Difunctional incision type alginate lyase as well as coding gene and application thereof

Abstract

The invention relates to difunctional incision type alginate lyase as well as a coding gene and application thereof, and belongs to the technical field of enzyme engineering. The alginate lyase AlyW1 and AlyW2 have double functions of degrading different types of alginate substrates and resisting a pseudomonas aeruginosa biological membrane, are separated from a sea mud metagenome library, are easy for heterologous expression and purification, are stable in physicochemical property and high in degradation activity, and have potential of industrial application. The method can be applied to preparation of alginate oligosaccharide and research on an anti-pseudomonas aeruginosa biological membrane, and has a wide application prospect in the fields of medical treatment, industrial production of bioethanol and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of enzyme engineering, and relates to a bifunctional endo-alginic acid lyase and a coding gene and application thereof. Background Art

[0002] Alginate (Alg) is a kind of linear polyanionic polymer acidic polysaccharide widely found in the cell walls and intercellular matrix of various brown algae plants. It is composed of α-L-guluronic acid (G) and its C5 diastereomer β-D-mannuronic acid (M) randomly bonded by β-1,4 glycosidic bonds. The two uronic acids form three segments by homopolymerization or random arrangement: polyguluronic acid (poly G), polymannuronic acid (poly M) and alternating blocks of guluronic acid and mannuronic acid (poly MG / GM). Alginate has outstanding biocompatibility, rheological properties, biodegradability, marginal toxicity and chemical versatility. Due to its unique properties, it is widely used in various fields, such as medical, food, agriculture, chemical and textile industries. It can be used to prepare seaweed protoplasts and functional oligosaccharides, treat cystic fibrosis, and is also one of the important raw materials for bioethanol production. It can be used as the third generation of marine bioenergy to reduce people's dependence on fossil energy and provide new ideas for solving the energy crisis.

[0003] Alginate lyase is a polysaccharide degrading enzyme that catalyzes the cleavage of glycosidic bonds within alginate molecules through β-elimination reaction, forming C4=C5 unsaturated double bonds at the non-reducing end of the newly produced alginate oligosaccharides. The production of unsaturated double bonds makes the unsaturated oligosaccharide products have characteristic absorption at 232 nm. At present, the sources of alginate lyase in nature mainly include animal sources (marine mollusks, echinoderms), plant sources (marine algae) and microbial sources (bacteria, fungi and a few viruses in the ocean and soil). Microorganisms are the main source of alginate lyase.

[0004] According to the substrate preference of alginate lyase, it can be divided into G-specific lyase, M-specific lyase and bifunctional lyase. Alginate lyase from different sources has different substrate specificity. According to the amino acid composition of alginate lyase and the characteristics of the spatial structure of enzyme molecules, CAZy (Carbohydrate-Active Enzymes) database classifies it into 12 polysaccharide lyase families, namely PL5, PL6, PL7, PL14, PL15, PL17, PL18, PL31, PL33, PL34, PL36 and PL39 families. The vast majority of alginate lyases belong to the PL5 and PL7 families. Among them, alginate lyases in the PL5 family are mostly M-specific lyases, and can degrade acetylated alginate to varying degrees; while the lyases in the PL7 family are more complex in nature, including three substrate specificities. Alginate lyases are mainly endo-type alginate lyases; the identified alginate lyases of PL14 family mainly come from marine animals, and the number is relatively small; the alginate lyases of PL15 and PL17 families are similar; the alginate lyases of PL18 family are mostly bifunctional enzymes; PL31, PL33, PL34, PL36 and PL39 families are newly established polysaccharide lyase families, which means that there must be more types and numbers of alginate lyases in nature, and the alginate lyases discovered by humans may be only a small part.

[0005] According to the different degradation modes of alginate lyase substrates, it can be divided into endo-type lyase and exo-type lyase. Most of the alginate lyases identified so far are endo-type lyases. Endo-type alginate lyases have high activity and good stability. They can quickly produce a series of unsaturated oligosaccharides with different molecular sizes when acting on alginate, and the smallest products are mostly unsaturated disaccharides; exo-type alginate lyases degrade from one end of the alginate molecule in sequence, and the products are unsaturated monosaccharides. Unsaturated monosaccharides can be automatically converted into DEH or TPC (unsaturated monosaccharide conversion products) under non-enzymatic catalysis. DEH and TPC are converted into 2-keto-3-deoxygluconate (KDG) under the action of reductase. KDG can enter the bacterial ED pathway (energy metabolism pathway) and be used by bacteria or converted into bioethanol. Most of the exo-type alginate lyases identified so far belong to the PL15 and PL17 families, and very few belong to the PL6 and PL7 families.

