Antibody for highly pathogenic porcine reproductive and respiratory syndrome virus, antibody composition and application

Abstract

According to the antibody or the antibody binding fragment of the highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 protein provided by the invention, the antibody has a relatively high relative affinity constant with PRRSV GP5 proteins of different pedigree and branches, can be bound with a target protein with high sensitivity and high specificity, and has relatively high stability; based on the antibody, the antibody can realize accurate, rapid and large-scale detection of the PRRSV GP5 protein content in serum or related products, and has a good application prospect in PRRSV GP5 content detection.

Description

Technical Field

[0001] The present invention relates to the technical field of immunological detection methods, and in particular to an antibody, an antibody composition and an application of a highly pathogenic porcine reproductive and respiratory syndrome virus. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS) is a contagious viral disease that can cause reproductive disorders in pregnant sows; respiratory symptoms in piglets, prolonged fattening time, waste of feed and increased costs, and higher mortality due to immunosuppression and other pathogenic infections; low fertilization rate and high estrus rate in breeding pigs, which seriously threatens the development of the global and domestic pig industry. Porcine reproductive and respiratory syndrome virus (PRRSV) is its pathogen. PRRSV is a single-stranded positive-strand RNA virus. Under an electron microscope, it can be observed that the virus particles are oval in shape with a diameter of 50-65nm. The internal nucleocapsid is icosahedral symmetrical and surrounded by a lipid bilayer membrane.

[0003] As a single-stranded RNA virus, PRRSV is prone to mutation, and there is a possibility of base mutation and deletion at any position in the PRRSV genome. The high variability of the PRRSV genome has led to the continuous emergence of new strains in the field. PRRSV has multiple genetic subtypes (lineages). In 1996, a PRRSV strain belonging to lineage 5 was isolated in China. In 2006, a highly pathogenic PRRSV (lineage 8) broke out in my country, and its non-structural protein 2 (NSP2) hypervariable region had a characteristic 30-amino acid discontinuous deletion. After 2013, a NADC30-like strain (lineage 1) appeared, and then lineage 1 strains have gradually become the PRRSV epidemic strains in my country. The commonly used detection method for PRRSV is PCR, which has the characteristics of simple operation, no special equipment requirements, low cost, and little subjective influence, and can automatically analyze the results, so it is particularly important for a large range of practical applications in clinical practice. However, its disadvantage is that the required test specimens need to be pretreated, and the entire operation process requires high technical conditions and is expensive. Although there are also antibody detection methods in the prior art, such as ELISA, Western blot method, etc., which have high sensitivity and specificity for detecting the expression of viral proteins in serum, the operation is complicated and requires high laboratory conditions and detection personnel, which limits the large-scale promotion in clinical diagnostic applications. Many detection reagents that can identify and diagnose PRRSV lineage 1 strains have been established at home and abroad, and most of them are RT-PCR methods, but there are no reports of monoclonal antibodies that can be specifically used for the identification of PRRSV lineage 1 strains. The ORF5 gene is a target gene for studying PRRSV genetic analysis. The protein it encodes is the structural protein with the highest degree of variation in the PRRSV genome, and can be used as a common diagnostic marker. In view of this, the present invention is specially proposed. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides an antibody, an antibody composition and application thereof to the ORF5 protein of highly pathogenic porcine reproductive and respiratory syndrome virus.

[0005] Specifically, the technical solution of the present invention is as follows:

[0006] First, 1,143 tissue samples including lungs, lymph nodes, tonsils, and spleens of pigs suspected of being infected with PRRS were collected from large-scale farms in Shandong, Liaoning, Zhejiang, Jiangsu, Heilongjiang, Henan, Hebei, Jilin, Fujian, Hunan, Shanxi, Shaanxi, Chongqing, Sichuan, and Tianjin provinces during 2020-2024 for PRRSV isolation and genetic analysis. The obtained fragment sequences were spliced ​​and compared using biological software, and the complete whole genome sequence was subjected to genetic evolution analysis. The sequence recombination characteristics were analyzed using recombination analysis software to further clarify the whole genome characteristics and recombination characteristics of PRRSV clinical samples in some parts of my country, providing data support for the molecular epidemiology of PRRSV in my country.

