTCGTT(SEQ ID NO:4)

[0069] Y4

[0070] TAGCAACCTGCCTG (SEQ ID NO: 5)

[0071] Example 2: Agmatine sulfate at different concentrations mediates self-assembly of DNA nanotubes

[0072] A certain amount of agmatine sulfate was weighed and dissolved in deionized water to make the concentration of the mother solution 1 M, and then diluted with deionized water to 100 mM, 10 mM, 1 mM and 100 μM respectively. The dry powder samples of each sequence of Y1 (SEQ ID NO: 2), Y2 (SEQ ID NO: 3), Y3 (SEQ ID NO: 4) and Y4 (SEQ ID NO: 5) were diluted with sterile enzyme-free deionized water, and then the concentration of each tube was measured using Nanndrop. The amount required for the corresponding proportion was calculated according to the concentration, and Y1, Y2, Y3, and Y4 were added to a sterile enzyme-free centrifuge tube in a molar ratio of 1:3:3:3, and a certain amount of agmatine sulfate aqueous solution was added so that the concentration of agmatine sulfate in the system was 50 μM, 500 μM, 1 mM, 10 mM, 100 mM, 300 mM and 500 mM, and the rest was added with deionized water to prepare a 30 μL system, and 7 groups of agmatine sulfate-mediated nanotube structures with different concentrations were prepared for self-assembly synthesis under the following conditions: 95° C. for 5 min, 65° C. for 30 min, 50° C. for 30 min, 37° C. for 30 min, and then 22° C. for 30 min. The synthesized small amount of sample was stained on a 6% non-denaturing PAGE gel [acrylamide / methylenebisacrylamide (19:1) solution (40%): 3.6 mL, 10×TAE-Mg 2+ : 2.4mL, 10% ammonium persulfate (APS): 400uL, TEMED: 40μL, water: 18.2mL], and the image was scanned by a scanner. The image of DNA nanotube electrophoresis is shown in Figure 4 , with higher purity at agmatine sulfate concentration of 10 mM and above.

[0073] Example 3: Self-assembly of DNA nanotubes mediated by agmatine sulfate at different temperatures

[0074] The dry powder samples of each sequence of Y1 (SEQ ID NO: 2), Y2 (SEQ ID NO: 3), Y3 (SEQ ID NO: 4) and Y4 (SEQ ID NO: 5) were diluted with sterile enzyme-free deionized water, and then the concentration of each tube was measured using Nanndrop. The amount required for the corresponding proportion was calculated according to the concentration. Y1, Y2, Y3, and Y4 were added to a sterile enzyme-free centrifuge tube in a molar ratio of 1:3:3:3, and a certain amount of agmatine sulfate aqueous solution was added so that the concentration of agmatine sulfate in the system was 10 mM. The rest was added with deionized water to prepare a 30 μL system, and five groups of nanotube structures were prepared. They were placed at 4° C. for 60 min, 22° C. for 60 min, 37° C. for 60 min, and 45° C. for 60 min, and the gradient annealing in Example 1 was performed. Then a small amount of the five groups of synthesized samples was electrophoresed in a 6% non-denaturing PAGE gel, and the pictures were scanned by a scanner. The electrophoresis pictures of DNA nanotubes are shown in FIG. Figure 5 , self-assembled at a constant temperature of 37℃ and 45℃ with high purity.

[0075] Example 4: Agmatine sulfate at different pH values ​​mediates self-assembly of DNA nanotubes

[0076] A certain amount of agmatine sulfate was weighed and dissolved in deionized water to a final concentration of 100 mM. The pH was adjusted using a pH meter and a prepared 100 μM NaOH aqueous solution to 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0, respectively. The dry powder samples of each sequence of Y1 (SEQ ID NO: 2), Y2 (SEQ ID NO: 3), Y3 (SEQ ID NO: 4) and Y4 (SEQ ID NO: 5) were diluted with sterile enzyme-free deionized water, and then the concentration of each tube was measured using Nanndrop. The amount required for the corresponding proportion was calculated according to the concentration, and Y1, Y2, Y3, and Y4 were added to a sterile enzyme-free centrifuge tube in a molar ratio of 1:3:3:3, and a certain amount of agmatine sulfate aqueous solution was added so that the concentration of agmatine sulfate in the system was 10 mM, and the rest was added with deionized water to prepare a 30 μL system, and six groups of agmatine sulfate aqueous solutions with different pH values ​​were prepared for self-assembly synthesis of nanotube structures under the following conditions: 95° C. for 5 min, 65° C. for 30 min, 50° C. for 30 min, 37° C. for 30 min, and then 22° C. for 30 min. Then, a small amount of the six groups of samples were taken for electrophoresis in 6% non-denaturing PAGE gel, and the images were scanned by a scanner. The electrophoresis images of DNA nanotubes are shown in Figure 6 At the above six pH values, agmatine sulfate-mediated DNA nanotube synthesis has high purity.

