Method, preparation, composition and reagent for obtaining RPE cells with stable performance

Abstract

The invention belongs to the field of regenerative medicine, and relates to a method, a preparation, a composition and a reagent for obtaining RPE cells with stable performance, and the method comprises the following steps: obtaining RPE precursor cells; the RPE precursor cells are RPE-like cells with a compact single-layer paving stone sample; continuously culturing the RPE precursor cells by adopting a maturation promoting culture medium until the RPE cells with cobblestone samples and uniform melanin distribution are obtained, wherein the melanin of the obtained RPE cells is deepened relative to the melanin of the RPE precursor cells; the maturation-promoting culture medium comprises maturation-promoting small molecules, and the maturation-promoting small molecules are selected from one or more of thyroid hormone, EDN1, EDN3 and RA in any molar ratio; the dosage of the thyroid hormone ranges from 20 nM to 500 nM, the dosage of the EDN1 ranges from 10 nM to 200 nM, the dosage of the EDN3 ranges from 10 nM to 200 nM, and the dosage of the RA ranges from 0.2 mu M to 2 mu M. The functional maturation stage is mainly realized by chemical small molecules, the components in the maturation promoting process are clear, and the replicability is strong.

Description

Technical Field

[0001] The present invention belongs to the field of regenerative medicine and relates to a method, preparation, composition and reagent for obtaining RPE cells with stable performance, especially using three small molecule compounds alone or in combination to induce pluripotent stem cells to differentiate into RPE cells. Background Art

[0002] Human pluripotent stem cells (hPSC) (human embryonic stem cells (hESC) / human induced pluripotent stem cells (hiPSC)) have the multipotent ability of self-renewal and differentiation into the three germ layers, so it is an important source of stem cell therapy. Eye-related cells obtained based on the differentiation of human pluripotent stem cells have broad application prospects for the treatment of degenerative ophthalmic diseases. Eye-related cells such as retinal pigment epithelial cells (RPE cells) play an important role in maintaining vision and retinal function. With age, retinal pigment epithelial cells may degenerate, leading to an increased risk of diseases such as age-related macular degeneration (AMD). Transplantation of hPSC-prepared RPE cell suspensions, RPE cell sheets or RPE cell spheres is considered to be safe and potentially effective for the treatment of diseases caused by retinal pigment epithelial cell degeneration.

[0003] When using human pluripotent stem cell (hPSC)-derived RPE cells, its functionality needs to be judged. Its main functional indicators include:

[0004] Regulatory barrier: RPE cells have melanosomes, or pigment granules, that absorb stray light and prevent light scattering, which would prevent loss of spatial resolution. The well-defined role of melanosomes in RPE cells (and melanocytes in the skin) is to filter light. During the day, when photoreceptor sensitivity is less important, their important role is to limit light scattering within the eye to improve spatial resolution.

[0005] Phagocytic function: RPE cells are located between the chorionic blood vessels and the photosensitive outer segments of photoreceptors. They phagocytose and degrade the detached outer segments of rods and cones photoreceptors, allowing the photosensitive outer segments of photoreceptors to be continuously renewed to maintain visual function.

[0006] Secretory function: VEGF is a neuroprotective factor and a potent angiogenic factor. VEGF secretion is an important property of healthy RPE cells and is essential for the survival and maintenance of the retina and choroid.

[0007] RPE precursor cells have strong proliferation ability and will produce safety characteristics such as tumorigenicity in practical applications. In order to ensure the safety of clinical use, stable (mature) RPE cells should be selected in the treatment of ophthalmic diseases.

[0008] Literature 1: Parinot C, Rieu Q, Chatagnon J, Finnemann SC, Nandrot EF. Large-scale purification of porcine or bovine photoreceptor outer segments forphagocytosis assays on retinal pigment epithelial cells. J Vis Exp.2014Dec 12;(94):52100.doi:10.3791 / 52100.PMID:25548986;PMCID:PMC4396958. Summary of the invention

[0009] The present application provides a method, preparation, composition and reagent for obtaining RPE cells with stable performance, wherein the functional maturation stage (stable performance stage) mainly relies on small chemical molecules, and the maturation-promoting process (the process of promoting stable performance) has clear components and strong replicability.