[0007] Furthermore, the present invention performs protein expression and purification on the conserved regions in the above analysis results to prepare the corresponding antibody 7D12 for the highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 protein, wherein the amino acid sequence of the light chain variable region of the antibody 7D12 is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.2.

[0008] Preferably, the antibody is a monoclonal antibody, Fab, Fab', F(ab')2, Fv or a single-chain antibody.

[0009] Furthermore, the present invention provides a nucleic acid molecule encoding the antibody 7D12.

[0010] Preferably, the nucleotide sequence encoding the light chain variable region is as shown in SEQ ID NO: 3, or has at least 80% sequence similarity to SEQ ID NO: 3; the nucleotide sequence encoding the heavy chain variable region is as shown in SEQ ID NO: 4, or has at least 80% sequence similarity to SEQ ID NO: 4.

[0011] Furthermore, the present invention provides a biological material, which contains the nucleic acid molecule; the biological material is an expression cassette, a vector or a host cell.

[0012] Furthermore, the present invention provides an antibody conjugate of the highly pathogenic porcine reproductive and respiratory syndrome virus antibody 7D12, which is obtained by conjugating the 7D12 antibody with a marker, wherein the marker is selected from one or more of an enzyme label, a biotin label, a fluorescent dye label, a chemiluminescent dye label, and a radioactive label.

[0013] Furthermore, the present invention provides a composition of highly pathogenic porcine reproductive and respiratory syndrome virus antibody 7D12, wherein the composition comprises the antibody 7D12.

[0014] Furthermore, the present invention provides any one of the following (1) to (5) uses of the highly pathogenic porcine reproductive and respiratory syndrome virus antibody 7D12, the nucleic acid molecule, the biomaterial, the antibody conjugate, or the composition:

[0015] (1) Use in the preparation of a product for detecting the presence or level of ORF5 of highly pathogenic porcine reproductive and respiratory syndrome virus in a sample;

[0016] (2) Use in detecting the presence or level of highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 in a sample for non-diagnostic and therapeutic purposes;

[0017] (3) Use in the preparation of a product for neutralizing the activity of highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 in a sample; (4) Use in the preparation of a drug for neutralizing highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 in vivo;

[0018] (5) Application in quality control or production of products containing highly pathogenic porcine reproductive and respiratory syndrome virus ORF5.

[0019] Furthermore, the present invention provides a kit comprising the highly pathogenic porcine reproductive and respiratory syndrome virus antibody 7D12, or the antibody conjugate, or the composition.

[0020] Preferably, the kit is an enzyme-linked immunosorbent assay kit, a fluorescent immunoassay kit or a chemiluminescent immunoassay kit.

[0021] Beneficial Effects

[0022] Through the research of this application, it is found that PRRSV in my country currently presents the coexistence of multiple lineages and strains, GP5 protein is an important immunogenic protein of PRRSV, and ORF5 amino acid site variation may be one of the reasons for the failure of vaccine immunity. The antibody provided by the present invention has a high relative affinity constant with PRRSV GP5 protein proteins of different lineages and branches, can bind to the target protein with high sensitivity and high specificity, and has high stability; based on the antibody, the antibody can accurately, quickly, and mass-produce the PRRSV GP5 protein content in serum or related products, and has a good application prospect in the detection of PRRSV GP5 content. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0024] Figure 1Schematic diagram of ORF5 gene sequence analysis in each sample.

[0025] Figure 2 This is the electrophoresis diagram of the ORF5 fragment amplified by PCR, where M is the DL-2000 marker, 1 is the negative control, and 2-4 are the ORF5 amplified fragments.

