Phytobacterium plantarum BR32 with functions of preventing decayed teeth and improving inflammation and application of phytobacterium plantarum BR32

Abstract

The invention relates to the technical field of microorganisms, in particular to plant lactobacillus BR32 with functions of preventing decayed teeth and improving inflammation and application of the plant lactobacillus BR32. The plant lactobacillus BR32 with the functions of preventing decayed teeth and improving inflammation, provided by the invention, has the preservation number of CGMCC No.32836, has an inhibiting effect on the growth of oral pathogens such as streptococcus mutans, candida albicans and porphyromonas gingivalis, is high in oxidation resistance, is beneficial to continuous oral cavity stability maintenance through a synergistic effect, also has relatively high hydrophobicity and self-agglutination capability, and can be used for preparing oral cavity health-care products. The compound is low in tooth environment corrosion, high in lysozyme tolerance and good in oral colonization capacity, does not have a hemolysis phenomenon in in-vitro hemolysis culture, is sensitive to common antibiotics and has relatively high food safety. The invention further provides a microbial agent, a probiotic product, a functional food, a fermented product, a bacteriostatic agent and an oral product containing the plant lactobacillus BR32 with the functions of preventing the decayed teeth and improving the inflammation, and the effects of preventing the decayed teeth, improving the inflammation, preventing dental plaque, relieving oral ulcer and the like are achieved.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a Lactobacillus plantarum BR32 having the functions of preventing dental caries and improving inflammation and an application thereof. Background Art

[0002] In the microscopic world of the human body, the oral cavity is a busy and complex ecosystem, with hundreds of millions of microorganisms coexisting and thriving in the human oral cavity, maintaining a delicate balance. However, when certain bacteria, such as Candida albicans, Streptococcus mutans, and Porphyromonas gingivalis, overgrow, this balance will be broken, causing a series of disturbing oral symptoms, affecting oral health and even the overall health of the human body.

[0003] Candida albicans usually causes oral mucositis, thrush and other diseases. When an infection occurs, white or milky white patches will appear in the patient's mouth, sometimes accompanied by pain and burning sensation, and in severe cases, it may affect eating and speaking.

[0004] Streptococcus mutans is one of the main culprits of dental caries, which not only affects the appearance, but also causes serious oral problems such as pain and infection. Streptococcus mutans can use the sugar in the mouth to produce acidic substances, which corrode the enamel on the surface of the teeth and lead to the formation of dental cavities. With the improvement of people's living standards and changes in dietary structure, the intake of high-sugar foods has increased significantly, and the opportunities for Streptococcus mutans to "commit crimes" have also increased. Children, teenagers and even adults are all facing the threat of dental caries.

[0005] Porphyromonas gingivalis is one of the main pathogens of periodontal disease. It can reproduce in the gap between gums and teeth, causing symptoms such as redness, swelling, bleeding, and atrophy of gums. As the disease progresses, it may also cause teeth to loosen and fall out. Periodontal disease not only affects oral health, but is also closely related to systemic diseases such as heart disease and diabetes. In China and around the world, periodontal disease has become one of the important health issues that affect people's quality of life.

[0006] The presence of free radicals in the mouth can damage the enamel on the surface of the teeth, making the teeth sensitive and more prone to tooth decay. Long-term exposure to free radicals can also damage the gum tissue, causing gum atrophy and loose teeth. In addition, free radicals can also irritate the oral mucosa and soft tissue, causing oral inflammation, leading to bacterial growth, and then causing bad breath problems.

[0007] Globally, oral health issues have become a public health challenge that cannot be ignored. According to data from the World Health Organization, the incidence of oral diseases remains high worldwide, especially in developing countries. Due to insufficient oral health knowledge and limited medical resources, the prevention and treatment of oral diseases is particularly severe. With the aging of the population and changes in lifestyle, oral health issues are becoming increasingly prominent.

[0008] On April 14, 2023, Chinese patent CN115960740A disclosed a strain of Lactobacillus plantarum and its use in preventing or treating oral diseases. The Lactobacillus plantarum VHProbi V38 has the function of scavenging free radicals and inhibiting oral pathogens, but its scavenging rates for DPPH radicals and hydroxyl radicals are only 20.9% and 36.3%, respectively. The free radical scavenging rate is crucial to maintaining oral health. While inhibiting oral pathogens, having stronger antioxidant ability is still a problem that technical personnel in this field need to explore and solve. Summary of the invention

[0009] In order to obtain a human-suitable strain that has stronger antioxidant capacity while inhibiting oral pathogens, the present invention provides a plant lactobacillus BR32 with the functions of preventing dental caries and improving inflammation, the Latin name of which is Lactiplantibacillus plantarum The deposit number is CGMCC No.32836. It was deposited in the General Microbiology Center of China Culture Collection Administration on November 28, 2024. The address of the deposit unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0010] The Lactobacillus plantarum BR32 with the functions of preventing caries and improving inflammation is isolated from a kimchi sample from Zhao'an County, Zhangzhou City, Fujian Province. It has a strong ability to inhibit and slow the growth of Streptococcus mutans and the formation of its biofilm, and also has an inhibitory effect on the growth of oral inflammatory pathogens Candida albicans and Porphyromonas gingivalis. At the same time, it also has a high free radical scavenging rate, is sensitive to antibiotics, has low corrosiveness to the dental environment, has a high tolerance to lysozyme, and has a good oral colonization ability.

[0011] The present invention also provides a Lactobacillus plantarum BR32 bacterial agent, the components of which include the Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation as described above.

[0012] Furthermore, the number of viable Lactobacillus plantarum BR32 in the Lactobacillus plantarum BR32 bacterial agent is ≥ 1×10 11 CFU / g or ≥1×10 10 CFU / mL.

[0013] The present invention also provides a probiotic product of Lactobacillus plantarum BR32, the components of which include the Lactobacillus plantarum BR32 having the functions of preventing dental caries and improving inflammation as described above.

[0014] The present invention also provides a Lactobacillus plantarum BR32 functional food, the components of which include the Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation as described above.

[0015] Furthermore, the functional food includes any one of functional foods for preventing caries, functional foods for improving periodontal inflammation, functional foods for preventing angular cheilitis, functional foods for improving oral ulcers, functional foods for inhibiting oral pathogens, functional foods for preventing dental plaque, antioxidant functional foods and antibiotic-sensitive functional foods, or a combination of any two or more thereof.

[0016] The present invention also provides a Lactobacillus plantarum BR32 fermentation product, the components of which include the Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation as described above.

[0017] The present invention also provides an antibacterial agent, the components of which include the above-mentioned Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation.

[0018] The present invention also provides an oral product, the components of which include the above-mentioned Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation.

[0019] Furthermore, the oral product includes any one of oral lozenges, oral popping beads, chewing gum and antibacterial toothpaste.

[0020] The Lactobacillus plantarum BR32 provided by the present invention has the following beneficial effects: The Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation provided by the present invention is separated from a kimchi sample from Zhao'an County, Zhangzhou City, Fujian Province. No hemolysis occurs in in vitro hemolysis culture, and the strain is sensitive to common antibiotics, thereby having high food safety.