[0010] To achieve the above technical objectives, the technical solution adopted by the present application is a method for obtaining RPE cells with stable performance, comprising obtaining RPE precursor cells; the RPE precursor cells are RPE-like cells that appear as a tight single layer of paving stones;

[0011] The RPE precursor cells were cultured in a maturation-promoting medium until cobblestone-shaped RPE cells with uniform melanin distribution were obtained, and the melanin of the obtained RPE cells was darker than that of the RPE precursor cells;

[0012] The maturation-promoting medium comprises maturation-promoting small molecules, wherein the maturation-promoting small molecules are selected from one of thyroid hormone, EDN1, EDN3, and RA or multiple molecules in any molar ratio; the dosage range of the thyroid hormone is 20-500nM, the dosage range of EDN1 is 10-200nM, the dosage range of EDN3 is 10-200nM, and the dosage range of RA is 0.2-2μM.

[0013] As an improved technical solution of the present application, the RPE precursor cells obtained are ESCs, iPSCs or universal iPSCs. HLA -KO Differentiation acquisition;

[0014] The universal iPSC HLA-KO These are iPSCs with immune privilege that have been gene-edited to specifically reduce HLA expression.

[0015] As an improved technical solution of the present application, the thyroid hormone is one of T3 and T4 or two of them in any molar ratio.

[0016] As an improved technical solution of the present application, the maturation-promoting agent culture medium further includes an additive; the additive is one of CHIR990211-10 μM and Nicotinamide 10-50 mM in any molar ratio.

[0017] As an improved technical solution of the present application, the maturation-promoting agent culture medium also includes a basal culture medium, and the basal culture medium is E5 or E6.

[0018] Another object of the present application is to provide an RPE cell preparation, comprising the RPE cells obtained by the aforementioned method.

[0019] Another object of the present application is to provide a pharmaceutical composition suitable for ophthalmology, comprising the RPE cells obtained by the aforementioned method as an active ingredient.

[0020] Another object of the present application is to provide a reagent for evaluating the toxicity or efficacy of a test substance, comprising the RPE cells obtained by the aforementioned method.

[0021] Another object of the present application is to provide a method for evaluating the toxicity or efficacy of a test substance, comprising contacting the RPE cells obtained using the aforementioned method with the substance, and determining the effect of the substance on the cells.

[0022] Beneficial Effects

[0023] 1. The purpose of the technical solution of this application is to obtain RPE cells with a short preparation cycle and stronger functionality.

[0024] 2. The technical solution of the present application can reduce costs and increase efficiency for the industrial production of RPE cells.

[0025] 3. The technical solution of the present application can provide more suitable raw materials for RPE cell preparations, pharmaceutical compositions and related reagents.

[0026] 4. The technical solution of this application does not introduce any animal-derived components during the differentiation process, eliminating the risk of exogenous virus contamination and improving the safety of future clinical applications.

[0027] In summary, this application is based on a large number of experimental studies to obtain RPE cells with stable performance, which are in ESC, iPSC or universal iPSC HLA-KO The differentiation direction towards RPE cells is universal. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Figure 3. Morphological diagram of iRPE precursor cells on which this application is based.

[0029] Figure 2The iRPE cell morphology images obtained based on the method of the present application are as follows: (a) iRPE-1 (immature RPE cells), without maturation promoter; (b) iRPE-T3, using T3 as a maturation promoter; (c) iRPE-EDN3, using EDN3 as a maturation promoter; (d) iRPE-RA, using RA as a maturation promoter; (e) iRPE-ALL-1, using a mixture of T3, EDN3, and RA as a maturation promoter.

