Construction and application of engineering lactic acid bacteria for producing alpha-arbutin by microbial fermentation method

Abstract

The invention discloses a recombinant lactococcus lactis strain for producing alpha-arbutin as well as a construction method and application of the recombinant lactococcus lactis strain. The recombinant strain is obtained by transforming a food-grade plasmid pNZ8149 into a double-expression cassette plasmid pNZDual-MSUA and transforming the double-expression cassette plasmid pNZDual-MSUA into lactococcus lactis. Wherein a first expression cassette of the pNZDual-MSUA plasmid expresses an assumed protein gene MNX1 from Candida paraapsilosis and a sucrose phosphatase gene Smut336, and a second expression cassette expresses a sucrose phosphatase gene Smut336 from Candida paraapsilosis; and a chorismate lyase gene ubiC and a 3-deoxy-arabinoheptulose-7-phosphate synthetase gene aroF are expressed in a second expression cassette of the gene. Experiments prove that the alpha-arbutin can be synthesized and produced from de novo only by adding substrate sucrose into the lactococcus lactis with the pNZDual-MSUA plasmid for microbial fermentation culture, and the recombinant lactococcus lactis has wide application potential in the fields of cosmetics and biological medicine development.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the construction and application of engineering lactic acid bacteria for producing alpha-arbutin by microbial fermentation. Background Art

[0002] Arbutin is a glycoside compound derived from hydroquinone. It is divided into α-arbutin and β-arbutin according to the different configurations of the glycosidic bond. Due to its strong inhibitory effect on tyrosinase activity, it is widely used as a skin whitening agent in the beauty industry. α-arbutin is similar to β-arbutin and can inhibit the production and deposition of melanin, remove spots and freckles. Studies have shown that α-arbutin can inhibit the activity of tyrosinase at a relatively low concentration, and its inhibitory effect on tyrosinase is better than that of β-arbutin.

[0003] At present, the research direction of biosynthesis of α-arbutin mainly adopts enzymatic method or whole-cell catalytic method. Both methods require the addition of a large amount of substrate hydroquinone and sugar to produce α-arbutin. Both microbial fermentation and whole-cell catalytic biosynthesis rely on intact cells as biocatalysts, but the difference is that microbial fermentation is to produce the target product by using metabolic reactions in the cell body while culturing living cells for growth and reproduction. It does not require the cells to be centrifuged, washed, resuspended, etc., but the catalytic reaction is completed directly during the fermentation process. In the prior art, microbial fermentation can be divided into exogenous addition of HQ to synthesize α-arbutin and de novo synthesis of β-arbutin. Microbial fermentation has low cost, simple production process, and is conducive to expanded culture. It has greater industrialization potential, but there is no related report on the de novo synthesis of α-arbutin using microbial fermentation.

[0004] This study is the first to use microbial fermentation to synthesize α-arbutin from scratch in lactic acid bacteria, using food-grade strains, plasmids and inducers. It has industrial significance and a very promising development prospect. Summary of the invention

[0005] In view of the above technical defects or improvement needs of the prior art, the present invention provides an engineered lactic acid bacteria for producing α-arbutin, and also provides a construction method of the recombinant lactic acid bacteria and an application of producing α-arbutin by microbial fermentation.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The invention discloses an engineered lactic acid bacterium for producing alpha-arbutin by a microbial fermentation method. The engineered lactic acid bacterium is constructed by introducing a pNZDual-MSUA plasmid into Lactococcus lactis, wherein the Lactococcus lactis is Lactococcus lactis NZ3900; the pNZDual-MSUA plasmid comprises two expression frames, wherein the first expression frame expresses a hypothetical protein gene MNX1 derived from Candidaparapsilosis and a sucrose phosphatase gene Smut336 derived from Streptococcus mutans serotype, and the second expression frame expresses a chorismate lyase gene ubiC and a 3-deoxy-arabinoheptulose-7-phosphate synthase gene aroF; the nucleotide sequences of ubiC, aroF, MNX1 and Smut336 are represented by MSUA, and the nucleotide sequences thereof are shown in SEQ ID No: 1; the genotype of the obtained recombinant Lactococcus lactis for producing alpha-arbutin is NZ3900 / pNZDual-MSUA.