[0026] Figure 3 The above figure is the identification by monoclonal antibody Western blot; 1 is the purified GP5 protein, 2 is the culture supernatant of Marc cells infected with PRRSV20200715 strain, 3 is the culture supernatant of Marc cells infected with JX A1 strain, 4 is the culture supernatant of Marc cells infected with HUN4 strain, and 5 is the culture supernatant of Marc cells infected with CH-1 strain.

[0027] Figure 4 The screened monoclonal antibodies can be used as tracers of PRRSV in the detection process of PRRSV, where 1 is PRRSV 20200715 strain infected with Marc cells, 2 is JX A1 strain infected with Marc cells, 3 is HUN4 strain infected with Marc cells, 4 is BJ4 strain infected with Marc cells, 5 is GM2 strain infected with Marc cells, and 6 is a negative control. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0029] Example 1 Analysis of ORF5 sequence of PRRSV and purification of GP5 protein of its lineage 1

[0030] During 2020-2024, samples of lungs, lymph nodes, tonsils, spleens and other tissues of suspected PRRS-infected pigs were collected from large-scale farms in Shandong, Liaoning, Zhejiang, Jiangsu, Heilongjiang, Henan, Hebei, Jilin, Fujian, Hunan, Shanxi, Shaanxi, Chongqing, Sichuan, Tianjin and other provinces in China for isolation and gene analysis of PRRSV virus. The above samples were numbered, sampled and ground, and dispensed into EP tubes, and stored at -80°C for later use. The ORF5 gene of the sample was PCR amplified using high-fidelity DNA polymerase PrimeSTAR HSDNA Polymerase. After the reaction was completed, the PCR product was taken out for electrophoresis identification, and the clones identified as positive were selected for sequencing. Sequence splicing was performed using Seqman software. MegAlign was used to analyze the nucleotide and deduced amino acid homology and amino acid variation sites of the PRRSV ORF5 gene sequence. MegAlign and MEGA-X software were used to perform genetic evolution analysis on the PRRSV ORF5 gene and representative strains of each lineage, and the phylogenetic tree was constructed using the neighbor-joining method (NJ). The Bootstrap value was set to 1000 (representing 1000 repetitions) to evaluate the confidence of the phylogenetic tree branches.

[0031] like Figure 1As shown, the sequence identity of ORF5 gene nucleotides in samples was 78.9-100%, and the deduced amino acid sequence identity was 80.2-100%, which was distributed on three branches of Lineage 1, Lineage 3, and Lineage 8 of PRRSV-2 on the genetic evolution tree, including two branches of Lineage 1 (Sublineage 1.5 and Sublineage 1.8). The amino acid differences of ORF5 in different lineages were mainly concentrated in the signal peptide region (1aa-26aa), decoy epitope (27aa-30aa), two hypervariable regions (32aa-35aa, 57aa-61aa) and two transmembrane regions (TM1, TM2), while the neutralization epitope region (37aa-45aa) was relatively conservative. Mutations of N30D, L28P, and N30S were found in the "decoy" epitope of the GP5 protein (V / ALVN / S at amino acid positions 27 to 30), and mutations of L41S, H37Y, and L38S were found in the neutralizing antigen epitope (SHF / LQLIYNL at amino acid positions 37 to 45, including the neutralizing epitope binding site (L / FQL at amino acid positions 39 to 41) and the recognition site of the neutralizing epitope (H and IYN at amino acid positions 38 and 42 to 44). The antigenic epitope of GP5 in lineage 1 is conservative, and there are no mutations in the amino acids of ORF5 of each lineage in the decoy epitope and the neutralizing antigen epitope. The representative strain PRRSV 20200715 (lineage 1) was selected as the object of further study.