[0030] Figure 3 Flow cytometry of iRPE cells obtained based on the method of the present application: (a) fRPE (99.44%); (b) iRPE-1, without maturation promoter (99.59%); (c) iRPE-T3, using T3 as a maturation promoter (99.29%); (d) iRPE-EDN3, using EDN3 as a maturation promoter (99.53%); (e) iRPE-RA, using RA as a maturation promoter (99.58%); (f) iRPE-ALL-1, using a mixture of T3, EDN3, and RA as a maturation promoter (99.63%).

[0031] Figure 4 Quantitative qPCR detection of marker MITF: iPSC, fRPE, iRPE-1, iRPE-T3-min (T3 dosage 20nM), iRPE-T3-mid (T3 dosage 300nM), iRPE-T3-max (T3 dosage 500nM), iRPE-EDN3-min (EDN3 dosage 10nM), iRPE-EDN3-mid (EDN3 dosage 100nM), iRPE-EDN3-max (EDN3 dosage 200nM), iRPE-RA-min (RA dosage 0.2μM), iRPE -RA-mid (RA dosage 1μM), iRPE-RA-max (RA dosage 2μM), iRPE-ALL-1 (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM), iRPE-ALL-2 (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM), iRPE-ALL-3 (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM), iKO-iRPE-ALL (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM).

[0032] Figure 5Quantitative qPCR detection of marker RPE65: iPSC, fRPE, iRPE-1, iRPE-T3-min (T3 dosage 20nM), iRPE-T3-mid (T3 dosage 300nM), iRPE-T3-max (T3 dosage 500nM), iRPE-EDN3-min (EDN3 dosage 10nM), iRPE-EDN3-mid (EDN3 dosage 100nM), iRPE-EDN3-max (EDN3 dosage 200nM), iRPE-RA-min (RA dosage 0.2μM), iRP E-RA-mid (RA dosage 1μM), iRPE-RA-max (RA dosage 2μM), iRPE-ALL-1 (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM), iRPE-ALL-2 (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM), iRPE-ALL-3 (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM), iKO-iRPE-ALL (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM).

[0033] Figure 6 Phagocytosis-flow cytometry images: (a) fRPE (95.67%), (b) iRPE-1 (76.66%), (c) iRPE-EDN3 (97.55%), (d) iRPE-T3 (98.51%), (e) iRPE-RA (97.75%), (f) iRPE-ALL-1 (98.35%).

[0034] Figure 7VEGF secretion detection: iPSC, fRPE, iRPE-1, iRPE-T3-min (T3 dosage 20nM), iRPE-T3-mid (T3 dosage 300nM), iRPE-T3-max (T3 dosage 500nM), iRPE-EDN3-min (EDN3 dosage 10nM), iRPE-EDN3-mid (EDN3 dosage 100nM), iRPE-EDN3-max (EDN3 dosage 200nM), iRPE-RA-min (RA dosage 0.2μM), iRPE-RA -mid (RA dosage 1μM), iRPE-RA-max (RA dosage 2μM), iRPE-ALL-1 (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM), iRPE-ALL-2 (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM), iRPE-ALL-3 (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM), iKO-iRPE-ALL (T3 dosage 300nM, RA dosage 1μM, EDN3 dosage 100nM). DETAILED DESCRIPTION

[0035] 1. Definition of terms

[0036] iPSC, or induced pluripotent stem cells. hiPSC, or human induced pluripotent stem cells, is a type of stem cell obtained by reprogramming human peripheral blood mononuclear cells, which has the ability to self-renew and differentiate into three germ layers. Three germ layer differentiation refers to differentiation into cells of the ectoderm, mesoderm, and endoderm cell lineages. Source: T / CSCB0005-2021, group standard "Human Induced Pluripotent Stem Cells", issued by the Chinese Society of Cell Biology. iRPE is RPE precursor cells obtained by differentiation of iPSC, as well as mature RPE cells.