[0021] The metabolites produced by the Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation provided by the present invention have strong inhibition and mitigation capabilities on the growth of Streptococcus mutans and the formation of its biofilm. In addition, the metabolites have strong copolymerization capabilities with Streptococcus mutans, and can make it flow with the flow of saliva, oral cleaning and other behaviors, thereby reducing its self-agglutination rate, and further reducing its adhesion to the oral mucosa and tooth surface, thereby reducing the colonization of Streptococcus mutans in the oral cavity, synergistically acting, and effectively preventing dental caries.

[0022] The Lactobacillus plantarum BR32 with the function of preventing caries and improving inflammation provided by the present invention also has good inhibitory ability against Candida albicans and Porphyromonas gingivalis, can effectively improve oral diseases such as oral mucositis, thrush, periodontitis, gingival bleeding, gingival atrophy, etc., and has important application value in the fields of oral products and oral functional foods.

[0023] The Lactobacillus plantarum BR32 with caries prevention and inflammation improvement functions provided by the present invention also has a very high free radical scavenging rate, with a DPPH free radical scavenging rate of (90.40±0.60)% and an OH free radical scavenging rate of (74.34±0.63)%, and has a strong antioxidant capacity, and plays a vital synergistic role in continuously maintaining oral health.

[0024] The Lactobacillus plantarum BR32 with caries prevention and inflammation improvement functions provided by the present invention has good hydrophobicity and self-aggregation ability, the hydrophobicity to xylene is (22.24±0.01)%, the hydrophobicity to chloroform is (26.5±0.02)%, the hydrophobicity to ethyl acetate reaches (35.96±0.01)%, the 24-hour self-aggregation rate reaches (83.56±0.01)%, and it has a certain adhesion ability to host tissue cells. In addition, it is highly tolerant to the lysozyme environment in the oral cavity, can be well colonized in the oral cavity, and has low corrosiveness to the tooth environment, which is conducive to effectively, long-term and safely exerting an antibacterial and stabilizing effect in the oral cavity.

[0025] The plant lactobacillus BR32 with the prevention of dental caries and improvement of inflammation provided by the present invention can produce organic acid to inhibit the growth of oral pathogens: Streptococcus mutans, Candida albicans, and Porphyromonas gingivalis, and secondly, the biofilm produced by these oral pathogens can be efficiently removed, and the colonization ability of oral pathogens in the oral cavity is reduced by copolymerization, and the pathogens that can cause dental caries and oral inflammation in the oral cavity are effectively reduced through triple action. And the probability of damage to the enamel, gingival tissue, and oral mucosa on the tooth surface is reduced by high antioxidant property, and the problems of tooth sensitivity, dental caries, gum atrophy, loose teeth, and bad breath are effectively prevented. And the colonization ability of plant lactobacillus BR32 in the oral cavity is confirmed by hydrophobicity, self-polymerization ability, and lysozyme tolerance, and the safety of plant lactobacillus BR32 consumption is confirmed by in vitro hemolysis test, antibiotic resistance analysis, and nano-hydroxyapatite simulated tooth corrosion test.

[0026] The Lactobacillus plantarum BR32 bacterial agent, probiotic product, functional food, fermented product, antibacterial agent and oral product provided by the present invention contain Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation, have high food safety, have obvious inhibitory effects on Streptococcus mutans, Candida albicans and Porphyromonas gingivalis, can effectively prevent dental caries and improve inflammation, and also have a very high free radical scavenging rate, are beneficial to continuously stabilizing the oral cavity, have low corrosiveness to the tooth environment, have high tolerance to lysozyme, and have high oral colonization efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1 This is a graph showing the results of an experiment on the antibacterial ability of the strain BR32 provided in Example 1 of the present invention against Streptococcus mutans; Figure 2 This is an analysis diagram of the copolymerization effect of 13 strains initially screened and Streptococcus mutans provided in Example 1 of the present invention; Figure 3 This is a colony morphology diagram of Lactobacillus plantarum BR32 with caries prevention and inflammation improvement functions provided in Example 2 of the present invention; Figure 4 Gram staining display of Lactobacillus plantarum BR32 with caries prevention and inflammation improvement functions provided in Example 2 of the present invention; Figure 5 A schematic diagram of the phylogenetic tree of Lactobacillus plantarum BR32 with caries prevention and inflammation improvement functions based on 16S rRNA sequences provided in Example 2 of the present invention; Figure 6 This is a graph showing the results of an in vitro hemolysis experiment of Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation provided in Example 3 of the present invention; Figure 7 This is a graph showing the results of an antibiotic sensitivity test of Lactobacillus plantarum BR32 with caries prevention and inflammation improvement functions provided in Example 3 of the present invention; Figure 8 A graph showing the results of a lysozyme tolerance experiment of Lactobacillus plantarum BR32 provided in Example 5 of the present invention; Fig. 9 The standard curve of phosphorus element drawn for Example 9 of the present invention; Fig.10This is a graph showing the experimental results of the effect of Lactobacillus plantarum BR32 on Candida albicans provided in Example 10 of the present invention. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments, and the technical features designed in different implementations of the present invention described below can be combined with each other as long as they do not conflict with each other. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] The present invention provides a plant lactobacillus BR32 having the functions of preventing dental caries and improving inflammation, the Latin name of which is Lactiplantibacillus plantarum The deposit number is CGMCC No.32836. It was deposited in the General Microbiology Center of China Culture Collection Administration on November 28, 2024. The address of the deposit unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0031] Strain source: The Lactobacillus plantarum BR32 was isolated from a kimchi sample in Zhao'an County, Zhangzhou City, Fujian Province. The DNA genome of the strain was extracted and PCR amplification was performed. The PCR amplification product was sequenced by 16S rRNA. Through Blast sequence alignment, the 16S rRNA gene sequence of the strain was highly homologous to that of Lactobacillus plantarum, and it was named Lactobacillus plantarum BR32.

[0032] Colony morphology: round, milky white, with smooth and neat edges on MRS solid culture medium.

[0033] Physiological and biochemical characteristics of the strain: A single colony of the Lactobacillus plantarum BR32 was picked for Gram staining and catalase test. The Lactobacillus plantarum BR32 was a Gram-positive bacterium with a short rod-shaped cell shape, negative for catalase and oxidase, and no spores.

[0034] Physiological and biochemical functions of the strain: The plant lactobacillus BR32 has high food safety; has strong inhibition and mitigation capabilities on the growth of Streptococcus mutans and the formation of its biofilm; also has a significant inhibitory effect on the growth of oral inflammatory pathogens Candida albicans and Porphyromonas gingivalis; has high DPPH free radical scavenging rates and OH free radical scavenging rates, strong antioxidant capacity, and strong ability to maintain oral health; has low corrosiveness to the dental environment, high tolerance to lysozyme, and good oral colonization ability.