[0006] Studies in recent years have found that the biological activity of alginate oligosaccharides is significantly better than that of polysaccharides. Enzymatic hydrolysis has successfully overcome the shortcomings of physical and chemical methods such as high cost and environmental pollution. It is a more commonly used method for preparing oligosaccharides. Alginate lyases with different substrate specificities can degrade alginate to obtain unsaturated oligosaccharides with different structures. Relevant reports have shown that the structure of oligosaccharides has a great correlation with their activity. Therefore, alginate lyase plays an important role in the study of the structure and function of alginate.

[0007] In addition, recent studies have found that alginate lyase can degrade the biofilm formed by Pseudomonas aeruginosa, thereby achieving an antibacterial effect. The biofilm of Pseudomonas aeruginosa is mainly composed of polysaccharides, accompanied by a small amount of enzymes and DNA. Pseudomonas aeruginosa that causes human infection is mucus-type, and forms biofilms because it secretes sticky alginate polysaccharides. Alginate is a linear polysaccharide with water retention, which enables Pseudomonas aeruginosa to cope with arid environments. Its adhesive properties make Pseudomonas aeruginosa tightly attached to the patient's body, making it extremely difficult to remove it. Since alginate is the main component of biofilm, alginate lyase can be used to degrade alginate polysaccharides to destroy biofilms. Scientists used alginate lyase in combination with antibiotics to act on Pseudomonas aeruginosa, and found that it could reduce bacterial resistance to a certain extent. Summary of the invention

[0008] In view of the deficiencies in the prior art, the present invention provides a bifunctional endo-algin lyase and its encoding gene and application, wherein the enzyme has highly efficient enzymatic activity for degrading alginate.

[0009] The technical solution of the present invention is as follows: A bifunctional endo-algin lyase, wherein the bifunctional endo-algin lyase is AlyW1 or AlyW2, the amino acid sequence of AlyW1 is shown in SEQ ID NO.2, and the amino acid sequence of AlyW2 is shown in SEQ ID NO.4.

[0010] The alginate lyases AlyW1 and AlyW2 of the present invention are both endo-enzymes. When the alginate lyase AlyW1 degrades Alg and poly M polysaccharides, the final product is a series of unsaturated oligosaccharides, including unsaturated disaccharides to unsaturated heptasaccharides, and when the poly G polysaccharides are degraded, the final product includes unsaturated disaccharides to unsaturated hexasaccharides; when the alginate lyase AlyW2 degrades Alg and poly M polysaccharides, the final product is a series of unsaturated oligosaccharides, including but not limited to unsaturated disaccharides to unsaturated heptasaccharides, and when the poly G polysaccharides are degraded, the final product includes unsaturated disaccharides, unsaturated trisaccharides, and unsaturated tetrasaccharides; both alginate lyases are more inclined to degrade the polyG segment.

[0011] A coding gene can encode the above-mentioned alginate lyase AlyW1 or AlyW2.

[0012] Preferably according to the present invention, the nucleotide sequence of the gene encoding alginate lyase AlyW1 is shown as SEQ ID NO.1, and the nucleotide sequence of the gene encoding alginate lyase AlyW2 is shown as SEQ ID NO.3.

[0013] A recombinant expression vector is provided, in which the coding gene of the alginate lyase AlyW1 or AlyW2 is inserted.

[0014] Preferably according to the present invention, the expression vector is an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a bacteriophage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector or a mammalian cell expression vector.

[0015] A recombinant cell, in which the coding gene of the alginate lyase AlyW1 or AlyW2 or the recombinant expression vector is inserted into the host cell.

[0016] Preferably according to the present invention, the host cell is an Escherichia coli host cell, a yeast host cell, a Bacillus subtilis host cell, a lactic acid bacteria host cell, an actinomycete host cell, a filamentous fungus host cell, an insect cell or a mammalian cell.