[0037] The universal iPSC HLA-KO It is an iPSC with immune immunity characteristics that has been gene-edited to specifically reduce HLA expression. Specifically: Universal iPSC HLA-KO Refers to knocking out class I (such as B2M) and / or class II (such as CIITA) genes of the HLA gene group in iPSC through CRISPR / Cas9 technology. The acquisition method is the same as the steps listed in the specification of the Chinese patent "2022106036092 A method for preparing low immunogenic iPSC cells, low immunogenic iPSC cells and compositions", except that the iPSC in this article does not rely on CD47 editing. iKO-RPE is iPSC HLA-KO Differentiation to obtain RPE precursor cells and mature RPE cells.

[0038] ESCs are derived from the embryonic stem cell lines H1 or H9.

[0039] RPE cells (Retinal Pigment Epithelium) are short for retinal pigment epithelial cells, located outside the retina, and are a dense layer of colored epithelial cells between the choroid and the neural central retina; they provide support, nutrition and circulation for photoreceptor cells. The confirmation methods of RPE cells in this application are: first, the cells are closely bound, typical polygonal, cobblestone-like cell morphology, etc. are easy to confirm; second, the presence of melanin granules (brown black); third, the expression of RPE cell-specific marker proteins: RPE65, MITF can be positively expressed.

[0040] In this paper, whether RPE cells have the function of retinal pigment epithelial cells was verified by detecting the in vitro phagocytic function of RPE cells and the VEGF secretion amount.

[0041] Thyroid hormones, specifically: one of T3 and T4 or two of them in any molar ratio; the dosage range of T3 and T4 is 20-500nM. The full name of T3 is triiodothyronine, and the full name of T4 is tetraiodothyronine. They show high affinity in binding with RPE cells and participate in the regulation of mature RPE cell functions such as choroidal vascular permeability, antioxidant enzyme activity, and photosensitivity.

[0042] The dosage range of EDN1 is 10-200 nM, and EDN1 is endothelin 1.

[0043] The dosage range of EDN3 is 10-200nM. EDN3 (Endothelin-3) is an endothelial-derived vasoactive peptide that participates in multiple biological functions. During the maturation of RPE cells, EDN3 increases the expression of melanin production markers, such as MITF, and promotes the deposition of melanin.

[0044] The dosage range of RA is 0.2-2μM. Retinoic acid (RA) is a regulator of eye growth, regulating non-steroid hormone receptors (such as RARα / β / γ and RXRα / β / γ) in the neural retina, RPE cells, periocular mesenchyme, lens, cornea, iris / ciliary body, choroid, sclera and conjunctiva, and is beneficial to tight junction (TJ)-related proteins in the RPE cell-choroid complex.

[0045] iRPE cells are mature RPE cells obtained by inducing iPSCs to differentiate into RPE precursor cells and then using different maturation-promoting methods.

[0046] fRPE, the full name of which is Human Retinal Pigment Epithelium Cells, is used as a positive control for iRPE cells. It is obtained by separating and culturing the eyeballs of aborted fetuses. The specific method is the existing technology, and the method based on it includes but is not limited to the method for isolating and culturing human fetal retinal pigment epithelial cells in Chinese patent CN201310552005.0.

[0047] Example 1

[0048] Obtaining RPE precursor cells. The method for obtaining RPE precursor cells may adopt any method in the prior art, or may adopt the preferred method listed in this application.

[0049] The preferred method is "RPE cells, preparations, pharmaceutical compositions and methods derived from pluripotent stem cells" applied for in Chinese patent application number CN202311679010.8.

[0050] Example 2

[0051] Obtaining RPE cells with stable performance. The method for obtaining RPE cells with stable performance includes

[0052] (1) obtaining RPE precursor cells; the RPE precursor cells are RPE-like cells that appear as a compact single layer of paving stones; Figure 1 shown.