[0035] Strain isolation process: Take 5 g of kimchi sample from Zhao'an County, Zhangzhou City, Fujian Province, put it in a sterile homogenizing bag, add 45 mL of 0.85% saline, and mix it homogenously to obtain a sample dilution solution; draw 100 μL of the above sample solution for a 10-fold series of gradient dilutions, and draw 10 dilutions of 10 times. -3 , 10 -4 , 10 -5 200 μL of each sample was spread on an MRS solid medium plate containing 2.5% CaCO3 and inverted for 48 h at 37°C; according to the morphology and color of the colonies, colonies with good growth and large calcium dissolution circles were picked on the culture plate, and repeatedly separated and purified by plate streak separation method until all colonies on the MRS solid medium maintained a single morphology, and single colonies were picked in MRS liquid medium and cultured at 37°C for 12 h. The fermentation broth of the strain was mixed with 50% glycerol in equal proportions and stored in a bacteria library at -80°C, and the isolated strain was named BR32; Among them, the formula of MRS solid culture medium is: 20.0 g glucose, 15.0 g agar powder, 10.0 g tryptone, 10.0 g beef extract, 5.0 g yeast extract powder, 5.0 g anhydrous sodium acetate, 2.0 g dipotassium hydrogen phosphate, 2.0 g ammonium citrate, 0.5 g magnesium sulfate, 0.25 g manganese sulfate monohydrate, 1.0 mL Tween-80, 1 L deionized water, pH = 6.5 (MRS liquid culture medium is obtained by removing 15.0 g agar powder).

[0036] Example 1 Screening of strain BR32 1.1 Preliminary screening using the Oxford cup double-layer plate method A total of 70 strains from different sources in the bacterial library were taken in turn, and the Oxford cup double-layer plate method was used for preliminary screening of the inhibitory effect on the growth of Streptococcus mutans; wherein the lower plate of the double-layer plate was MRS solid culture medium, and the upper plate was 75% BHI culture medium.

[0037] The 70 strains were inoculated into MRS liquid culture medium for activation, and cultured at 37°C for 12 h to activate the first generation of strains. The bacterial solution was transferred to MRS liquid culture medium at a 2% inoculation rate and cultured at 37°C for 24 h to activate the second generation of strains.

[0038] Inoculate 2% (v / v) of Streptococcus mutans grown to the logarithmic phase into 75% BHI medium and mix well; The bottom layer of the culture medium is 10 mL of MRS solid culture medium. After the culture medium solidifies, place an Oxford cup on each MRS solid culture medium plate and press gently to make the Oxford cup and the culture medium completely fit together. Continue to pour 7 mL of 75% BHI culture medium into the culture medium. After solidification, add 200 μL of lactic acid bacteria fermentation broth to the Oxford cup and culture it upright at 37°C for 12 h.

[0039] If a transparent circle is formed on the upper culture medium of the corresponding strain, it indicates that the strain can inhibit the growth of Streptococcus mutans. According to the size of the transparent circle, 13 strains with strong inhibitory effects on Streptococcus mutans were selected. The results are referenced to Figure 1 Among them, strain BR32 has the strongest antibacterial ability against Streptococcus mutans, and the diameter of the inhibition zone can reach (25.5±0.06) mm.

[0040] 1.2 Determination and screening of copolymerization ability with Streptococcus mutans The antibacterial substances metabolized by the 13 strains obtained in the above preliminary screening can inhibit the growth of Streptococcus mutans, and their copolymerization with Streptococcus mutans can make the Streptococcus mutans flow with the flow of saliva, oral cleaning and other behaviors, thereby reducing the self-agglutination rate of oral pathogens, and then reducing the adhesion of Streptococcus mutans to the oral mucosa and tooth surface, achieving the effect of reducing the colonization of pathogens in the oral cavity.

[0041] The above 13 strains and Streptococcus mutans were cultured overnight, centrifuged at 4000 rpm for 5 min, the supernatant was discarded, the bacteria were washed twice with sterile PBS buffer, and then resuspended with sterile PBS buffer to adjust the OD of the bacterial suspension. 600 = 0.6 ± 0.02; The culture fluids of the 13 strains were mixed with the culture fluid of Streptococcus mutans in equal amounts, and allowed to stand at room temperature. The OD values ​​at 2 h, 4 h, 6 h, 8 h, and 24 h were measured. 600 .

[0042] The copolymerization capacity was calculated according to formula (1), and the data were summarized in Table 1:

[0043] A0: absorbance value of the bacterial suspension of the primary screening strain at 600 nm when not mixed; B0: absorbance value of Streptococcus mutans suspension at 600 nm when not mixed; C t : Absorbance of mixed bacterial solution at 600 nm at different times.

[0044] Table 1 Test results of copolymerization ability with Streptococcus mutans

[0045] refer to Figure 2 From the analysis of the copolymerization effect of the 13 strains initially screened with Streptococcus mutans, it can be seen that all 13 strains have a certain copolymerization effect on Streptococcus mutans, and as time goes by, the copolymerization ability of the strains on Streptococcus mutans is also increasing; further, according to the data in Table 1, it can be clearly known that at 8 h, the copolymerization ability of strain BR32 and Streptococcus mutans was 27.21%, the highest value among the 13 strains, and reached 80.32% at 24 h, still the strain with the strongest copolymerization ability with Streptococcus mutans, while the copolymerization levels of the remaining 12 strains with Streptococcus mutans at 24 h were between 55.05% and 79.75%.

[0046] Example 2 Identification of strain BR32 2.1 Colony morphology identification The glycerol-preserved strain BR32 was taken out from the bacteria library and inoculated into MRS liquid medium at a 2% (v / v) inoculation rate for strain activation. The strain was cultured in a shaking incubator at 37°C and 180 rpm for 24 h, and then streaked on an MRS solid medium plate. The plate was inverted and cultured at 37°C for 48 h to obtain a single colony.

[0047] Colony morphology reference Figure 3 As shown, the single colony of the strain BR32 is round, milky white, and has smooth and neat edges.

[0048] 2.2 Physiological and biochemical tests The purified strain BR32 was subjected to Gram staining test, and it was detected that the strain had a single morphology, all of which were short rod-shaped, purple in Gram staining, no spore formation, and negative for catalase and oxidase. The Gram staining results were as follows: Figure 4 shown.

[0049] 2.3 16S rRNA gene sequence identification (1) Extraction of strain DNA Take 2 mL of the strain culture medium into a centrifuge tube, centrifuge at 12000 rpm for 1 min, remove the supernatant, and retain the bacteria; Add 200 μL of 20 mg / mL lysozyme to the centrifuge tube and treat at 37°C for more than 30 min; Add 200 μL of solution A to the centrifuge tube, oscillate thoroughly or use a pipette to repeatedly blow up and down to fully suspend the bacteria, add 20 μL of 10 mg / mL RNaseA to the suspension, mix thoroughly by inversion, and place at room temperature for 15-30 min; Add 20 μL of 10 mg / mL proteinase K to the centrifuge tube, mix thoroughly, and digest at 55°C for 30-60 min. During the digestion period, invert the centrifuge tube several times to mix until the sample is completely digested to obtain a clear and viscous bacterial solution. Add 200 μL of solution B to the centrifuge tube and mix thoroughly by inverting. If a white precipitate appears during this period, place it at 75°C for 15-30 min. The precipitate will disappear and you can continue the operation. Add 200 μL of anhydrous ethanol to the centrifuge tube and mix thoroughly. Flocculent precipitation may appear during this period, which does not affect the extraction of strain DNA. Add the solution and flocculent precipitation to the adsorption column and let it stand for 2 min. Centrifuge at 12000 rpm for 2 min, discard the waste liquid, and place the adsorption column in a collection tube; Add 600 μL of rinse solution to the adsorption column, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the adsorption column in a collection tube; Add 600 μL of rinse solution to the adsorption column again, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the adsorption column in a collection tube; Centrifuge at 12000 rpm for 2 min, leave the adsorption column open at room temperature for 15 min, remove the residual rinse solution in the adsorption column to prevent the residual rinse solution from affecting subsequent enzyme digestion, PCR and other experimental operations; Place the adsorption column in a clean centrifuge tube, drop 100 μL of the eluent preheated in a 65°C water bath into the center of the adsorption membrane, place at room temperature for 5 min, and centrifuge at 12,000 rpm for 1 min; The eluate obtained by centrifugation was suspended and added to the adsorption column, placed at room temperature for 2 minutes, and centrifuged at 12000 rpm for 2 minutes to obtain high-quality strain DNA.