[0077] Example 5: Stability of Agmatine Sulfate-Mediated DNA Nanotube Self-Assembly at 37°C and in Serum

[0078] According to the method in Example 1, a certain amount of agmatine sulfate-mediated DNA nanotube preparation and a corresponding amount of TAE-Mg 2+ The mediated DNA nanotube preparation was mixed according to the volume ratio of 1:9 of nanotube preparation: 10% FBS (fetal bovine serum), and placed in an incubator at 37°C. The experimental groups were set to have time of 0h, 3h, 6h, 12h and 24h. After the time was up, the samples were collected and electrophoresed in 6% non-denaturing PAGE gel. The images were scanned by a scanner. Figure 7 Agmatine sulfate-mediated DNA nanotube preparations can be stable in serum for 24 h, while TAE-Mg 2+ The mediated DNA nanomaterials are basically decomposed in serum within 12 hours.

[0079] Example 6: Cellular response to agmatine sulfate-mediated self-assembly of DNA nanotubes and TAE-Mg 2+ Comparison of mediated nucleic acid nanomaterial uptake

[0080] RAW264.7 cells were seeded in a 24-well plate (with a built-in cover glass) and cultured in a 37°C, 5% CO2 incubator for 24 hours. When the cell density reached 50% to 60%, they were used for the uptake of nucleic acid nanomaterials. The experimental groups were: agmatine sulfate-mediated DNA nanotubes (150 nM), TAE-Mg 2+ Mediated DNA nanotubes (150nM) and blank control groups. Mix according to the material: culture medium volume ratio of 1:9, add the nano-preparation and place in a 37°C, 5% CO2 incubator for 24h. After that, add 5uL of Hoechst dye to each well and incubate in a 37°C, 5% CO2 incubator for 40min, then take it out, discard the 24-well plate culture medium, gently rinse with 37°C PBS for 3min×3 times; add 1mL of 4% paraformaldehyde along the wall of the culture plate and fix at room temperature for 5min; rinse with PBS for 5min×3 times, discard the PBS liquid; remove the coverslip, use anti-fade mounting medium (about 10μL) to seal the slide, and store it in the dark; take pictures under a laser confocal microscope.

[0081] As can be seen from the laser confocal microscopy image 8 (A), at the same time and concentration, the Cy5-Y3 carried by DNA nanotubes showed red fluorescence distribution in the cells, indicating that the uptake of agmatine sulfate-mediated nanomaterial self-assembly was much higher than that of traditional TAE-Mg 2+ Agmatine sulfate-mediated DNA nanotube self-assembly significantly enhanced its uptake by RAW264.7 cells.

[0082] RAW264.7 cells were seeded in a 6-well plate and cultured in a 37°C, 5% CO2 incubator for 24 hours. When the cell density reached 50% to 60%, they were used for the uptake of nucleic acid nanomaterials. The experimental groups were: agmatine sulfate-mediated nanomaterials (50 nM), TAE-Mg 2+ Mediated DNA nanotubes (50nM) and blank control group. Mix according to the material: culture medium volume ratio of 1:9, add the nano-preparation and culture in a 37°C, 5% CO2 incubator for 24h. Discard the 6-well plate culture medium and gently rinse with 37°C PBS for 3min×3 times; collect cells and perform flow sorting. The corresponding data were normalized and the statistical graph was obtained as shown in Figure 8 (B). It can be seen that the uptake of agmatine sulfate-mediated nanomaterial self-assembly is higher than that of traditional TAE-Mg 2+ Mediated.