[0008] SEQ ID No: 1

[0009]

[0010] As a preferred technical solution of the present invention, the pNZDual-MSUA plasmid is a transformation of the pNZ8149 plasmid, has two expression cassettes, and both expression cassettes are driven by the PnisA promoter.

[0011] As a preferred technical solution of the present invention, the pNZDual-MSUA plasmid comprises an exogenous expression element MSUA, and MSUA comprises a chorismate lyase gene ubiC from Escherichia coli BL21 (DE3), a 3-deoxy-arabinoheptulose-7-phosphate synthase gene aroF from Lactococcus lactis NZ3900, a hypothetical protein gene MNX1 from Candida parapsilosis, and a sucrose phosphatase gene Smut336 from Streptococcus mutans serotype.

[0012] As a preferred technical solution of the present invention, the pNZDual-MSUA plasmid, the plasmid vector skeleton comprises the PnisA promoter, the lacF protein gene, and the replication initiation proteins RepA and RepC.

[0013] As a preferred technical solution of the present invention, the construction of the NZ3900 / pNZDual-MSUA strain comprises the following steps:

[0014] (1) Clone the hypothetical protein gene MNX1 from Candida parapsilosis and the sucrose phosphatase gene Smut336 from Streptococcus mutans serotype;

[0015] (2) cloning the chorismate lyase gene ubiC from Escherichia coli BL21 (DE3) and the 3-deoxy-arabinoheptulose-7-phosphate synthase gene aroF from Lactococcus lactis NZ3900;

[0016] (3) connecting the obtained nucleotide sequences of ubiC, aroF, MNX1 and Smut336 to a plasmid vector to obtain a recombinant plasmid;

[0017] (4) Introducing the recombinant plasmid obtained in step (3) into the Lactococcus lactis NZ3900 strain to obtain a recombinant strain that produces α-arbutin.

[0018] As a preferred technical solution of the present invention, the application of the engineered lactic acid bacteria for producing α-arbutin by microbial fermentation is: de novo synthesis and production of α-arbutin by microbial fermentation.

[0019] As a preferred technical solution of the present invention, the method and conditions for producing α-arbutin from scratch by microbial fermentation are as follows: the seed liquid of the recombinant strain is transferred to the LLB medium at a ratio of 3% by volume and fermented under the following conditions: 30°C, static culture until OD600=0.35-0.45, and nisin with a final concentration of 10 ng / mL is added; after continuing static induction culture for 1 hour, substrate sucrose and auxiliary material ATP are added, and the fermentation conditions are switched to control pH=7.0 and shake culture at 100-120 rpm. After culturing for 16 hours, a fermentation product containing α-arbutin is produced.

[0020] As a preferred technical solution of the present invention, the LLB culture medium formula is: 1% peptone, 1% yeast powder, 1% soy peptone, 1% lactose, and the balance is deionized water.

[0021] Beneficial effects of the present invention:

[0022] (1) The present invention uses food-grade strains, plasmids and inducers, has no special requirements for fermentation equipment, and can be widely used in the field of green fermentation production.

[0023] (2) The plasmid pNZDual-MSUA constructed by the present invention can effectively express four foreign gene proteins.

[0024] (3) The strain NZ3900 / pNZDual-MSUA constructed in the present invention does not use antibiotics as screening markers, and the recombinant strain is screened in a culture medium supplemented with lactose.

[0025] (4) The recombinant strain constructed by the present invention can use sucrose as a substrate to synthesize and produce α-arbutin from scratch through a microbial fermentation method.

[0026] (5) The recombinant lactic acid bacteria constructed by the present invention can successfully express the final product α-arbutin, and the intermediate product accumulation in the synthesis process is relatively small. After the product is synthesized, it only needs to be simply removed from the intermediate product before use. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to facilitate understanding by those skilled in the art, the present invention is further described below with reference to the accompanying drawings.

[0028] Figure 1 Schematic diagram for the construction of pNZDual-MSUA plasmid;

[0029] Figure 2 This is the SDS-PAGE protein electrophoresis diagram of MSUA protein expression;

[0030] Figure 3 This is a liquid chromatography detection chart of α-arbutin produced by recombinant Lactococcus lactis. DETAILED DESCRIPTION

[0031] In order to further explain the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the specific implementation methods, structures, features and effects of the present invention are described in detail below in conjunction with the accompanying drawings and preferred embodiments.