[0032] Example 2 Screening and identification of monoclonal antibodies against ORF5 of PRRSV

[0033] Design and synthesize ORF5 amplification primers (ORF5-F: ATGTTGCGGAAATGCTAGACC; ORF5-R: CTACAATCGACGCCATTGTTC), use a viral RNA extraction kit to extract RNA from the sample and reverse transcribe it into cDNA, and use a PRRSV qRT-PCR kit to detect PRRSV. The cDNA with a lower Ct value was PCR amplified using the above ORF5 specific primers. PCR reaction conditions: 94℃ pre-denaturation for 2min; 94℃ denaturation for 30s, annealing for 30s, 72℃ extension for 2min, 35 cycles; 72℃ extension for 3min. Recover and purify the target fragment and connect it to the pET-28a vector using double enzyme digestion ( Figure 1), the successfully constructed recombinant plasmid pET-28a-GP5 was transformed into E. coli BL21 (DE3) to express the recombinant protein. Under IPTG induction, the recombinant plasmid transformed bacteria successfully expressed recombinant GP5, and the recombinant protein was soluble. After affinity purification by Ni-NTA-His column, a high-purity protein was obtained. The concentration of GP5 was 1 mg / mL as determined by the BCA method.

[0034] Female BALB / c mice aged 6-8 weeks were selected, and recombinant GP5 antigen was fully emulsified with an equal volume of complete Freund's adjuvant, and then subcutaneously immunized with 6-8 week-old Balb / c mice, with an antigen immunization dose of 20 μg / mouse. Subsequently, the mice were subcutaneously immunized three times every 2 weeks with the same dose of antigen fully emulsified with incomplete Freund's adjuvant. The mouse serum titer was measured after three immunizations, and booster immunization was performed intraperitoneally 3 days before fusion. Using PEG Hybri-Max as a fusion agent, mouse spleen cells and SP2 / 0 cells were mixed at a ratio of 4:1. The fused cells were added to a 96-well plate (1×10 5 cells / well), each well containing 0.1mL 1×HAT medium. On the 3rd day, 0.1mL HT (medium was added, and on the 7th day, the medium in the 96-well plate was aspirated and 0.2mL fresh HT medium was added. On the 9th day, the supernatant was collected for ELISA detection, which was summarized as follows: the 96-well ELISA plate was coated with purified GP5 protein, placed at room temperature overnight, washed 3 times with washing buffer (PBS+0.05% Tween20), and then incubated with blocking buffer (PBS+1% BSA) for 1 hour; the 96-well plate was washed 3 times; hybridoma supernatant was added for 1 hour and washed 3 times; 100μL 1:10000 diluted goat anti-mouse IgG secondary antibody was added to each well, incubated at room temperature for 1 hour and then washed 3 times; 100μL TMB was added to each well for color development for 3 minutes, and then 100μL / well of stop solution (2M H2SO4) was added to terminate the reaction, and the reaction was performed with Tecan The Spark microplate reader measures the OD450 signal of each sample. The monoclonal wells that are positive in both tests are subcloned again. After three subclonings, when the positive rate of all cloned cell wells is 100%, it can be determined that the hybridoma cell line 7D12 that can stably secrete monoclonal antibodies has been obtained. The positive monoclonal hybridoma is cultured in 50mL serum-free medium for 8-9 days, and the supernatant is collected by centrifugation for expansion culture.

[0035] 10-week-old female Balb / c mice were intraperitoneally injected with 0.5 mL of liquid paraffin. 7 days later, 1×10 6 Before inoculation, the hybridoma cells were washed twice with DMEM culture medium and the concentration was adjusted to 1×10 7 / mL, take 0.1mL of cell suspension and inject it into the mouse peritoneal cavity. After 7 days, ascites will be produced, which can be collected by syringe. The collected ascites is centrifuged at 3000rpm for 5min and the supernatant is collected. Monoclonal antibodies are purified using Protein A columns, and the purified monoclonal antibodies are dialyzed against PBS at 4℃ overnight, quantified using a BCA quantitative kit, and the concentration is adjusted to 1mg / mL.