[0083] Example 7: Effect of Agmatine Sulfate-Mediated Self-Assembled DNA Nanotubes on Cellular MicroRNA-126b Expression

[0084] One day before treatment, RAW264.7 cells were counted, cells were climbed, and inoculated in 6-well plates. The corresponding nanoparticle concentration was 50nM. The experimental groups were set as follows: blank control group (except for the blank control group, all other groups were added with LPS), LPS group, agmatine sulfate-mediated DNA nanotube group (without microRNA-126b), agmatine sulfate-mediated DNA nanotube group (carrying microRNA-126b) and the microRNA concentration was set to 5nM, 50nM, and 200nM. After the nanomaterials were added and co-incubated with the cells for 24h, they were treated with LPS for 6h and then rinsed with PBS twice; 500μL of TRIzol reagent (Invitrogen, USA) was added, and RNA was extracted according to the TRIzol reagent extraction instructions. The RNA concentration and purity were determined using a nucleic acid quantitative analyzer. The A260 / A280 ratios of all RNAs were between 1.8 and 2.0. Then, reverse transcription PCR (RT-PCR) reagent was used to detect the microRNA-126b in each group, and U6 was used as an internal reference. The primers were designed as follows:

[0085] microRNA-126b

[0086] GCCGATTATTACTCACGGTACGAGTT

[0087] RT reaction conditions: 37°C, 60 min, 85°C, 5 min, storage at 4°C, reaction volume was 20 μl; qPCR reaction conditions: 95°C, 10 min, cycle conditions were 95°C, 15 s, 60°C, 30 s, 72°C, 30 s, 40 cycles, extension at 72°C for 10 min, reaction volume was 10 μl.

[0088] The results showed that the expression of microRNA-126b in cells was downregulated after LPS treatment, and DNA nanotubes carrying 200 nM concentration of microRNA-126b could significantly upregulate the expression of microRNA-126b in cells (* represents p<0.05), indicating that DNA nanotubes can effectively deliver microRNA-126b into cells (see Fig. 9 ).

[0089] Example 8: Effects of Agmatine Sulfate-Mediated Self-Assembled Nanotubular Nucleic Acid Nanoformulations on Cellular Inflammation Levels

[0090] One day before treatment, RAW264.7 cells were counted, cells were plated, and inoculated in 6-well plates. The corresponding nanoformulation concentration was 50 nM. The experimental groups were set up as follows: blank control group (except for the blank control group, all other groups were added with LPS), LPS group, agmatine sulfate-mediated DNA nanotube group (without microRNA-126b), TAE-Mg 2+ Mediated DNA nanotube group (carrying microRNA-126b), agmatine sulfate mediated DNA nanotube group (carrying microRNA-126b). After adding nanomaterials and co-incubating with cells for 24 hours, they were treated with LPS for 6 hours and then rinsed with PBS twice; 500μL of TRIzol reagent (Invitrogen, USA) was added, and RNA was extracted according to the TRIzol reagent extraction instructions. The RNA concentration and purity were determined using a nucleic acid quantitative analyzer. The A260 / A280 ratios of all RNAs were between 1.8 and 2.0. Then, reverse transcription PCR (RT-PCR) reagents were used to detect the conditions of IL6 and IL-1β in each group, and GAPDH was used as an internal reference. The primers were designed as follows:

[0091] IL6

[0092] Forward:CTTCTTGGGACTGATGCTGGTGAC(SEQ ID NO:6)

[0093] Reverse:TCTGTTGGGAGTGGTATCCTCTGTG(SEQ ID NO:7)

[0094] IL-1β

[0095] Forward:CACTACAGGCTCCGAGATGAACAAC(SEQ ID NO:8)

[0096] Reverse:TGTCGTTGCTTGGTTCTCCTTGTAC(SEQ ID NO:9)

[0097] RT reaction conditions: 25°C, 5 min, 42°C, 60 min, 70°C, 15 min, stored at 4°C, reaction volume was 20 μl; qPCR reaction conditions: 95°C, 10 min, cycle conditions were 95°C, 15 s, 60°C, 30 s, 72°C, 30 s, 40 cycles, extension at 72°C for 10 min, reaction volume was 10 μL.

[0098] The results showed that the expression of inflammatory factors IL6 and IL-1β in cells increased after LPS treatment. Agmatine sulfate-mediated DNA nanotubes carrying microRNA-126b could significantly reduce the expression of IL6 and IL-1β in cells (* or # represents p < 0.05), indicating that agmatine sulfate-mediated DNA nanotubes carrying microRNA-126b have anti-inflammatory effects (see Fig. 10A , 10B ).