[0053] (2) Continue to culture the RPE precursor cells in a maturation-promoting medium until cobblestone-shaped RPE cells with uniform melanin distribution are obtained, and the melanin of the obtained RPE cells is darker than that of the RPE precursor cells. Figure 2 shown. Note: Figure 2 All subsequent tests were based on RPE cells that were cultured for 10 to 15 days using maturation-promoting medium to further culture RPE precursor cells.

[0054] The maturation-promoting medium includes a maturation-promoting small molecule, wherein the maturation-promoting small molecule is selected from one of T3 or T4, EDN1 or EDN3, and RA, or multiple thereof in any molar ratio;

[0055] The dosage range of T3 or T4 is 20-500nM;

[0056] The dosage range of EDN1 or EDN3 is 10-200nM;

[0057] The dosage range of RA was 0.2-2 μM.

[0058] Table 1 Selection of maturation-promoting culture medium in this example

[0059]

[0060]

[0061]

[0062] The basal culture medium may be E5 (less insulin than E6) or E6 (a culture medium with less FGF2 and TGF-β than E8). The two can be substituted for each other and have little effect on the obtained RPE cells.

[0063] Among them, T3 and T4 are interchangeable, EDN3 and EDN1 are interchangeable, and have little effect on the obtained RPE cells.

[0064] Example 3, flow cytometry detection.

[0065] After obtaining cobblestone-like RPE cells with uniform melanin distribution, the cells were digested, and the cell suspension digested into single cells was washed once with DPBS, and then incubated at room temperature for 10 minutes with 4% paraformaldehyde; washed once with DPBS, centrifuged and discarded the supernatant, and then permeabilized with 0.2% Triton-X100 for 10 minutes; washed once with DPBS, centrifuged and discarded the supernatant, and then blocked with 1% bovine serum albumin (BSA) in DPBS at room temperature for 30 minutes. After centrifugation and discarding BSA, for MITF, the primary antibody was added directly without washing: mouse monoclonal MITF antibody (the antibody was diluted with diluent at 1:100), and incubated at 4°C overnight. Washed once with DPBS, and then added the secondary antibody: FITC-labeled goat anti-mouse IgG antibody (the antibody was diluted with diluent at 1:1000), and incubated at room temperature for 1 hour. Then wash once with DPBS, discard the supernatant and add DPBS for sample analysis under the flow cytometer system.

[0066] As described, fRPE cells were used as a control (99.44%), and iRPE-1 (no maturation agent, the result value was 99.59%) was compared; iRPE-T3 (T3 was used as a maturation agent, the result value was 99.29%); iRPE-EDN3 (EDN3 was used as a maturation agent, the result value was 99.53%); iRPE-RA (RA was used as a maturation agent, the result value was 99.58%); iRPE-ALL (a mixture of T3, EDN3, and RA was used as a maturation agent, the result value was 99.63%).

[0067] Flow cytometry results showed that iRPE cells matured with maturation agents positively expressed RPE cell-specific marker proteins; the MITF-positive cell rate was greater than 99%, and the purity of iRPE cells matured with maturation agents was consistent with that of fRPE cells and iRPE cells matured without maturation agents. Adding maturation agents would not reduce the purity of RPE cells.

[0068] Example 4, reverse transcription qPCR detection.

[0069] The total RNA of each group of cells was extracted using an RNA extraction kit (Novozyme, China), and the OD was measured to ensure that the OD 260 / OD280 value of the extracted RNA of each group was between 1.8 and 2.1 to ensure its purity. Then the RNA was reverse transcribed into cDNA using a reverse transcription kit (Novozyme, China). The reaction system and reaction procedure refer to the product manual. The product cDNA was used for RT-PCR, and the primer sequences are shown in Table 1. The reaction system refers to the instructions of the SYBR kit (Bio, USA). After centrifugation, the reaction was carried out on the machine, pre-denatured at 95℃ for 5 minutes, and reacted for 40 cycles (94℃, 30 seconds; 59℃, 30 seconds; 72℃, 30 seconds). 2μL of the reaction product was aspirated and added with 3μL of SYBRGREEN MIX to mix well and then put on the machine.