[0032] Example 1

[0033] The invention discloses an engineered lactic acid bacterium for producing alpha-arbutin by a microbial fermentation method. The engineered lactic acid bacterium is constructed by introducing a pNZDual-MSUA plasmid into Lactococcus lactis, wherein the Lactococcus lactis is Lactococcus lactis NZ3900; the pNZDual-MSUA plasmid comprises two expression frames, wherein the first expression frame expresses a hypothetical protein gene MNX1 derived from Candidaparapsilosis and a sucrose phosphatase gene Smut336 derived from Streptococcus mutans serotype, and the second expression frame expresses a chorismate lyase gene ubiC and a 3-deoxy-arabinoheptulose-7-phosphate synthase gene aroF; the nucleotide sequences of ubiC, aroF, MNX1 and Smut336 are represented by MSUA, and the nucleotide sequences thereof are shown in SEQ ID No: 1; the genotype of the obtained recombinant Lactococcus lactis for producing alpha-arbutin is NZ3900 / pNZDual-MSUA.

[0034] SEQ ID No: 1

[0035] ATGGCTGTTCAAGCTCCATCAAAAACATATGGTTTTCAAAAAGCTCC

[0036] AATTCAATTGACATTTGTTGTTGTAGGTGCTGGACTTGGAGGAGTTG

[0037] CTGCTTCAATTTGTTTAAGACTTGCTGGTCATCGTGTTATTTTATTAG

[0038] AAGCAGCAACTGAATTAGGAGAAGTAGGAGCAGGAATTCAAATTCC

[0039] TCCACCATCAACTAAAATTTTAAAAGCTATTGGAGTTCTTGATGCTG

[0040] TTGATAAAGTTTCAATTCATCCACATGATATTTTAGTTAAAAAATAT

[0041] AAAGGTGAATTATTATCAACACAAAATTTAGTTCCATATGTTTCTGA

[0042] AAAATATGATGGAATGTATTTACATATTCATCGTGCAGATTATCATA

[0043] AAGTTTTAGTTGATAGAGCTGAAGAATTAGGAGTTGAAATTCATACT

[0044] AATAGTAGAGTTGTTGATATTGATTTTGAAAAAGCTACTGTCACAAC

[0045] TGCAACAGGAAAACAATATTCAGGTGATGTTATTGTTGGATATGAT

[0046] GGAGTTCGTTCACAAACAAGAGCTCTTTTGACTGGAGATTCAAGTG

[0047] GTGCTTATGATACTGGTGATTTAGCATATAGAGCTTTAATTAAAGTT

[0048] GAAGAATATGAAAAAAGTTCCTGGTCTTGAAAAATTTTATGCAAATC

[0049] CTAATATTAATTTTTGGTGGGGTCCTACAATGCATATTGTAATGTAT

[0050] TTTCTTCATGAAGGAGAAATTTGTAATGTTGTTGCTCTTTGTCCCTGAT

[0051] ACATTGCCTAAAGGAGTTTTAAAACAAGATGCTTCTCAAGAAGAAT

[0052] TACTTGATTTAGTTAAAGGTTGGGATCAAGATTTAACAACAGTTTTT

[0053] AAATTAATTACTTCTGTTTCAAAATGGCGATTACAAGATTCAAGAGA

[0054] ATTGAAACATGGGTAAATTCTAAAACAGGTAATTTTATTATTTTAG

[0055] GAGATGCTTCACATTCAACATTGCCATATTTAGCTAGTGGTGCTAGT

[0056] CAAGCTGTTGAAGATGGAGCAGTTTTAGCTGGTTTTATTTAGTAAAAT

[0057] TGAATCTCGTGATCAAATTCCACAATTGCTTCAAATGACAGAAAATT