[0099] Example 9: Retention of Agmatine Sulfate-Mediated Self-Assembled Nanotubular Nucleic Acid Nanoformulations in the Lungs

[0100] After the mice were anesthetized, 50 μL of LPS (5 mg / kg) was injected into the trachea. Two hours later, Cy5.5-labeled agmatine sulfate-mediated DNA nanotubes were injected into the lungs through the trachea, and then the lung tissues of the mice were dissected at 1, 3, 6, 12, and 24 hours after administration. Lung imaging was detected using a multi-mode animal in vivo imaging system (see Fig.11 The imaging results showed that after agmatine sulfate-mediated self-assembled nanotubular nucleic acid nanoformulations entered the lungs, they were gradually metabolized over time, gradually stabilized after 6 hours, and could be maintained in the lungs for at least 24 hours.

[0101] Example 10: Agmatine sulfate-mediated self-assembly of nanotubular nucleic acid nanoformulations to alleviate lung injury and inflammation

[0102] The experimental groups were set as follows: blank control group (except for the blank control group, all other groups were added with LPS), LPS group, agmatine sulfate-mediated DNA nanotube group (without microRNA-126b), TAE-Mg 2+mediated DNA nanotube group (carrying microRNA-126b), agmatine sulfate-mediated DNA nanotube group (carrying microRNA-126b). After the mice were anesthetized, 50 μL of LPS (5 mg / kg) was injected into the trachea. Two hours later, the DNA nanotubes were injected into the lungs through the trachea according to the above groups, and then the lung tissues of the mice were dissected 24 hours after administration. The lung tissues were removed and stored in 4% paraformaldehyde for at least 24 hours. After dehydration and embedding, the tissues were cut into 5 μm slices and stained with H&E. The results showed that agmatine sulfate-mediated DNA nanotubes carrying microRNA-126b can reduce lung damage (see Fig.12 ).

[0103] For immunohistochemical staining, paraffin-embedded sections were first dewaxed, rehydrated, and antigen retrieval was performed in Tris-EDTA buffer (pH 9.0). Then, lung tissues were immunohistochemically stained with antibodies iNOS, SOD2, and IL-1β. Finally, sections were counterstained with hematoxylin and mounted with neutral resin. The results showed that agmatine sulfate-mediated DNA nanotubes carrying microRNA-126b can reduce the level of reactive oxygen species in the lungs and alleviate lung inflammation (see Fig.12 ).

[0104] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution, which should be included in the scope of the claims of the present invention.

Claims

1. A nucleic acid nanotube delivery material, characterized in that: The nucleic acid nanotube delivery material is self-assembled by four DNA single strands: Y1, Y2, Y3, and Y4, and also includes a delivered compound microRNA. The four DNA single strands and the microRNA are self-assembled in the presence of an agmatine sulfate aqueous solution to form the nucleic acid nanotube delivery material.

2. The nucleic acid nanotube delivery material according to claim 1, characterized in that: The molar ratio of Y1, Y2, Y3, Y4 and microRNA is 1:3:3:3:

3.

3. The nucleic acid nanotube delivery material according to claim 2, characterized in that: The nucleotide sequences of Y1, Y2, Y3, Y4 and microRNA are SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:1 respectively.

4. The method for preparing the nucleic acid nanotube delivery material according to any one of claims 1 to 3, characterized in that: The steps are as follows: S1: preparing aqueous solutions of Y1, Y2, Y3 and Y4; S2: taking aqueous solutions of Y1, Y2, Y3 and Y4 in a molar concentration ratio of 1:3:3:3 and subjecting them to gradient annealing or / and constant temperature annealing in an aqueous solution of agmatine sulfate to obtain a nucleic acid nanotube solution, S3: adding the microRNA solution to the nucleic acid nanotube solution in step S2, and placing it at a constant temperature of 37° C. for 30 minutes again to obtain the nucleic acid nanotube delivery material solution.

5. The preparation method according to claim 4, characterized in that: In step S2, the gradient annealing program is 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and then 22°C for 30 min.

6. The preparation method according to claim 4, characterized in that: In step S2, the constant temperature annealing program is 37° C. or 45° C., and the mixture is placed at the constant temperature for 30 to 90 minutes. The DNA solution is mixed and then placed at the same constant temperature for 30 to 90 minutes.

7. The preparation method according to claim 4, characterized in that: In the step S2, the pH value of the agmatine sulfate aqueous solution is 5.0-10.

0.

8. The preparation method according to claim 4, characterized in that: In the step S2, the concentration of the agmatine sulfate aqueous solution is 10 mM-500 mM.

9. Use of the nucleic acid nanotube delivery material according to any one of claims 1 to 3 in the preparation of a pharmaceutical preparation.

10. The use according to claim 9, characterized in that Application of the nucleic acid nanotube delivery material in preparing a drug for treating lung inflammation.

Images