[0050] Among them, the kit is a bacterial genomic DNA extraction kit sold by Tiangen Biochemical Technology (Beijing) Co., Ltd.; Lysozyme buffer: 20 mmol / L Tris (pH=8.0), 2 mmol / L Na2-EDTA, 1.2% TritonX-100.

[0051] (2) PCR amplification of 16S rRNA gene using strain DNA as template The strain DNA is amplified by PCR, and the PCR amplification product is sequenced by 16S rRNA; Among them, the amplification primers used were upstream primer 27F: AGAGTTTGGATCCTGGCTCAG and downstream primer 1492R: CGGTTACCTTGTTACGACTT; The PCR reaction system was: DNA 1 μL, upstream primer 27F 1 μL, downstream primer 1492R 1 μL, Premix Ex Taq 10 μL, ddH2O 7 μL; The PCR reaction conditions were as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, 30 cycles; and extension at 72°C for 5 min.

[0052] The 16S rRNA sequencing company is Fuzhou Qingke Biotechnology Co., Ltd.

[0053] The sequencing results were searched for similar sequences in the NCBI database using Blast software, and the strain BR32 sequence was compared with the 16S rRNA gene sequence of related species obtained from the gene bank. The phylogenetic tree was constructed using Mega7.0 software. Figure 5 The gene sequence is as follows: 16S rRNA gene sequence determination results:

[0054] Based on the comprehensive analysis of the colony morphology, cell morphology, physiological and biochemical characteristics and 16S rRNA gene sequence identification results of the strain BR32, the strain BR32 was identified as Lactobacillus plantarum ( Lactiplantibacillus plantarum ).

[0055] Example 3 Food Safety Evaluation of Lactobacillus plantarum BR32 3.1 In vitro hemolysis assay Take out the glycerol-preserved strain of Lactobacillus plantarum BR32 from the bacterial bank and activate it for 2 generations; Add 20% sterile defibrinated sheep blood to the MRS solid culture medium at 50-55°C, mix well and pour into a culture dish. After solidification, the blood agar culture medium is obtained. Pick a single colony of activated Lactobacillus plantarum BR32 and streak it on the blood agar medium, use Escherichia coli as a positive control, and culture it at 37°C for 24 hours; Observe whether there is a hemolytic transparent zone around the colony. If so, it is hemolysis positive.

[0056] Experimental results reference Figure 6 As shown in the figure, a hemolytic transparent zone appeared around the Staphylococcus aureus colonies in the positive control group, indicating that hemolysis occurred, while no obvious transparent zone appeared around the Lactobacillus plantarum BR32 colonies, indicating that Lactobacillus plantarum BR32 did not show hemolysis after being cultured on the blood agar plate for 24 h, and was safe for consumption.

[0057] 3.2 Antibiotic sensitivity test Lactobacillus plantarum BR32 was activated for 2 generations and cultured in MRS liquid medium at 37°C until the McFarland turbidity was 0.5; Pipette 200 μL of bacterial solution and drop it onto the surface of MRS solid medium, and use a coating rod to evenly spread the inoculation; Within 15 minutes after inoculation, spread the Liofilchem ​​drug-sensitive paper on the surface of the culture medium, dry it, and then incubate it upside down at 37°C for 8 to 24 hours; The diameter of the complete inhibition transparent zone was measured to evaluate the antibiotic sensitivity of the strains, and the results are summarized in Table 2 ; The specifications of the Liofilchem ​​drug sensitivity paper are as follows: ampicillin (AMP, 10 μg / tablet), tetracycline (TE, 30 μg / tablet), erythromycin E (15 μg / tablet), amoxicillin (AML, 10 μg / tablet), chloramphenicol C (30 μg / tablet), azithromycin (AZM, 15 μg / tablet); According to the interpretation standard of the antibacterial range of the antibiotic susceptibility test paper strip method, ampicillin (AMP, 10 μg / tablet) with an inhibition zone diameter of ≥17 mm is sensitive (S); tetracycline (TE, 30 μg / tablet) with an inhibition zone diameter of 15-18 mm is intermediate (I); erythromycin E (15 μg / tablet) with an inhibition zone diameter of ≥23 mm is sensitive (S); amoxicillin (AML, 10 μg / tablet) with an inhibition zone diameter of ≥18 mm is sensitive (S); chloramphenicol C (30 μg / tablet) with an inhibition zone diameter of ≥18 mm is sensitive (S); and azithromycin (AZM, 15 μg / tablet) with an inhibition zone diameter of ≥17 mm is sensitive (S).

[0058] Table 2 Results of sensitivity evaluation of Lactobacillus plantarum BR32 to 6 common antibiotics

[0059] according to Figure 7 From the evaluation results in the experimental results diagram and Table 2, it can be seen that among the 6 common antibiotics, Lactobacillus plantarum BR32 has an intermediate sensitivity to tetracycline and is relatively sensitive to other antibiotics, which indicates that Lactobacillus plantarum BR32 can be safely used in food.

[0060] Example 4 Determination of Antioxidant Capacity of Lactobacillus plantarum BR32 Fermentation Supernatant 4.1 Preparation of cell-free fermentation supernatant Lactobacillus plantarum BR32 was activated for 2 generations and inoculated into MRS liquid culture medium at a 2% (v / v) inoculation amount. The culture was incubated at 37°C for 12 h, and centrifuged at 4°C and 8000 rpm for 10 min. The supernatant was retained as the test sample.

[0061] 4.2 Determination of DPPH free radical scavenging rate Experimental group: Take 1 mL of the sample to be tested, add 1 mL of 0.2 mmol / L DPPH ethanol solution, and mix thoroughly; Blank group: Take 1 mL of the sample to be tested, add 1 mL of anhydrous ethanol solution, and mix thoroughly; Control group: Take 1 mL of distilled water, add 1 mL of 0.2 mmol / L DPPH ethanol solution, and mix thoroughly.

[0062] The experimental group, blank group and control group were protected from light for 30 min, and the absorbance at 517 nm was measured. The DPPH free radical scavenging rate was calculated according to the formula (2):

[0063] A s : absorbance value at 517 nm of the experimental group; Ab : The absorbance value of blank group at 517 nm; A c : The absorbance value of the control group at 517 nm.

[0064] It can be seen that the DPPH free radical scavenging rate of the fermentation supernatant of Lactobacillus plantarum BR32 is (90.40±0.60)%.