[0058] TACGTAAATGGCGTTCTTCACAAGTTGTTCGTGGATCACATCAATGT

[0059] CAAGATATTTATCATCTTCCAGATGGTGAATTACAAGAAATTCGTGA

[0060] TAGTTATCTTTATGATAAACAACCAGAATTAGGATGTCCAAATCGTT

[0061] TTGCTGATCCAGTTTTTCAAGACTTTTTATGGGGATATAATGCTTTTG

[0062] ATGAAGTTGAACGTGCTTGGAAAGAATTTAAAGCTGGAGGAAATCC

[0063] AACTTATACATATCCTAATTTATATAAACCTAAATCATCTGGTGAAA

[0064] AAGATGTTTCAGGTGGAGGAGCTGCTGCAACATTAGCTGCAGGTAA

[0065] TACACCAGCTGCTCCATTAAGTGCTAGTGGATAATAAAAAAGGGAGG

[0066] CCAAATATAATGCCAATTATTAATAAAAACAATGTTAATTACATATGC

[0067] TGATTCATTAGGTAAAAATTTAAAAGAATTAAATGAAAATATTGAA

[0068] AATTATTTTGGTGATGCTGTAGGTGGAGTTCATTTATTACCATTTTTC

[0069] CCATCAACTGGAGATAGAGGATTTGCTCCTATTGATTATCATGAAGT

[0070] TGATTCAGCTTTTGGAGATTGGGATGATGTTAAATGTCTTGGTGAAA

[0071] AATATTATTTAATGTTTGATTTTATGATTAATCATATTTCTAGACAAT

[0072] CTAAATATTATAAAGATTATCAAGAAAAACATGAAGCATCAGCTTA

[0073] TAAAGATTTATTTTTAAATTGGGATAAATTTTGGCCTAAAAATAGAC

[0074] CAACACAAGAAGATGTTGATCTTATTTATAAACGTAAAGATAGAGC

[0075] TCCTAAACAAGAAATTCAATTTGCTGATGGTTCAGTTGAACATTTAT

[0076] GGAATACATTTGGTGAAGAACAAATTGATTTAGATGTAACTAAAGA

[0077] AGTTACAATGGATTTTATTAGATCAACAATTGAAAATTTAGCAGCAA

[0078] ATGGATGTGATTTGATTAGATTAGATGCATTTGCTTATGCAGTTAAA

[0079] AAATTAGATACTAATGACTTTTTCGTTGAACCTGAAATTTGGACATT

[0080] ATTAGATAAAGTTCGTGATATTGCTGCAGTTTTCAGGAGCAGAAATTT

[0081] TACCAGAAATTCATGAACACTATACTATTCAATTTAAAATTGCAGAT

[0082] CATGACTATTATGTTTATGATTTTGCATTGCCAATGGTTACTTTATAC

[0083] TCATTATATTCATCTAAAGTTGATCGTTTGGCTAAATGGCTTAAAAT

[0084] GTCACCAATGAAACAATTTACAACTCTTGATACACATGATGGAATTG

[0085] GAGTAGTTGATGTTAAAGATATTTTTAACTGATGAAGAAATTACATAT

[0086] ACATCAAATGAATTATATAAAGTAGGTGCTAATGTTAATCGTAAAT

[0087] ATTCAACTGCAGAATATAATAATTTAGATTTGTATCAAATTAATAGT

[0088] ACATATTATTCAGCATTAGGAGATGATGATCCAAAAAATTTTCTAGC

[0089] TAGATTAATCCAAGCATTTGCTCCTGGAATTCCTCAAGTTTATTATG

[0090] TTGGTTTTCTTGCTGGTAAAAAATGATCTTGAATTATTAGAATCTACT

[0091] AAAGAAGGACGTAATATTAATCGTCATTATTATTCATCAGAAGAAA

[0092] TTGCTAAAGAAGTTAAACGTCCAGTTGTTAAAAGCTTTATTGAATTTA

[0093] TTTACATATCGTAATCAATCAGCAGCTTTTGATTTAGATGGACGTAT

[0094] TGAAGTTGAAACACCAAATGAAGCTACAATTGTAATTGAACGTCAA

[0095] AATAAAGATGGTAGTCATATAGCTAAAGCTGAAATTAATCTTCAAG

[0096] ATATGACATATAGAGTTACTGAAAATGATCAAACAATTTCATTGAA

[0097] TAAATAATGCCGACTGTACTTTTTACAGTCGGTTTTCTAATGTCACT

[0098] AACCTGCCCCGTTAGTTGAAGAGGTTTTTATATTACAGCTCCAGAT