[0017] Further preferably, the Escherichia coli host cell is Escherichia coli BL21, Escherichia coli JM 109 or Escherichia coli DH 5α; the yeast host cell is Saccharomyces cerevisiae , Pichia pastoris or Kluyveromyces Iactis ; The Bacillus subtilis host cell is Bacillus subtilis R25 or Bacillus subtilis 9920; the lactic acid bacteria host cell is Lactic acid bacteria COCC101; the actinomycete host cell is Streptomyces spp; the filamentous fungal host cell is Trichoderma viride , Trichoderma reesei , Aspergillus niger or Aspergillus nidulans ; The insect cell is Bombyxmori or Antharaea eucalypti; the mammalian cell is hamster ovary cell CHO, baby hamster kidney cell BHK or hamster lung cell CHL.

[0018] Use of the above recombinant cell in recombinantly expressing the above alginate lyase AlyW1 or AlyW2.

[0019] Application of the alginate lyase AlyW1 or AlyW2 in the preparation of alginate oligosaccharides.

[0020] Application of the alginate lyase AlyW1 or AlyW2 in combating Pseudomonas aeruginosa biofilm.

[0021] Beneficial effects: 1. The alginate lyases AlyW1 and AlyW2 in the present invention have the dual functions of degrading different types of alginate substrates and resisting Pseudomonas aeruginosa biofilms. They are isolated from the sea mud metagenomic library, are easy to heterologously express and purify, have stable physicochemical properties, high degradation activity, and have the potential for industrial application.

[0022] 2. The alginate lyases AlyW1 and AlyW2 in the present invention are novel bifunctional endo-type alginate lyases, which have high enzyme activity against alginate. The enzyme activities of alginate lyase AlyW1 against Alg, poly M, and poly G polysaccharides are 251.76 U / mg, 222.85 U / mg, and 255.53 U / mg, respectively, and the enzyme activities of alginate lyase AlyW2 against Alg, poly M, and poly G polysaccharides are 208.95 U / mg, 96.56 U / mg, and 235.35 U / mg, respectively.

[0023] 3. The alginate lyases AlyW1 and AlyW2 of the present invention both degrade alginate in endo-enzyme mode; when the alginate lyase AlyW1 degrades Alg and poly M polysaccharides, the final product is a series of unsaturated oligosaccharides, including unsaturated disaccharides to unsaturated heptasaccharides, and when the alginate lyase AlyW1 degrades poly G polysaccharides, the final product includes unsaturated disaccharides to unsaturated hexasaccharides; when the alginate lyase AlyW2 degrades Alg and poly M polysaccharides, the final product is a series of unsaturated oligosaccharides, including but not limited to unsaturated disaccharides to unsaturated heptasaccharides, and when the alginate lyase AlyW2 degrades poly G polysaccharides, the final product includes unsaturated disaccharides, unsaturated trisaccharides, and unsaturated tetrasaccharides.

[0024] 4. The alginate lyases AlyW1 and AlyW2 of the present invention can be applied to the preparation of alginate oligosaccharides and the study of anti-Pseudomonas aeruginosa biofilms, and have broad application prospects in the fields of medical treatment and industrial production of bioethanol. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 : is a functional module analysis diagram of alginate lyase; wherein A is a functional module analysis diagram of alginate lyase AlyW1, and B is a functional module analysis diagram of alginate lyase AlyW2.

[0026] Figure 2The polyacrylamide gel electrophoresis patterns of the expression and purification of alginate lyase; wherein, A is the polyacrylamide gel electrophoresis pattern of the expression and purification of alginate lyase AlyW1, and B is the polyacrylamide gel electrophoresis pattern of the expression and purification of alginate lyase AlyW2; wherein: lane 1, protein molecular weight standard, sample volume 5 µL, the sizes of the bands from top to bottom are 180 kDa, 130 kDa, 100 kDa, 70 kDa, 55 kDa, 40 kDa, 35 kDa, 25 kDa, 15 kDa; lane 2, bacterial solution after cell wall disruption of control strain, sample volume 8 µL; lane 3, bacterial solution after cell wall disruption of recombinant strain, sample volume 5 µL; lane 4, supernatant after cell wall disruption of recombinant strain, sample volume 4 µL; lane 5, protein sample purified by nickel column, sample volume 5 µL.