[0065] 4.3 Determination of OH radical scavenging rate Experimental group: 0.5 mL of 0.75 mmol / L O-phenanthroline, 0.5 mL of the sample to be tested, and 1 mL of sterile PBS buffer were added in sequence, mixed thoroughly, and then 5 mL of 0.75 mol / L FeSO4 and 0.5 mL of 0.01% H2O2 were added; Blank group: add 0.5 mL of 0.75 mmol / L O-phenanthroline, 0.5 mL of the sample to be tested, and 1 mL of sterile PBS buffer, mix thoroughly, and then add 5 mL of 0.75 mol / L FeSO4 and 0.5 mL of distilled water; Control group: 0.5 mL of 0.75 mmol / L O-phenanthroline, 0.5 mL of distilled water, and 1 mL of sterile PBS buffer were added in sequence, mixed thoroughly, and then 5 mL of 0.75 mol / L FeSO4 and 0.5 mL of 0.01% H2O2 were added.

[0066] The experimental group, blank group and control group were placed in a water bath at 37°C for 1 h, and the absorbance at 536 nm was measured. The OH radical scavenging rate was calculated according to the formula (3). The data are summarized in Table 3:

[0067] A 实验 : absorbance value at 536 nm of the experimental group; A 空白 : The absorbance value of blank group at 536 nm; A 对照 : The absorbance value of the control group at 536 nm.

[0068] Table 3 Results of OH radical scavenging rate determination of Lactobacillus plantarum BR32 fermentation supernatant

[0069] According to the data in Table 3, the OH radical scavenging rate of the fermentation supernatant of Lactobacillus plantarum BR32 is (74.34±0.63)%. Combined with the data of its DPPH radical scavenging rate (90.40±0.60)%, it is clear that the antioxidant capacity of the fermentation supernatant of Lactobacillus plantarum BR32 is very significant.

[0070] Example 5 Lysozyme tolerance test of Lactobacillus plantarum BR32 The oral cavity contains lysozyme at a concentration of 20-80 μg / mL. To ensure the survival of Lactobacillus plantarum BR32 in the oral cavity, its tolerance to lysozyme needs to be tested.

[0071] Lactobacillus plantarum BR32 was activated for 2 generations, and a single colony was picked and inoculated into MRS liquid medium. The culture was carried out at 37°C for 12 h, and the OD was adjusted. 600 to 0.6, and the tolerance of Lactobacillus plantarum BR32 to lysozyme was tested using the Oxford cup method. After pre-diffusion, it was transferred to an incubator and cultured at 37 °C for 12 h; Among them, the inoculation amount of Lactobacillus plantarum BR32 was 2% (v / v); the lysozyme concentrations were set to: 0 μg / mL, 0.2 μg / mL, 0.4 μg / mL, 0.6 μg / mL, 0.8 μg / mL, 1.0 μg / mL and 1.2 μg / mL; the amount of lysozyme solution added to the Oxford cup was 100 μL.

[0072] The tolerance of Lactobacillus plantarum BR32 to lysozyme can be judged by observing whether an antibacterial transparent zone is produced and the size of the antibacterial transparent zone. Figure 8 It can be seen that under the 7 concentrations of lysozyme, Lactobacillus plantarum BR32 did not produce an antibacterial transparent zone, indicating that Lactobacillus plantarum BR32 has a high tolerance to lysozyme and can survive in the lysozyme environment in the oral cavity.

[0073] Example 6 Determination of oral colonization ability of Lactobacillus plantarum BR32 The hydrophobicity and self-aggregation ability of Lactobacillus plantarum are considered to be important criteria for determining its ability to colonize in the oral cavity. The stronger the hydrophobicity and self-aggregation ability, the stronger its ability to colonize in the oral cavity.

[0074] 6.1 Hydrophobicity test Lactobacillus plantarum BR32 was activated for 2 generations and inoculated into 5 mL of MRS liquid medium at a 2% (v / v) inoculation volume. The culture was incubated at 37°C for 12 h, and the culture was centrifuged at 4°C and 10,000 rpm for 10 min. The supernatant was discarded and the bacteria were collected.

[0075] Wash the cells 2-3 times with sterile PBS buffer, and then resuspend the cells with sterile PBS buffer to adjust the concentration of the bacterial solution to 1×109 CFU / mL, and the absorbance at 600 nm was measured.

[0076] (1) Determination of the hydrophobicity of Lactobacillus plantarum BR32 to xylene Take 3 mL of bacterial suspension, add 1 mL of xylene as a hydrophobic organic solvent, place at room temperature for 10 min, shake and mix for 2 min, and then incubate at room temperature for 20 min. Measure the absorbance of the aqueous phase of the incubation solution at 600 nm.

[0077] (2) Determination of the hydrophobicity of Lactobacillus plantarum BR32 to chloroform Take 3 mL of bacterial suspension, add 1 mL of chloroform as a hydrophobic organic solvent, place at room temperature for 10 min, shake and mix for 2 min, and then incubate at room temperature for 20 min. Measure the absorbance of the aqueous phase of the incubation solution at 600 nm.

[0078] (3) Determination of the hydrophobicity of Lactobacillus plantarum BR32 to ethyl acetate Take 3 mL of bacterial suspension, add 1 mL of ethyl acetate as a hydrophobic organic solvent, place at room temperature for 10 min, shake and mix for 2 min, and then incubate at room temperature for 20 min. Measure the absorbance of the aqueous phase of the incubation solution at 600 nm.

[0079] The calculation was performed according to the cell surface hydrophobicity calculation formula (4), and the data were summarized in Table 4:

[0080] A 菌悬 : absorbance of bacterial suspension at 600 nm; A 孵育 : Absorbance of the aqueous phase of the incubation solution at 600 nm.

[0081] Table 4 Hydrophobicity test results of Lactobacillus plantarum BR32

[0082] According to the data in Table 4, the hydrophobicity of Lactobacillus plantarum BR32 to xylene is (22.24±0.01)%, to chloroform is (26.5±0.02)%, and to ethyl acetate is (35.96±0.01)%.

[0083] 6.2 Self-aggregation ability test Lactobacillus plantarum BR32 was activated for 2 generations, inoculated into MRS liquid medium, cultured at 37°C for 12 h, centrifuged at 12000 rpm for 10 min, the supernatant was discarded, and the cells were collected; Wash the cells twice with sterile PBS buffer, resuspend the cells with sterile PBS buffer, and adjust the OD of the bacterial suspension. 600 =0.6±0.05, and then incubate at room temperature; The OD values ​​at 0 h, 2 h, 4 h, 6 h, 8 h, and 24 h of incubation were measured. 600 .

[0084] The calculation is performed according to the self-aggregation capacity calculation formula (5), and the data are summarized in Table 5:

[0085] A0: OD at 0 h 600 ; A t : OD at different times 600 .

[0086] Table 5 Self-aggregation ability test results of Lactobacillus plantarum BR32

[0087] According to the data in Table 5, the self-aggregation ability of Lactobacillus plantarum BR32 was (35.35±0.06)% at 8 h, and reached (83.56±0.01)% at 24 h, indicating that Lactobacillus plantarum BR32 has a certain adhesion ability to host tissue cells.

[0088] Example 7 Study on the characteristics of Lactobacillus plantarum BR32 in eliminating biofilm formation of Streptococcus mutans 7.1 Preparation of fermentation broth and bacterial suspension The Lactobacillus plantarum BR32 was activated for 2 generations, inoculated into MRS liquid culture medium, and cultured at 37° C. for 12 h to obtain the fermentation liquid.