[0099] CTAGTCTTATAACTATACTGACAATAGAAACATTAACAAATCTAAA

[0100] ACAGTCTTAATTCTATCTTGAGAAAGTATTGGTAATAATATTATTGT

[0101] CGATAACGCGAGCATAATAAACGGCTCTGATTAAATTCTGAAGTT

[0102] GTTAGATACAATGATTTCGTTCGAAGGAACTACAAAATAAATTATA

[0103] AGGAGGCACTCACCATGTCACACCCGCGTTAACGCAACTGCGTGC

[0104] GCTGCGCTATTTTAAAGAGATCCCTGCCCTGGATCCGCAACTGCTCG

[0105] ACTGGCTGTTGCTGGAGGATTCCATGACAAAACGTTTTGAACAGCA

[0106] GGGAAAACGGTAAGCGTGACGATGATCCGCGAAGGGTTGTCGAG

[0107] CAGAATGAAATCCCCGAAGAACTGCCGCTGCTGCCGAAAAGAGTCTC

[0108] GTTACTGGTTACGTGAAATTTTGTTATGTGCCGATGGTGAACCGTGG

[0109] CTTGCCGGTCGTACCGTCGTTCCTGTGTCAACGTTAAGCGGGCCGGA

[0110] GCTGGCGTTACAAAAATTGGGTAAAACGCCGTTAGGACGCTATCTG

[0111] TTCACATCATCGACATTAACCCGGGACTTTATTGAGATAGGCCGTGA

[0112] TGCCGGGCTGTGGGGGCGACGTTCCCGCCTGCGATTAAGCGGTAAA

[0113] CCGCTGTTGCTAACAGAACTGTTTTTACCGGCGTCACCGTTGTACTA

[0114] ATAAAAAGGGAGGCCAAATATAATGACTTTTAAAGAAATAAGTCCT

[0115] AAGATAAATATTGATGCCATTAAGATGTTGGGTCATCTCAATAGTGA

[0116] GCAACAAGAAAAAAAGATGCTTCGAGATAAAGAACTTGAAGCAATT

[0117] ATCAAAGGCGAAGATGACCGGTTGCTTTTGATTATCGGACCTTGTTC

[0118] GTCTGATAATGAAGAAGCAGTATTGGAATATGCTCGTCGTTTAGCCA

[0119] AACTTCAAGAAGCAGTCAAAGACAAGATTTTTATGGTAATGCGTGT

[0120] CTATACTGCTAAACCTCGTACAAATGGAGATGGCTATAAAGGGTTG

[0121] ATTCACGAACCTGATGCGGATGGTCATACTGACTTAATCAACGGAA

[0122] TCAAAATGGTTCGCGACTTGCATTACAAAGTTATCACTGAAACTGGT

[0123] TTGACAACTGCTGATGAAATGCTTTACCCAGAAAATCTGCCAATGGT

[0124] TGATGATTTGGTCAGCTACCATGCGATTGGTGCACGTTCTGTGGAAA

[0125] ATCAACAACACCGTTTTGTAGCTTCTGGAATTGATGTTCCAACGGGA

[0126] TTGAAAAATCCAACTTCAGGAAACCTAAAAGTAATGTTCAACGGTA

[0127] TCTATGCTGCGCAACAATCACAAGATTTCCTTTTTGGTCGTGCAGAA

[0128] GTTCAAACTTCAGGAAATCCACTGGCACATGCAATTTTGCGCGGTGG

[0129] ACAAGATGAAAATGGCAAATACCATCCAAACTACTATACAGATAAC

[0130] TTGCTTGAAACAATTGAGATTTATGAAAAAATGGGCTTGAAAAATC

[0131] CTTTCATTCTCATTGACACAAATCATGATAATTCAGGTAAAAAATTC

[0132] ATGGAACAAATCCGTATTGTCCGTCAAACATTGGTCAATCGTGATTG

[0133] GGATGATAAAATCCGCCAAAACGTTCGTGGCTTTATGATTGAATCAT

[0134] ATCTTGAAGATGGTCGTCAAGATAAGCCAGAAGTTTTTGGTAAATC

[0135] AATTACCGATCCATGTTTAGGTTGGGATAAAACAGAAGCGCTCGTTC

[0136] AAGAAATTTACGAAGCTGAAAGTAAAAATAAATAA

[0137] The clone of the MS fragment is:

[0138] The MS gene expressed in the present invention was commissioned to Sangon Biotech Co., Ltd. for sequence synthesis.