[0036] The monoclonal antibody 7D12 was sequenced, and the sequencing results showed that the amino acid sequence of its light chain variable region was: DIVMTQALSNPVTSASLGSSC RSKSLLHIRNYTSLF WYLQPDGTPQLLIY QMSLHLAS GVPDRFSSSGSGTDFTLRISSLTISNLDQC AQNNTLPYT FGGGTRVLEIK (SEQ ID NO. 1), wherein LCDR1-3 are underlined;

[0037] Its nucleotide sequence is:

[0038] gatattgtgatgacccaggcgctgagcaacccggtgaccagcgcgagcctgggcagcagctgccgcagcaaaagcctgctgcatattcgcaactataccagcctgttttggtatctgcagccggatggcaccccgcagctgctgatttatcagatgagcctgca tctggcgagcggcgtgccggatcgctttagcagcagcggcagcggcaccgattttaccctgcgcattagcagcctgaccattagcaacctggatcagtgcgcgcagaacaacaccctgccgtatacctttggcggcggcacccgcgtgctggaaattaaa(SEQ ID NO.3);

[0039] The amino acid sequence of its heavy chain variable region is:

[0040] EVQLVESGGGLVGSLKLSCALSCASGF TFSYGMS WVRQTPEKRRLELWVA TISRGTYPSYSNSG RFTIDNAKAKTL YLQMSLMNSLRSYYCTR EGIFFNFYVEYSAMY WGQTTLTVSS (SEQ ID NO. 2), wherein HCDR1-3 are underlined;

[0041] Its nucleotide sequence is:

[0042] gaagtgcagctggtggaaagcggcggcggcctggtgggcagcctgaaactgagctgcgcgctgagctgcgcgagcggctttacctttagctatggcatgagctgggtgcgccagaccccggaaaaacgccgcctggaactgtgggtggcgaccattagccgcggcacctatccgagcta tagcaacagcggccgctttaccattgataacgcgaaagcgaaaaccctgtatctgcagatgagcctgatgaacagcctgcgcagctattattgcacccgcgaaggcattttttttaacttttatgtggaatatagcgcgatgtattggggccagaccaccctgaccgtgagcagc(SEQ ID NO.4).

[0043] GP5 antigen was coated on the ELISA plate and blocked. After washing the plate with PBST, the monoclonal antibody 7D12 was diluted to a saturated concentration and added to the ELISA plate, 100 μL / well, and incubated at room temperature for 2 hours. After washing the plate with PBST, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0 mol / L NaSCN (sodium sulfhydrate) solution was added in sequence at 60 μL / well, and incubated at room temperature for 15 minutes. After washing the plate with PBST, HRP-labeled goat anti-mouse IgG was added, and the plate was incubated at room temperature for 45 minutes for color development detection. After elution, the sodium thiocyanate concentration corresponding to the OD value at 450nm dropped to 50% of the uneluted value was the relative affinity constant of the antibody. The results showed that the affinity of the screened monoclonal antibody 7D12 was greater than 4 mol / L, and it had good affinity.

[0044] NaSCN(mol / L) 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5 7D12 2.512 2.403 2.137 2.011 1.988 1.974 1.905 1.894 1.348 0.421 0.274

[0045] The collected protein expression samples were mixed with 5× protein loading buffer, boiled for 10 minutes, and separated by 10% SDS-PAGE electrophoresis, and stained with Coomassie Brilliant Blue R-250. At the same time, the electrophoresed protein samples were transferred to the NC membrane, and the NC membrane was blocked with TBS solution containing 5% skim milk at room temperature for 2 hours. The NC membrane was then incubated with the screened monoclonal antibodies or label antibodies, positive serum, etc. at room temperature for 1 hour, washed 3 times with 0.5% Tween-20 (TBST), and incubated with HRP-labeled goat anti-mouse IgG (H+L) as the secondary antibody (1:10000) at room temperature for 1 hour, washed 3 times with TBST, and developed with ECL. The immunoblot results were detected by the Tianneng imaging system. The results showed that the screened monoclonal clones could not only specifically recognize the purified expressed GP5 protein, but also specifically recognize the GP5 protein expressed by the natural virus-infected Marc-145 cells.