[0089] A portion of the fermentation broth was centrifuged at 8000 rpm for 10 min, the supernatant was discarded, the bacteria were collected, the bacteria were washed twice with a phosphate buffer having a pH value of 7.0, and then the bacteria were resuspended with a phosphate buffer having a pH value of 7.0 having the same volume as the fermentation broth to obtain the bacterial suspension.

[0090] 7.2 Determination of the clearance rate of Streptococcus mutans biofilm Add 600 μL of mutans Streptococcus liquid to each well of a 24-well plate and culture for 24 h to allow mutans Streptococcus to adhere to the cell slide to form a biofilm. Discard the culture medium in the well and wash twice with a phosphate buffer at pH 7.0. Experimental group I: 600 μL of Lactobacillus plantarum BR32 fermentation broth was added to the wells and co-cultured with the biofilm formed by Streptococcus mutans at 37°C for 24 h; Experimental group II: 600 μL of Lactobacillus plantarum BR32 suspension was added to the wells and co-cultured with the biofilm formed by Streptococcus mutans at 37°C for 24 h; Control group: 600 μL of MRS liquid culture medium was added to the wells and co-cultured with the biofilm formed by Streptococcus mutans at 37°C for 24 h; The liquid in the wells was discarded, and 600 μL of pH=7.0 phosphate buffer was added to wash three times to remove the non-adherent bacteria. The number of Streptococcus mutans on the cell slide was counted by live bacteria counting, and the biofilm removal rate was calculated according to the biofilm removal rate calculation formula (6). The data are summarized in Table 6:

[0091] Table 6 Results of the determination of the clearance rate of Streptococcus mutans biofilm by Lactobacillus plantarum BR32

[0092] According to the results in Table 6, no mutans Streptococcus was found in experimental group I, that is, the clearance rate of mutans Streptococcus by the fermentation broth of Lactobacillus plantarum BR32 reached 100%, indicating that the metabolites in the fermentation broth of this strain can effectively help to remove the mutans Streptococcus biofilm; while the clearance efficiency of the bacterial suspension in experimental group II for mutans Streptococcus was only 61.09%, indicating that there are binding sites for mutans Streptococcus on the cell membrane of Lactobacillus plantarum BR32 bacteria, and the simple bacteria themselves can also bind to mutans Streptococcus, and part of the biofilm can be removed in a short time.

[0093] Example 8 Determination of antibacterial substances of Lactobacillus plantarum BR32 Lactobacillus plantarum BR32 was activated for 2 generations, inoculated into MRS liquid culture medium, cultured at 37°C for 12 h, centrifuged at 8000 rpm for 5 min, the supernatant was aspirated, the pH value of the supernatant was adjusted to 7.0 with 1 mmol / L NaOH solution, and the diameter of the inhibition zone against Streptococcus mutans was measured; if the diameter of the inhibition zone was significantly reduced or no inhibition zone was produced, the antibacterial substance was an organic acid.

[0094] Add catalase to the supernatant adjusted to pH 7.0 and adjust the mass concentration to 0.5 mg / mL. Incubate at 37°C for 1 h, and then measure the diameter of the inhibition zone against Streptococcus mutans. If the diameter of the inhibition zone is significantly reduced or no inhibition zone is produced, the antibacterial substance is H2O2. If an inhibition zone still appears, the antibacterial substance is bacteriocin.

[0095] When the pH value of the fermentation supernatant was adjusted to 7.0, no inhibition zone was produced for Streptococcus mutans, indicating that the substance that inhibited the growth of Streptococcus mutans by Lactobacillus plantarum BR32 was mainly organic acid.

[0096] Example 9 Simulation study on the effect of Lactobacillus plantarum BR32 on tooth environmental corrosion Hydroxyapatite was used to simulate the tooth environment, and the corrosiveness of lactic acid bacteria metabolites on teeth was investigated by acid-molybdate spectrophotometry to explore the safety of Lactobacillus plantarum BR32 on teeth.

[0097] Drawing of standard curve: add 5 mL of phosphorus standard solution with concentration of 0 mg / L, 5 mg / L, 10 mg / L, 15 mg / L, 20 mg / L, 25 mg / L to the bottles respectively, then add 25 mL of water, 2.0 mL of ammonium molybdate solution, 3.0 mL of ascorbic acid solution to each bottle in turn, dilute to the scale with water, shake well, place at room temperature for 10 min, and measure the absorbance at 710 nm; use the measured absorbance as the ordinate and the corresponding phosphorus content as the abscissa to draw the standard curve of phosphorus element as shown below: Fig. 9 shown.

[0098] Experimental group: 10 mL of the supernatant of Lactobacillus plantarum BR32 fermented for 24 h was mixed with 0.01 g of hydroxyapatite, stirred evenly and incubated together; Control group: 10 mL of the fermentation supernatant of Streptococcus mutans was mixed with 0.01 g of hydroxyapatite, stirred evenly and incubated together.

[0099] Take equal amounts of incubation solution at 1 h, 2 h, 3 h, and 4 h, centrifuge at 4 °C and 4700 rpm for 10 min; take 5 mL of supernatant into a 100 mL conical flask, add 1 mL of sulfuric acid solution and 5 mL of potassium persulfate solution, adjust the volume of the solution in the conical flask to 50 mL with water, place it on an adjustable electric stove and slowly boil it for 15 min until the solution is almost evaporated; take it out, cool it to room temperature with running water, transfer it quantitatively to a 50 mL colorimetric tube, add 2 mL of ammonium molybdate solution and 3 mL of ascorbic acid solution, dilute it to the scale with water, shake it well, place it at room temperature for 10 min, and measure the absorbance at 710 nm; substitute the absorbance value into the standard curve to get the corresponding phosphorus content, and the data are summarized in Table 7.

[0100] Table 7 Phosphorus content released by fermentation supernatant at different times in hydroxyapatite

[0101] According to the data in Table 7, the phosphorus content released by the fermentation supernatant of Lactobacillus plantarum BR32 in treating hydroxyapatite is lower than that in the positive control group; in addition, the phosphorus content of the fermentation supernatant of Lactobacillus plantarum BR32 has reached the maximum value of 0.985 μg / mL at 2 h after treating hydroxyapatite, while the phosphorus content in the fermentation supernatant of Streptococcus mutans still has an upward trend after 4 h of treatment, and compared with Streptococcus mutans, the fermentation supernatant of Lactobacillus plantarum BR32 can reduce the phosphorus mass concentration by 6.69 μg / mL, which indicates that Lactobacillus plantarum BR32 is significantly less corrosive to teeth than Streptococcus mutans.

[0102] Example 10 Study on the effect of Lactobacillus plantarum BR32 on Candida albicans Candida albicans is one of the common microorganisms in the oral cavity. When it overproduces, it can cause oral problems such as angular cheilitis, oral ulcers, and thrush.

[0103] In this embodiment, the effect of Lactobacillus plantarum BR32 on Candida albicans was explored by the Oxford cup double-layer plate method. If a transparent circle was formed in the upper culture medium, the surface Lactobacillus plantarum BR32 could inhibit the growth of Candida albicans; wherein the lower plate of the double-layer plate was an MRS solid culture medium, and the upper plate was a 75% PDA culture medium; the specific experimental steps were as follows: Lactobacillus plantarum BR32 was inoculated into MRS liquid medium for activation and cultured at 37°C for 12 h to activate the first generation strain. The bacterial liquid was transferred to MRS liquid medium at a 2% inoculation rate and cultured at 37°C for 24 h to activate the second generation strain.