[0027] Figure 3 is the effect curve of temperature on the enzyme activity of alginate lyase; wherein, A is the effect curve of temperature on the enzyme activity of alginate lyase AlyW1, and B is the effect curve of temperature on the enzyme activity of alginate lyase AlyW2.

[0028] Figure 4 : is the effect curve of pH on the enzyme activity of alginate lyase; wherein, A is the effect curve of pH on the enzyme activity of alginate lyase AlyW1, and B is the effect curve of pH on the enzyme activity of alginate lyase AlyW2.

[0029] Figure 5 Figure 2 is the influence curve of temperature on the stability of alginate lyase; A is the stability influence curve of alginate lyase AlyW1 under 0-70 ℃ conditions, B is the stability influence curve of alginate lyase AlyW2 under 0-70 ℃ conditions, and C is the stability influence curve of alginate lyase AlyW2 under 70-100 ℃ conditions.

[0030] Figure 6 It is a bar graph showing the effects of metal ions and chemical reagents on the enzyme activity of alginate lyase; wherein, A is a bar graph showing the effects of metal ions and chemical reagents on the enzyme activity of alginate lyase AlyW1, and B is a bar graph showing the effects of metal ions and chemical reagents on the enzyme activity of alginate lyase AlyW2.

[0031] Figure 7 The figures are high performance liquid chromatograms of the degradation products of different substrates degraded by alginate lyase AlyW1; wherein A is the HPLC chromatogram with Alg as substrate, B is the HPLC chromatogram with poly M polysaccharide as substrate, and C is the HPLC chromatogram with poly G polysaccharide as substrate; in the figure, Di is an unsaturated disaccharide; Tri is an unsaturated trisaccharide; Tetra is an unsaturated tetrasaccharide; Penta is an unsaturated pentasaccharide; Hexa is an unsaturated hexasaccharide; Hepta is an unsaturated heptasaccharide.

[0032] Figure 8 The high performance liquid chromatograms of the degradation products of different substrates degraded by alginate lyase AlyW2; wherein A is the HPLC chromatogram with Alg as substrate, B is the HPLC chromatogram with poly M polysaccharide as substrate, and C is the HPLC chromatogram with poly G polysaccharide as substrate; in the figure, Di is an unsaturated disaccharide; Tri is an unsaturated trisaccharide; Tetra is an unsaturated tetrasaccharide; Penta is an unsaturated pentasaccharide; Hexa is an unsaturated hexasaccharide; Hepta is an unsaturated heptasaccharide.

[0033] Fig. 9 This is a high performance liquid chromatogram of the degradation products of Alg at different times after alginate lyase AlyW1 degraded Alg; in the figure, Di is an unsaturated disaccharide; Tri is an unsaturated trisaccharide; Tetra is an unsaturated tetrasaccharide; Penta is an unsaturated pentasaccharide; Hexa is an unsaturated hexasaccharide; Hepta is an unsaturated heptasaccharide.

[0034] Fig.10 This is a high performance liquid chromatogram of the degradation products of Alg at different times after alginate lyase AlyW2 degrades Alg; in the figure, Di is an unsaturated disaccharide; Tri is an unsaturated trisaccharide; Tetra is an unsaturated tetrasaccharide; Penta is an unsaturated pentasaccharide; Hexa is an unsaturated hexasaccharide; Hepta is an unsaturated heptasaccharide.

[0035] Fig.11 This is a bar graph showing the clearance effects of alginate lyases AlyW1 and AlyW2 on established Pseudomonas aeruginosa biofilms. DETAILED DESCRIPTION

[0036] The following examples are provided to fully disclose some common techniques for implementing the present invention, but are not intended to limit the scope of application of the present invention. Unless otherwise specified, molecular weight in the present invention refers to weight average molecular weight, and temperature refers to degrees Celsius. The reagents and materials involved in the examples are all common commercially available products unless otherwise specified.

[0037] Sources of biological materials: The sea mud samples were collected from the Hutouya intertidal zone in Yantai, Shandong (N37°18'31", E119°09'27"), and the samples were collected on July 8, 2021.