[0070] Table 2 Primer sequences (F: left arm; R: right arm)

[0071] Primers Sequence (5'to3') GAPDH-F SEQ ID No.1:GGAGCGAGATCCCTCCAAAAT GAPDH-R SEQ ID No.2: GGCTGTTGTCATACTTCTCATGG RPE65-F SEQ ID No.3:TTGGATCTGAGCCATTTTACCAC RPE65-R SEQ ID No.4: GTCAGTAACCTCTACTCCTCGAA MITF-F SEQ ID No.5: TGCCCAGGCATGAACACAC MITF-R SEQ ID No.6: TGGGAAAAATACACGCTGTGAG

[0072] RPE65 and MITF were used to detect the expression level of RPE cells, and GAPDH was used as the internal reference gene (Normalized to GAPDH) to correct and normalize the expression of the target gene. The product sequence length corresponding to the primers of the GAPDH gene was 197 bp; the product sequence length corresponding to the primers of the RPE65 gene was 236 bp; the product sequence length corresponding to the primers of the MITF gene was 276 bp.

[0073] RT-PCR results showed that iRPE cells matured with maturation promoters upregulated specific RPE cell marker genes, such as RPE65 (such as Figure 5 As shown), MITF( Figure 4 ); at the same time, relative to fRPE cells, specific RPE cell marker genes were also upregulated: RPE65 (such as Figure 5 As shown), MITF( Figure 4 ). RPE65 is expressed in the late stage of RPE cell development and plays a key role in the visual cycle, while MITF is an important regulator of melanin production in RPE cells.

[0074] The conclusion shows that the addition of small molecules will be more conducive to the maturation of iRPE cells and will further promote the clinical transformation and application of iRPE cells.

[0075] Example 5, in vitro phagocytic function detection.

[0076] The method of the published literature 1 was followed, and each experimental group was divided into 1×10 6 Cells / well were seeded into 12-well plates and cultured at 37°C for 2 days. After 2 days, Fluorescent Particles were added and incubated at 4°C / 37°C for 8 hours. TrypanBlue was added for fluorescence quenching. Then the cells were washed 3 times with DPBS, digested with TrpLE 1×, resuspended with DPBS, and analyzed on a flow cytometer system.

[0077] Another important function of RPE cells is to phagocytize the outer segments shed by photoreceptor cells. In order to detect the phagocytic function of differentiated RPE cells, Fluorescent Particles were used to track the cells after incubation.

[0078] The results showed that flow cytometry could more intuitively show that Fluorescent Particles were engulfed by iRPE cells and fRPE cells and entered the cells ( Figure 6 ). The phagocytic ability of iRPE cells without maturation promoters is lower than that of fRPE cells, specifically: fRPE cells, 95.67%; iRPE-1, 76.66%. The phagocytic ability of iRPE cells matured with maturation promoters is basically the same as that of fRPE cells, or even slightly higher, specifically: fRPE cells, 95.67%; iRPE-EDN3, 97.55%; iRPE-T3, 98.51%; iRPE-RA, 97.75%; iRPE-ALL, 98.35%.

[0079] Example 6: ELISA assay to detect VEGF secretion.

[0080] The following experiment was performed using a human VEGF ELISA kit (Thermo, USA). The experimental steps are as follows: Use the coating solution to dilute the antigen (the antigen and the diluent are diluted at 1:250) and add it to the ELISA plate for overnight coating. Take it out and wash it the next day, then add the ELISA working solution for blocking at room temperature for 1 hour; after washing, add the standard and the corresponding sample to each well and incubate at room temperature for 2 hours; after washing, add the primary antibody and incubate at room temperature for 1 hour (the antibody and the diluent are diluted at 1:250); after washing, add the enzyme-labeled secondary antibody and incubate at room temperature for 30 minutes (the antibody and the diluent are diluted at 1:250); after washing, add the substrate solution (TMB) for color development, incubate at room temperature for 10 minutes, and finally add the stop solution (2mol / L H2SO4) to each well to terminate the reaction, and then use the ELISA reader for detection.