[0104] Inoculate 2% (v / v) of Candida albicans grown to the logarithmic phase into 75% PDA medium and mix well; The bottom layer of the culture medium is 10 mL of MRS solid culture medium. After the culture medium solidifies, place an Oxford cup on each MRS solid culture medium plate and press gently to make the Oxford cup and the culture medium fit completely. Continue to pour 7 mL of 75% PDA culture medium into the culture medium. After solidification, add 200 μL of lactic acid bacteria fermentation liquid to the Oxford cup and culture it upright at 37°C for 12 h.

[0105] If a transparent zone is formed on the upper culture medium of the corresponding strain, it indicates that the strain can inhibit the growth of Candida albicans.

[0106] Experimental results reference Fig.10 As shown, a transparent zone was formed in the upper culture medium of the double-layer plate, and the diameter of the inhibition zone was 17.82 mm, indicating that Lactobacillus plantarum BR32 could inhibit the growth of Candida albicans.

[0107] Example 11 Study on the effect of Lactobacillus plantarum BR32 on Porphyromonas gingivalis Porphyromonas gingivalis is one of the main pathogens of periodontal disease. When it reproduces excessively, it can cause symptoms such as redness, swelling, bleeding, and atrophy of the gums.

[0108] In this example, the inhibitory effect of Lactobacillus plantarum BR32 on Porphyromonas gingivalis was investigated by counting viable bacteria. The specific experimental steps are as follows: Experimental group: Lactobacillus plantarum BR32 was inoculated into MRS liquid culture medium and cultured for 12 h. The fermentation broth was centrifuged at 8000 rpm for 10 min. The supernatant was added to Porphyromonas gingivalis liquid culture medium at a ratio of 30% and cultured at 37°C for 12 h. The number of viable Porphyromonas gingivalis was recorded as A. Blank group: MRS liquid culture medium was added to Porphyromonas gingivalis liquid culture medium at a ratio of 30%, and cultured at 37°C for 12 h. The number of viable Porphyromonas gingivalis was tested and recorded as B.

[0109] The number of viable Porphyromonas gingivalis bacteria was determined and calculated according to the Porphyromonas gingivalis inhibition rate calculation formula (7). The data are summarized in Table 8:

[0110] Table 8 Experimental results on the effect of Lactobacillus plantarum BR32 on Porphyromonas gingivalis

[0111] According to the results in Table 8, there was no proliferation of Porphyromonas gingivalis in the experimental group, and the inhibition rate of Lactobacillus plantarum BR32 on Porphyromonas gingivalis was 100%, indicating that the fermentation supernatant of Lactobacillus plantarum BR32 has excellent ability to inhibit the growth of Porphyromonas gingivalis.

[0112] Example 12 Lactobacillus plantarum BR32 bacterial agent The present invention provides a Lactobacillus plantarum BR32 bacterial agent, which is prepared according to the following steps: Lactobacillus plantarum BR32 was activated and inoculated at a 3% (v / v) inoculum into MRS liquid culture medium sterilized at 121°C for 15 min. 12% skim milk, 2.0% glucose, 1.5% peptone, 0.6% yeast extract and the remainder water were added to the total mass of the culture medium to adjust the pH to 6.8.

[0113] The cells were cultured at 37°C for 48 h, centrifuged at 4°C and 6000 rpm for 20 min, the supernatant was discarded, and phosphate buffer (pH = 7.2) was added to wash 2 to 4 times to obtain bacterial sludge.

[0114] The bacterial mud and the protective agent are mixed and emulsified in a mass ratio of 1:1; wherein the protective agent includes 150 g / L crystalline trehalose, 40 mL / L glycerol, 30 g / L isomaltooligosaccharide, 25 g / L fructooligosaccharide and 10 g / L sodium L-glutamate.

[0115] The emulsion was pre-frozen at -40°C for 2 h and then freeze-dried. After freeze-drying, the bacterial survival rate of Lactobacillus plantarum BR32 was calculated according to the bacterial survival rate formula (8).

[0116]

[0117] N: number of viable bacteria after reconstitution of freeze-dried bacterial powder, CFU / mL; N0: number of viable bacteria in the emulsion before freeze-drying, CFU / mL.

[0118] It can be calculated that the survival rate of the Lactobacillus plantarum BR32 provided by the present invention after freeze-drying is 85.7%, and the activity retention degree of the strain is excellent.

[0119] Example 13 Lactobacillus plantarum BR32 probiotic product The present invention provides a probiotic product of Lactobacillus plantarum BR32, which is any one of oral popping beads, oral lozenges, tooth powder, chewing candy, etc., and its components include Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation and ingredients; Among them, the ingredients can be any one of prebiotics, fillers, acidulants, solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, adhesives, disintegrants, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesive agents, integrators, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, defoamers, thickeners, inclusion agents, humectants, absorbents, diluents, flocculants, deflocculating agents and filter aids, or any combination of any two or more of them.

[0120] 13.1 Lactobacillus plantarum BR32 Oral Microbubble Tablets In this embodiment, a Lactobacillus plantarum BR32 oral microvesicle tablet is provided, which is prepared according to the following steps: Preparation of active bacterial powder: activating Lactobacillus plantarum BR32, which has the function of preventing dental caries and improving inflammation, and then culturing it in MRS liquid medium, collecting and washing the bacterial cells, adding auxiliary materials, and drying to obtain active bacterial powder; Take 20 parts of active bacterial powder, 60 parts of maltitol, 15 parts of sodium bicarbonate, 3 parts of ascorbic acid, and 2 parts of magnesium stearate by weight, mix them evenly, and package them to obtain Lactobacillus plantarum BR32 oral microbubble tablets; wherein the number of live bacteria of Lactobacillus plantarum BR32 is not less than 1×10 11 CFU / g.

[0121] 13.2 Lactobacillus plantarum BR32 probiotics bursting beads In this embodiment, a probiotic Lactobacillus plantarum BR32 popping beads are also provided, which are prepared according to the following steps: Preparation of active bacterial powder: activating Lactobacillus plantarum BR32, which has the function of preventing dental caries and improving inflammation, and then culturing it in MRS liquid medium, collecting and washing the bacterial cells, adding auxiliary materials, and drying to obtain active bacterial powder; Take 30% active bacteria powder, 2% sodium alginate, 50% watermelon juice, 10% warm water, and 8% calcium lactate by mass fraction, mix them evenly, and package them to obtain Lactobacillus plantarum BR32 probiotic bursting beads; Wherein, the viable count of Lactobacillus plantarum BR32 is not less than 1×10 10 CFU / mL.

[0122] It should be noted that the above concept is to mix active bacterial powder of Lactobacillus plantarum BR32 with the function of preventing tooth decay and improving inflammation or other forms of Lactobacillus plantarum BR32 with the function of preventing tooth decay and improving inflammation with other ingredients to prepare a probiotic product, and the selection and ratio of the ingredients can be adaptively adjusted, including but not limited to maltodextrin, fructooligosaccharides, galacto-oligosaccharides, etc. in the embodiment scheme.