[0038] Example 1 Construction of metagenomic library 1 g of intertidal mud sample was added to 100 mL of sole carbon source medium and cultured at 28°C and 200 rpm for 3 days. 1 mL of bacterial culture was transferred to fresh sole carbon source medium and then cultured at 28°C and 200 rpm for 3 days. The culture was centrifuged at 8000 × g for 20 min to collect the cultured bacteria, and the metagenomic DNA was sequenced and annotated at BGI Technology Service Co., Ltd. (Guangdong, China) to construct the metagenomic library.

[0039] The above-mentioned sole carbon source medium has the following components per liter: K2HPO4 1 g, MgSO4·7H2O 0.5 g, NaCl 30 g, CaCl2·2H2O 0.1 g, FeSO4 0.001 g, NH4Cl 1 g, alginate 0.3 g, dilute to 1000 mL with water, pH 7.0.

[0040] Example 2 Extraction of bacterial DNA Take 40 mL of the culture solution of Example 1, centrifuge at 12,000 rpm for 25 min, collect the bacterial precipitate, wash with 20 mL of lysozyme buffer (10 mM Tris-HCl, pH 8.0), centrifuge at 12,000 rpm for 25 min, and collect the bacterial precipitate; To the above bacterial precipitate, 12.0 mL of lysozyme buffer (10 mM Tris-HCl, pH 8.0) was added to obtain about 14.0 mL of bacterial solution, and 560 µL of lysozyme solution with a concentration of 20 mg / mL was added, with a final concentration of about 800 µg / mL; after an ice bath for 1.0 h, it was warmed at 37 °C for 2 h until the solution became viscous; 0.82 mL of 10 wt % SDS (sodium dodecyl sulfate) and 60 µL of 100 mg / mL proteinase K solution were added, and the solution was incubated at 52 °C for 1.0 h; 15 mL of phenol / chloroform / isoamyl alcohol (volume ratio 25:24:1) equilibrated with Tris-HCl buffer (pH8.0) was added, and the mixture was gently inverted to mix until fully emulsified; centrifuged at 10,000 × g and 4 °C for 10 min, the supernatant was transferred, and 2.0 mL of NaAc-HAc buffer (3.0 M, pH 5.2) and 17.0 mL of anhydrous ethanol, mix well; pick out the filamentous DNA with a 1.0 mL pipette tip, transfer to a 1.5 mL EP centrifuge tube, wash twice with 70 wt % ethanol (stored at -20 ℃), discard the supernatant after microcentrifugation; centrifuge at 10,000 × g, 4 ℃ for 3 min, and completely discard the supernatant; blow dry the sample under an alcohol lamp on a sterile workbench; resuspend and dissolve the DNA sample with sterile deionized water and incubate at 4 ℃ overnight to obtain high molecular weight genomic DNA.

[0041] Example 3 Sequence Analysis of Alginate Lyase AlyW1 and AlyW2 The sequencing results of the metagenomic library prepared in Example 1 were analyzed using software from NCBI (National Center for Biotechnology Information, http: / / www.ncbi.nlm.nih.gov / ). The NCBI analysis software used was Open Reading Frame Finder (ORF Finder, http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html) and Basic Local Alignment Search Tool (BLAST, http: / / blast.ncbi.nlm.nih.gov / Blast.cgi).

[0042] NCBI analysis results show alginate lyase genes in metagenomic libraries alyw1 The gene coding region is 1647 bp long, and its nucleotide sequence is shown in SEQ ID NO.1. Alginate lyase gene alyw1 The GC content is 42.94%, and the alginate lyase AlyW1 encoded by it consists of 548 amino acids. Its amino acid sequence is shown in SEQ ID NO.2, and the theoretical molecular weight of the protein is about 61.91 kDa. The structural information of alginate lyase AlyW1 was analyzed using Simple Modular Architecture Research Tool (SMART, http: / / smart.embl_heidelberg.de / ). According to the results of the NCBI conserved domain database, the N-terminus and C-terminus of AlyW1 both contain alginate lyase domains (Alginate_lyase2superfamily), such as Figure 1 A. AlyW1 was analyzed by neighbor-joining tree with other types of alginate lyases that have been identified. AlyW1 was in the same evolutionary branch as the PL38 family. Blast software online comparison showed that its closest sequence homolog was AlyPI (13%).