[0139] The MS gene was amplified using 2×FidCycle Evo High-Fidelity PCR Mix and the MS synthetic gene fragment as a template using primers MNX1-smut336-F / MNX1-smut336-R.

[0140] Table 1 PCR reaction system

[0141]

[0142] PCR amplification conditions: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 55°C for 20 s, extension at 72°C for 30 s, amplification for 30 cycles; reaction at 72°C for 5 min.

[0143] After PCR amplification, agarose gel electrophoresis was performed, and the target gene fragment was recovered using the Zhuangmeng Biogel Recovery Kit.

[0144] The UA fragment was cloned as follows:

[0145] The UA gene expressed in the present invention was commissioned to Sangon Biotech Co., Ltd. for sequence synthesis.

[0146] The UA gene was amplified using primers PnisA-ubiC-F / aroF-R and 2×FidCycle Evo High-Fidelity PCR Mix with the UA synthetic gene fragment as a template.

[0147] Table 2 PCR reaction system

[0148]

[0149] The PCR amplification conditions were: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 55°C

[0150] Anneal for 20 seconds, extend at 72°C for 30 seconds, and amplify for 30 cycles; react at 72°C for 5 minutes.

[0151] After PCR amplification, agarose gel electrophoresis was performed, and the target gene fragment was recovered using the Zhuangmeng Biogel Recovery Kit.

[0152] The pNZDual-MSUA plasmid is a transformation of the pNZ8149 plasmid, has two expression cassettes, and both expression cassettes are driven by the PnisA promoter.

[0153] The linearization of the pNZ8149 vector was performed using 2×FidCycle Evo High-Fidelity PCR Mix, with the pNZ8149 plasmid as a template and primers 8149-F / 8149-R to amplify the pNZ8149 linearized vector.

[0154] The PCR reaction system is as shown in Table 3:

[0155] Table 3 PCR reaction system

[0156]

[0157]

[0158] PCR amplification conditions: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 55°C for 20 s, extension at 72°C for 100 s, and amplification for 30 cycles; reaction at 72°C for 5 min.

[0159] After PCR amplification, agarose gel electrophoresis was performed, and the linearized vector fragment was recovered using the Zhuangmeng Biogel Recovery Kit.

[0160] The pNZDual-MSUA plasmid comprises the exogenous expression element MSUA, which comprises the chorismate lyase gene ubiC from Escherichia coli BL21 (DE3), the 3-deoxy-arabinoheptulose-7-phosphate synthase gene aroF from Lactococcus lactis NZ3900, the hypothetical protein gene MNX1 from Candida parapsilosis and the sucrose phosphatase gene Smut336 from Streptococcus mutans serotype.

[0161] The pNZDual-MSUA plasmid was constructed by connecting the linearized pNZ8149 vector and the MS and UA genes using the ClonExpress Ultra One Step Cloning Kit. The connection reaction system is shown in Table 4:

[0162] Table 4 Seamless cloning and ligation reaction system

[0163]

[0164]

[0165] The primer sequences used for the strain construction are shown in Table 5

[0166] Table 5 Primer sequences

[0167]

[0168] The pNZDual-MSUA plasmid has a plasmid vector skeleton comprising a PnisA promoter, a lacF protein gene, and replication initiation proteins RepA and RepC.

[0169] The construction of the NZ3900 / pNZDual-MSUA strain includes the following steps:

[0170] (1) Clone the hypothetical protein gene MNX1 from Candida parapsilosis and the sucrose phosphatase gene Smut336 from Streptococcus mutans serotype;

[0171] (2) cloning the chorismate lyase gene ubiC from Escherichia coli BL21 (DE3) and the 3-deoxy-arabinoheptulose-7-phosphate synthase gene aroF from Lactococcus lactis NZ3900;

[0172] (3) connecting the obtained nucleotide sequences of ubiC, aroF, MNX1 and Smut336 to a plasmid vector to obtain a recombinant plasmid;

[0173] (4) Use sterile ultrapure water to prepare the recombinant plasmid at a concentration of 100-500 ng / μL. Take 5 μL and mix it evenly in the electroporation competent cells of lactic acid bacteria NZ3900. Incubate at 37°C for 30 min and then perform electroporation. Incubate at 30°C for 2 h and then spread on LLB medium plates containing bromophenol blue and culture at 30°C overnight.