[0123] Example 14 Lactobacillus plantarum BR32 fermentation product The present invention provides a Lactobacillus plantarum BR32 fermentation product, which is prepared according to the following steps: Preparation of active bacterial powder: activating Lactobacillus plantarum BR32, which has the function of preventing dental caries and improving inflammation, and then culturing it in MRS liquid medium, collecting and washing the bacterial cells, adding auxiliary materials, and drying to obtain active bacterial powder; Weigh 2 kg of water and 0.6 kg of concentrated watermelon juice, mix thoroughly, and obtain a fermentation culture medium; Weigh 50 g of active bacterial powder, inoculate it into the fermentation culture solution, ferment at 32° C. for 48 h, and control the pH at the fermentation end point to be 3.6, thereby obtaining a Lactobacillus plantarum BR32 fermentation product; Wherein, the viable count of Lactobacillus plantarum BR32 is ≥ 1×10 11 CFU / g or 1×10 10 CFU / mL.

[0124] It should be noted that the above concept is to add active bacterial powder of Lactobacillus plantarum BR32 with the function of preventing tooth decay and improving inflammation or other forms of Lactobacillus plantarum BR32 with the function of preventing tooth decay and improving inflammation to the fermentation system to obtain a fermented product. The selection and ratio of the various components of the fermentation culture medium in the fermentation system can be adaptively adjusted, including but not limited to the concentrated watermelon juice in the embodiment scheme.

[0125] Example 15 Antibacterial Agent The present invention provides an antibacterial agent, the components of which include active bacterial powder of Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation and / or fermentation liquid of Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation; The active bacterial powder of Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation is vacuum freeze-dried bacterial powder and / or spray-dried bacterial powder, and the number of viable bacteria is ≥ 1×10 11 CFU / g; The Lactobacillus plantarum BR32 fermentation liquid with the functions of preventing dental caries and improving inflammation comprises any one of fermentation supernatant, cell-free extract and bacterial cell metabolites or a combination of any two or more thereof.

[0126] Example 16 Lactobacillus plantarum BR32 oral product The present invention provides a Lactobacillus plantarum BR32 oral product, which is any one of oral lozenges, oral popping beads, chewing gum and antibacterial toothpaste, and its components include Lactobacillus plantarum BR32 with the functions of preventing dental caries and improving inflammation and ingredients; In this embodiment, a Lactobacillus plantarum BR32 oral lozenge is provided, which is prepared according to the following steps: Preparation of active bacterial powder: activating Lactobacillus plantarum BR32, which has the function of preventing dental caries and improving inflammation, and then culturing it in MRS liquid medium, collecting and washing the bacterial cells, adding auxiliary materials, and drying to obtain active bacterial powder; Take 5 parts of active bacteria powder, 60 parts of sorbitol, 12 parts of whole milk powder, 8 parts of fermented kiwi powder, 2 parts of isomaltooligosaccharide, 2 parts of magnesium stearate, 0.5 parts of vitamin C, 2 parts of galacto-oligosaccharide, 2 parts of fructo-oligosaccharide, and 2 parts of oligo-glucose by weight, mix well to obtain pre-made powder; The prefabricated powder is tableted and packaged using a tableting device to obtain Lactobacillus plantarum BR32 oral tablets, wherein the number of viable bacteria of Lactobacillus plantarum BR32 is not less than 1×10 11 CFU / g.

[0127] The plant lactobacillus BR32 with caries prevention and inflammation improvement functions provided by the present invention is separated and screened from kimchi samples in Zhao'an County, Zhangzhou City, Fujian Province. No hemolysis occurs in in vitro hemolysis culture, the bacteria is sensitive to common antibiotics, has high food safety, has strong inhibition and mitigation capabilities on the growth of Streptococcus mutans and the formation of its biofilm, and also has an inhibitory effect on the growth of oral inflammation pathogens Candida albicans and Porphyromonas gingivalis. The bacteria has high hydrophobicity and self-aggregation ability, low corrosiveness to the tooth environment, high tolerance to lysozyme, good oral colonization ability, and a very high free radical scavenging rate. The fermentation supernatant has a scavenging rate of (90.40±0.60)% for DPPH free radicals and a scavenging rate of (74.34±0.63)% for OH free radicals. The bacteria has a high antioxidant capacity and is beneficial for maintaining oral health after antibacterial treatment.

[0128] The plant lactobacillus BR32 with the function of preventing caries and improving inflammation provided by the present invention can be used as a raw material component of probiotic products, functional foods and fermented products, but its efficacy includes but is not limited to inhibiting oral pathogens, preventing caries, improving inflammation, preventing dental plaque, improving oral ulcers and preventing angular cheilitis, etc., all of which can play a beneficial role in the human body. Among them, the product form includes solid preparations such as powders and tablets, or preparations suitable for oral administration by humans such as liquid preparations.

[0129] It should be noted that, although the term "functional food" is used more frequently in this article, the term "food" is broad, including human food and drink. In certain embodiments, the food product is suitable for and designed for human consumption. The use of these terms is only for the purpose of more conveniently describing and explaining the essence of the present invention, and does not exclude the possibility of using other terms; interpreting them as any additional limitation is contrary to the spirit of the present invention.

[0130] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A plant lactobacillus with the function of preventing dental caries and improving inflammation ( Lactiplantibacillus plantarum ) BR32, characterized by: The deposit number is CGMCC No.32836.

2. A plant lactobacillus BR32 bacterial agent, characterized in that: The components thereof include the Lactobacillus plantarum BR32 having the functions of preventing dental caries and improving inflammation as claimed in claim 1.

3. The plant lactobacillus BR32 agent according to claim 2, characterized in that: The number of viable bacteria of Lactobacillus plantarum BR32 is ≥1×10 11 CFU / g or ≥1×10 10 CFU / mL.

4. A probiotic product of Lactobacillus plantarum BR32, characterized in that: The components thereof include the Lactobacillus plantarum BR32 having the functions of preventing dental caries and improving inflammation as claimed in claim 1.

5. A functional food of Lactobacillus plantarum BR32, characterized in that: The components thereof include the Lactobacillus plantarum BR32 having the functions of preventing dental caries and improving inflammation as claimed in claim 1.

6. The functional food of Lactobacillus plantarum BR32 according to claim 5, characterized in that: The functional food includes any one of functional foods for preventing caries, functional foods for improving periodontal inflammation, functional foods for preventing angular cheilitis, functional foods for improving oral ulcers, functional foods for inhibiting oral pathogens, functional foods for preventing dental plaque, antioxidant functional foods and antibiotic-sensitive functional foods, or a combination of any two or more thereof.

7. A Lactobacillus plantarum BR32 fermentation product, characterized in that: The components thereof include the Lactobacillus plantarum BR32 having the functions of preventing dental caries and improving inflammation as claimed in claim 1.

8. An antibacterial agent, characterized in that: The components thereof include the Lactobacillus plantarum BR32 having the functions of preventing dental caries and improving inflammation as claimed in claim 1.

9. An oral product, characterized in that: The components thereof include the Lactobacillus plantarum BR32 having the functions of preventing dental caries and improving inflammation as claimed in claim 1.

10. The oral product according to claim 9, characterized in that: The dental caries prevention product includes any one of oral lozenges, oral popping beads, chewing gum and antibacterial toothpaste.

Images