[0043] NCBI analysis results show alginate lyase genes in metagenomic libraries alyw2 The gene coding region is 1344 bp long, and its nucleotide sequence is shown in SEQ ID NO.3. Alginate lyase gene alyw2The GC content is 49.26%, and the alginate lyase AlyW2 encoded by it consists of 447 amino acids. Its amino acid sequence is shown in SEQ ID NO.4, and the theoretical molecular weight of the protein is about 48.03 kDa. According to the results of the NCBI conserved domain database, AlyW2 contains a carbohydrate domain (CBM_4_9 superfamily) and an alginate lyase domain (Alginate_lyase2superfamily), such as Figure 1 As shown in B. Neighbor-joining tree analysis showed that AlyW2 belonged to the PL7 family, and its closest sequence homolog was AlyPI (36%).

[0044] Example 4 alyw1 and alyw2 Recombinant gene expression in E. coli The high molecular weight genomic DNA prepared in Example 2 was used as a template for PCR amplification, and the primers were as follows: Forward Primer alyw1 -F:ATCTGTATACATATGACTGACACTGACATGGTAGCGCCATAC(SEQ IDNO.5); Reverse primer alyw1 -R: GTGGTGGTGCTCGAGTAAATGCTCAGTACTCAACGCACTG (SEQ IDNO.6); Forward Primer alyw2 -F: ATCTGTATACATATGGCCGAAGTCAATCTCGTTAACCCAAG (SEQ IDNO.7); Reverse primer alyw2 -R: GTGGTGGTGCTCGAGCGGGAATTCATACCCGTCGTGCGAG (SEQ IDNO.8); Prime STAR Max DNA polymerase was purchased from Solebio Biotechnology, and the PCR reaction system was operated according to the product instructions provided by the company.

[0045] PCR amplification reaction conditions were as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 40 s, annealing at 60 °C for 30 s, extension at 72 °C for 2 min, 35 cycles; extension at 72 °C for 10 min, and stabilization at 4 °C for 15 min.

[0046] alyw1 and alyw2After the gene fragment was amplified by PCR, the recombinase Exnase II, pET-30a expression vector and PCR amplification product were used to prepare the recombination reaction system. The recombination reaction was completed at 37°C for 30 min to achieve in vitro cyclization of the two linear DNAs. The recombinant products were directly transformed into Escherichia coli DH5α (purchased from Nanjing Novozymes) strains, spread on LB medium solid plates containing 50 µg / mL kanamycin, and cultured at 37°C for 12-14 h. Single clones were picked and transferred to liquid LB medium containing 50 µg / mL kanamycin. After culturing at 37°C and 200 rpm for 12-14 h, the corresponding forward primers and reverse primers were used for bacterial liquid PCR verification. The results showed that the amplification products of the correct size were obtained, which preliminarily proved that the two sets of recombinant plasmids constructed were correct. 20 µL of the recombinant plasmids were taken out and sent to Sangon Biotech for sequencing. The sequencing results showed that alyw1 Gene fragment (SEQ ID NO.1) and alyw2 The gene fragments (SEQ ID NO.3) were successfully inserted into the restriction sites of the pET-30a expression vector in the correct direction, and no base mutation, deletion or addition occurred, which further proved that the constructed recombinant plasmids were correct. The recombinant plasmids were named pET30a-alyw1 and pET30a-alyw2, respectively.

[0047] The above-mentioned recombinant enzyme Exnase II was purchased from Solebio Biotechnology Co., Ltd., and the pET-30a expression vector was purchased from Novagen Corporation in the United States. The enzyme-substrate reaction system, reaction temperature and reaction time all followed the instruction manual.

[0048] The recombinant plasmids pET30a-alyw1 and pET30a-alyw2 were transformed into Escherichia coli BL21 (DE3) (purchased from Nanjing Novozyme Co., Ltd.), and then the recombinant bacteria were induced to express alginate lyase AlyW1 and AlyW2 according to the operation steps provided by the company. The target proteins were purified by Ni-sepharose™ 6 Fast Flow (manufactured by GE Healthcare) gel filtration chromatography, and the purified target proteins were detected by polyacrylamide gel electrophoresis. The detection results are shown in FIG. Figure 2 As shown in A and B, the purified alginate lyase AlyW1 and AlyW2 both showed single bands on the electrophoresis gel, and the positions were consistent with the predicted molecular weights, and the purity reached 95%.