[0081] like Figure 7 As shown, the results showed that iRPE cells matured with maturation-promoting agents had similar VEGF secretion levels as fRPE cells, but the VEGF secretion capacity of iRPE cells without the addition of maturation-promoting agents was significantly weaker than that of fRPE cells and iRPE cells obtained with the addition of maturation-promoting agents.

[0082] Based on the above results and the prior art, another object of the present application is to provide an RPE cell preparation, comprising the aforementioned RPE cells derived from pluripotent stem cells.

[0083] Another object of the present application is to provide a pharmaceutical composition for ophthalmology, comprising the aforementioned RPE cells derived from pluripotent stem cells as an active ingredient.

[0084] Another object of the present application is to provide a reagent for evaluating the toxicity or efficacy of a test substance, comprising the aforementioned RPE cells derived from pluripotent stem cells.

[0085] Another object of the present application is to provide a method for evaluating the toxicity or efficacy of a test substance, comprising contacting the aforementioned pluripotent stem cell-derived RPE cells with the substance, and determining the effect of the substance on the cells.

Claims

1. A method for obtaining RPE cells with stable performance, characterized in that: include Obtaining RPE precursor cells; the RPE precursor cells are RPE-like cells that appear as a compact single layer of paving stones; The RPE precursor cells were cultured in a maturation-promoting medium until cobblestone-shaped RPE cells with uniform melanin distribution were obtained, and the melanin of the obtained RPE cells was darker than that of the RPE precursor cells; The maturation-promoting medium comprises maturation-promoting small molecules, wherein the maturation-promoting small molecules are selected from one of thyroid hormone, EDN1, EDN3, and RA or multiple molecules in any molar ratio; the dosage range of the thyroid hormone is 20-500nM, the dosage range of EDN1 is 10-200nM, the dosage range of EDN3 is 10-200nM, and the dosage range of RA is 0.2-2μM.

2. A method for obtaining RPE cells with stable performance according to claim 1, characterized in that, The RPE precursor cells obtained are ESCs, iPSCs or universal iPSCs HLA-KO Differentiation acquisition; The universal iPSC HLA-KO These are iPSCs with immune privilege that have undergone gene editing to specifically reduce HLA expression.

3. A method for obtaining RPE cells with stable performance according to claim 1, characterized in that, The thyroid hormone is one of T3 and T4 or both of them in any molar ratio.

4. A method for obtaining RPE cells with stable performance according to claim 1, characterized in that, The maturation-promoting agent culture medium further comprises an additive; the additive is one of CHIR990211-10 μM and Nicotinamide 10-50 mM in any molar ratio.

5. A method for obtaining stable performance RPE cells according to claim 1, characterized in that, The maturation-promoting agent medium also includes a basal medium, and the basal medium is E5 or E6.

6. A RPE cell preparation, characterized in that: The invention relates to RPE cells obtained by any one of the methods described in claims 1 to 5.

7. A pharmaceutical composition suitable for ophthalmology, characterized in that: The invention comprises RPE cells obtained by the method according to any one of claims 1 to 5 as active ingredients.

8. A reagent for evaluating the toxicity or efficacy of a test substance, characterized in that: The invention relates to RPE cells obtained by any one of claims 1 to 5.

9. A method for evaluating the toxicity or efficacy of a test substance, characterized in that: The method comprises contacting the RPE cells obtained by the method according to any one of claims 1 to 5 with the substance, and determining the effect of the substance on the cells.

Images