[0046] Indirect immunofluorescence (IFA) assay

[0047] Marc-145 cells were infected with 0.1MOI PRRSV HuN4, CH-1a, and ZJhz021 strains, respectively. After 24 hours of infection, the infected Marc-145 cells were fixed with pre-cooled 80% ethanol. After washing the cells three times with PBS, the screened monoclonal antibodies were added and incubated at 37°C for 1 hour. After washing with PBS three times, 1:1000 diluted FITC-labeled goat anti-mouse IgG (H+L) was added and incubated at 37°C in the dark for 30 minutes. After washing with PBS, the test results were recorded under an inverted fluorescence microscope. The results showed that the screened monoclonal antibodies can be used as tracers for PRRSV in the detection process of PRRSV.

[0048] The above description of the embodiments is to facilitate the understanding and use of the present invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present invention without departing from the scope of the present invention should be within the protection scope of the present invention.

Claims

1. An antibody or antibody binding fragment against the ORF5 protein of highly pathogenic porcine reproductive and respiratory syndrome virus, characterized in that The amino acid sequence of the light chain variable region of the antibody or antibody binding fragment is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

2.

2. The antibody or antibody binding fragment according to claim 1, wherein the antibody or antibody binding fragment is a monoclonal antibody, Fab, Fab', F(ab')2, Fv or a single-chain antibody.

3. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the antibody or antibody binding fragment of claim 1.

4. The nucleic acid molecule according to claim 4, characterized in that The nucleotide sequence encoding the light chain variable region is shown in SEQ ID NO: 3, or has at least 80% sequence similarity to SEQ ID NO: 3; the nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID NO: 4, or has at least 80% sequence similarity to SEQ ID NO:

4.

5. A biological material comprising the nucleic acid molecule according to claim 3 or 4, wherein the biological material is an expression cassette, a vector or a host cell.

6. A conjugate of a highly pathogenic porcine reproductive and respiratory syndrome virus antibody or antibody binding fragment, characterized in that The conjugate is obtained by conjugating the antibody or antibody binding fragment of claim 1 with a label, and the label is selected from one or more of enzyme labeling, biotin labeling, fluorescent dye labeling, chemiluminescent dye labeling, and radioactive labeling.

7. A composition of highly pathogenic porcine reproductive and respiratory syndrome virus antibodies or antibody binding fragments, the composition comprising the antibody or antibody binding fragment according to claim 1.

8. A kit, characterized in that The kit comprises the antibody or antibody binding fragment of claim 1 or 2, the nucleic acid molecule of claim 3 or 4, the biomaterial of claim 5, the conjugate of claim 6, and / or the composition of claim 7.

9. The kit according to claim 8, which is an enzyme-linked immunosorbent assay kit, a fluorescent immunoassay kit or a chemiluminescent immunoassay kit.

10. Use of the antibody or antibody binding fragment of claim 1 or 2, the nucleic acid molecule of claim 3 or 4, the biomaterial of claim 5, the conjugate of claim 6, the composition of claim 7 and / or the kit of claim 8 or 9 in any of the following (1) to (5): (1) Use in the preparation of a product for detecting the presence or level of highly pathogenic porcine reproductive and respiratory syndrome virus in a sample; (2) Use in detecting the presence or level of highly pathogenic porcine reproductive and respiratory syndrome virus in samples for non-diagnostic and therapeutic purposes; (3) Use in the preparation of a product for neutralizing the activity of highly pathogenic porcine reproductive and respiratory syndrome virus in a sample; (4) Use in the preparation of drugs for neutralizing highly pathogenic porcine reproductive and respiratory syndrome virus in vivo; (5) Application in quality control or production of products containing highly pathogenic porcine reproductive and respiratory syndrome virus.

Images