[0174] The formula of the LLB culture medium containing bromophenol blue is: 1% peptone, 1% yeast powder, 1% soybean peptone, 1% lactose, 0.4% bromophenol blue, and the balance is deionized water.

[0175] The electroporation competent cell preparation method is:

[0176] The NZ3900 strain was activated by subculturing twice with GM17 medium, and then transferred to GM17 medium containing 1% glycine at a 10% inoculum. When the strain grew to OD600nm = 0.4, the cells were collected by centrifugation, washed three times with washing solution, and the competent cells were packaged in 85 μL / tubes and stored at -20°C for use.

[0177] The GM17 culture medium comprises 0.5% glucose, 5% soytone, 2.5% peptone, 2.5% casein peptone, 2.5% yeast extract powder, 5% beef extract powder, 5% lactose, 0.5% sodium ascorbate, 19% sodium β-glycerophosphate, 0.25% magnesium sulfate, and the balance is deionized water.

[0178] The washing solution was 10% glycerol and 0.5 M sucrose.

[0179] A single colony was randomly picked from the plate and inoculated into 5 mL of LLB medium, cultured at 30°C overnight, and the plasmid was extracted using a plasmid extraction kit and sent to Aiki Biotechnology Co., Ltd. for sequencing. The strain with the correct sequencing was the recombinant strain, which was named NZ3900 / pNZDual-MSUA.

[0180] The application of the engineered lactic acid bacteria for producing α-arbutin by microbial fermentation is to synthesize and produce α-arbutin from scratch by microbial fermentation.

[0181] A single colony of the correctly sequenced recombinant strain NZ3900 / pNZDual-MSUA was picked and inoculated into 2 mL of LLB medium. After being cultured at 30°C for 8 h, the bacterial solution was transferred to 150 mL of LLB medium at a ratio of 2%, and cultured at 30°C for 16 h to obtain the seed solution of the recombinant strain.

[0182] The seed solution of the recombinant strain was transferred to 3L LLB medium at a ratio of 3% by volume and fermented under the following conditions: 30°C, static culture until OD600 = 0.4, and nisin with a final concentration of 10 ng / mL was added; after continuing static induction culture for 1 hour, substrate sucrose was added to 36 g / L, and auxiliary material ATP was added to 1 mM. At this time, the fermentation conditions were changed to control pH = 7.0 and shake culture at 100 rpm. After culturing for 16 hours, a fermentation liquid containing α-arbutin was produced.

[0183] The LLB culture medium formula is: 1% peptone, 1% yeast powder, 1% soybean peptone, 1% lactose, and the balance is deionized water.

[0184] Example 2

[0185] During the fermentation of the recombinant strain based on Example 1, the substrate sucrose was added to 25 g / L, the auxiliary material ATP was added to 0.6 mM, and the rest was consistent with Example 1.

[0186] Example 3

[0187] During the fermentation of the recombinant strain based on Example 1, the substrate sucrose was added to 50 g / L, the auxiliary material ATP was added to 2 mM, and the rest was consistent with Example 1.

[0188] Performance Testing

[0189] The fermentation broth was centrifuged at 6000 rpm for 5 min to separate the bacterial cells. The supernatant was added to a 50% methanol aqueous solution and diluted 15 times, then filtered using a 0.22 μm filter, and the filtrate was detected using HPLC.

[0190] HPLC detection method: using C18 column (4.6×250mm, 5μm); column temperature 30℃; gradient elution, mobile phase A is methanol; mobile phase B is water; flow rate 1mL / min, injection volume: 10μL; injection time 20min; DAD lamp detection; detection wavelength 285nm.

[0191] Among them, the gradient elution time is as follows:

[0192]

[0193] The yield of α-arbutin in Example 1-3 was obtained by HPLC detection

[0194]

[0195] The test results show that the Lactococcus lactis with the pNZDual-MSUA plasmid of the present invention can synthesize α-arbutin de novo by adding only the substrate sucrose for microbial fermentation culture.