[0049] Example 5 Analysis of Enzymatic Properties of Alginate Lyase AlyW1 and AlyW2 DNS method (3,5-dinitrosalicylic acid method) to determine enzyme activity: Enzyme activity is determined by measuring the absorbance change of the colored product generated by the reaction of the aldehyde group produced by the reducing sugar with DNS. The absorbance of the colored product generated by the reaction of the aldehyde group with DNS is proportional to the concentration of the reducing sugar. The concentration of the reducing sugar can be indirectly determined by measuring the change in absorbance, thereby inferring the enzyme activity.

[0050] 1. Effect of temperature on enzyme activity First, 5 mg / mL Alg, 150 mM NaH2PO4-Na2HPO4 buffer (pH 8.0), alginate lyase AlyW1 or AlyW2 enzyme solution (0.05 mg / mL) and deionized water were mixed in a ratio of 10:10:3:7 (volume ratio), and reacted at 0 ℃, 10 ℃, 20 ℃, 30 ℃, 40 ℃, 50 ℃, 60 ℃, and 70 ℃ for 30 min. After the reaction, the enzyme activity was determined by the DNS method, and the optimal enzyme activity was defined as 100% relative enzyme activity. The test results are shown in Figure 2. Figure 3 As shown. Figure 3 As shown in A, the relative enzyme activity of alginate lyase AlyW1 to Alg is above 70% at 25-35 ℃. Figure 3 As shown in Figure B, the relative enzyme activity of alginate lyase AlyW2 to Alg was above 70% at 15-35 ℃. When the reaction temperature was above 35 ℃, the enzyme activities of alginate lyase AlyW1 and AlyW2 decreased rapidly. Among them, the alginate lyase AlyW1 and AlyW2 reached the maximum enzyme activity to Alg at 30 ℃, indicating that the optimal reaction temperature of alginate lyase AlyW1 and AlyW2 to Alg was 30 ℃.

[0051] 2. Effect of pH on enzyme activity 5 mg / mL Alg, reaction buffer, alginate lyase AlyW1 or AlyW2 enzyme solution (0.05 mg / mL) and deionized water were mixed in a ratio of 10:10:3:7 (volume ratio). The reaction buffer included 150 mM NaAc-HAc buffer (pH5.0-6.0), 150 mM NaH2PO4-Na2HPO4 buffer (pH6.0-8.0), and 150 mM Tris-HCl buffer (pH7.0-10.0). The reaction was carried out at the optimal temperature for 30 minutes. After the reaction, the enzyme activity was determined by the DNS method. The optimal enzyme activity was defined as 100% relative enzyme activity. The test results are shown in Figure 2. Figure 4 As shown. Figure 4As shown in A, the alginate lyase AlyW1 has the highest enzyme activity against Alg in NaH2PO4-Na2HPO4 buffer (pH 8.0). Figure 4 As shown in B, the enzyme activity of alginate lyase AlyW2 towards Alg is the highest in NaH2PO4-Na2HPO4 buffer (pH 7.0).

[0052] 3. Effect of temperature on enzyme stability 5 mg / mL Alg, 150 mM NaH2PO4-Na2HPO4 buffer (pH8.0 / pH7.0), alginate lyase AlyW1 or AlyW2 enzyme solution (0.05 mg / mL) heat-treated at different temperatures (0℃, 10℃, 20℃, 30℃, 40℃, 50℃, 60℃, 70℃) for 1, 2, 4, 8, 12, 24 h, and deionized water were mixed in a ratio of 10:10:3:7 (volume ratio), and the enzyme activity was determined by the DNS method at the optimal temperature and optimal pH. The enzyme activity of the enzyme solution without heat treatment was defined as 100% relative enzyme activity. The test results are shown in Figure 5 As shown. Figure 5 As shown in A, the relative enzyme activity of alginate lyase AlyW1 to Alg decreased sharply after being heat treated at an environment above 20 ℃ for 1 h, and lost its activity after 4 h, indicating that temperature has a great influence on the stability of alginate lyase AlyW1 and it is not resistant to high temperature. In contrast, the relative enzyme activity of alginate lyase AlyW2 to Alg remained above 60% after being heat treated at 0-60 ℃ for 12 h. The test results are shown in Figure 5 As shown in B. Subsequently, the alginate lyase AlyW2 enzyme solution was heat treated at different high temperatures (70 ℃, 80 ℃, 90 ℃, 100 ℃) for 0.5, 1, 4, and 12 h, and its enzyme activity was measured. It was found that the alginate lyase AlyW2 still maintained a relative enzyme activity of more than 65% after heat treatment at 70 ℃ for 2 h, and completely lost its enzyme activity after heat treatment at 90 ℃-100 ℃ for 4 h. The test results are shown in Figure 5 As shown in C, it shows that alginate lyase AlyW2 is an extremely thermostable enzyme.