[0196] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technical personnel in this field can make some changes or modify the technical contents disclosed above into equivalent embodiments without departing from the scope of the technical solution of the present invention. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. An engineered lactic acid bacterium for producing α-arbutin by microbial fermentation, which is obtained by introducing pNZDual-MSUA plasmid into Lactococcus lactis, and is characterized by: The lactococcus lactis is Lactococcus lactis NZ3900; the pNZDual-MSUA plasmid comprises two expression frames, wherein the first expression frame expresses the hypothetical protein gene MNX1 derived from Candida parapsilosis and the sucrose phosphatase gene Smut336 derived from Streptococcus mutans serotype, and the second expression frame expresses the chorismate lyase gene ubiC and the 3-deoxy-arabinoheptulose-7-phosphate synthase gene aroF; the nucleotide sequences of ubiC, aroF, MNX1 and Smut336 are represented by MSUA, and the nucleotide sequence thereof is shown in SEQ ID No: 1; the obtained genotype of the recombinant lactococcus lactis producing α-arbutin is NZ3900 / pNZDual-MSUA.

2. The engineered lactic acid bacteria for producing α-arbutin by microbial fermentation according to claim 1, characterized in that: The pNZDual-MSUA plasmid is a transformation of the pNZ8149 plasmid, has two expression cassettes, and both expression cassettes are driven by the PnisA promoter.

3. The engineered lactic acid bacteria for producing α-arbutin by microbial fermentation according to claim 1, characterized in that: The pNZDual-MSUA plasmid contains the exogenous expression element MSUA, which contains the chorismate lyase gene ubiC from Escherichia coli BL21 (DE3), the 3-deoxy-arabinoheptulose-7-phosphate synthase gene aroF from Lactococcus lactis NZ3900, the hypothetical protein gene MNX1 from Candida parapsilosis and the sucrose phosphatase gene Smut336 from Streptococcus mutansserotype.

4. The engineered lactic acid bacteria for producing α-arbutin by microbial fermentation according to claim 1, characterized in that: The pNZDual-MSUA plasmid has a plasmid vector skeleton comprising a PnisA promoter, a lacF protein gene, and replication initiation proteins RepA and RepC.

5. The engineered lactic acid bacteria for producing α-arbutin by microbial fermentation according to claim 1, characterized in that: The construction of the NZ3900 / pNZDual-MSUA strain includes the following steps: (1) Clone the hypothetical protein gene MNX1 from Candida parapsilosis and the sucrose phosphatase gene Smut336 from Streptococcus mutans serotype; (2) cloning the chorismate lyase gene ubiC from Escherichia coli BL21 (DE3) and the 3-deoxy-arabinoheptulose-7-phosphate synthase gene aroF from Lactococcus lactis NZ3900; (3) connecting the obtained nucleotide sequences of ubiC, aroF, MNX1 and Smut336 to a plasmid vector to obtain a recombinant plasmid; (4) Introducing the recombinant plasmid obtained in step (3) into the Lactococcus lactis NZ3900 strain to obtain a recombinant strain that produces α-arbutin.

6. An application of the engineered lactic acid bacteria for producing α-arbutin by microbial fermentation as claimed in any one of claims 1 to 5, characterized in that: De novo production of α-arbutin by microbial fermentation.

7. The use of engineered lactic acid bacteria for producing α-arbutin by microbial fermentation according to claim 6, characterized in that: The method and conditions for producing α-arbutin from scratch by microbial fermentation are as follows: the seed liquid of the recombinant strain is transferred to the LLB medium at a ratio of 3% by volume and fermented under the following conditions: 30° C., static culture until OD600=0.35-0.45, adding nisin with a final concentration of 10 ng / mL; after continuing static induction culture for 1 hour, adding substrate sucrose and auxiliary material ATP, at this time, the fermentation conditions are changed to control pH=7.0, 100-120 rpm shaking culture, and after culturing for 16 hours, a fermentation product containing α-arbutin is produced.

8. The use of engineered lactic acid bacteria for producing α-arbutin by microbial fermentation according to claim 7, characterized in that: The LLB culture medium formula is: 1% peptone, 1% yeast powder, 1% soybean peptone, 1% lactose, and the balance is deionized water.

Images