[0053] 4. Effect of metal ions on enzyme activity 5 mg / mL Alg, 150 mM pH8.0 / pH7.0 NaH2PO4-Na2HPO4 buffer, alginate lyase AlyW1 or AlyW2 enzyme solution (0.05 mg / mL) and deionized water were mixed in a ratio of 10:10:3:7 (volume ratio). Then different metal ions were added to the reaction system with a final concentration of 5 mM. The reaction was carried out under the optimal conditions for 30 min. After the reaction, the enzyme activity was detected by the DNS method. The enzyme activity without the addition of metal ions was defined as 100% relative enzyme activity. The test results are shown in Figure 6 As shown. Figure 6 As shown in A, Na + , K + , Ca 2+ , imidazole, glycerol, and DTT (dithiothreitol) strongly promoted the activity of alginate lyase AlyW1. 2+ , Ba 2+ , Fe 2+ , Fe 3+ , β-mercaptoethanol (2-mercaptoethanol), Cr 3+ The enzyme activity of alginate lyase AlyW1 was slightly inhibited by Hg 2+ , Cu 2+ 、Cd 3+ , Pb 2+ 、Zn 2+ 、Co 2+ 、Ni 2+ 、Ag + , Mn 2+ , EDTA (ethylenediaminetetraacetic acid) and SDS have a strong inhibitory effect on the enzymatic activity of alginate lyase AlyW1; Figure 6 As shown in B, Na + , K + , Ca 2+ , imidazole, glycerol, and DTT strongly promoted the activity of alginate lyase AlyW2. 2+ , Ba 2+ , Fe 2+ , Fe 3+ , β-mercaptoethanol, Cr 3+ It showed a weak inhibitory effect on the activity of alginate lyase AlyW2. + , Hg 2+ , Cu 2+ 、Cd 3+ , Pb 2+ 、Zn 2+ 、Co2+ 、Ni 2+ 、Ag + , Mn 2+ , EDTA and SDS have a strong inhibitory effect on the enzymatic activity of alginate lyase AlyW2.

[0054] Example 6 Determination of the Enzyme Activities of Alginate Lyase AlyW1 and AlyW2 5 mg / mL Alg, 150 mM pH8.0 / pH7.0 NaH2PO4-Na2HPO4 buffer, alginate lyase AlyW1 or AlyW2 enzyme solution (0.05 mg / mL) and deionized water were mixed in a ratio of 10:10:3:7 (volume ratio), and the reactions were carried out under the optimal conditions with a reaction time of 1-5 min. An equal amount of inactivated alginate lyase AlyW1 or AlyW2 enzyme solution was added to the negative control. After the reaction, the enzyme activity was determined according to the DNS method mentioned above.

[0055] The enzyme activities against poly M and poly G substrates were determined according to the above method.

[0056] Definition of enzyme activity unit (U): the amount of enzyme required to generate 1 μmoL of product containing unsaturated double bonds per minute.

[0057] At the same time, the protein content of alginate lyase AlyW1 and AlyW2 enzyme solutions was determined using a protein quantification kit purchased from Kangwei Century Company. The results showed that the enzyme activities of alginate lyase AlyW1 against Alg, poly M, and poly G polysaccharides were 251.76 U / mg, 222.85 U / mg, and 255.53 U / mg, respectively; the enzyme activities of alginate lyase AlyW2 against Alg, poly M, and poly G polysaccharides were 208.95 U / mg, 96.56 U / mg, and 235.35 U / mg, respectively.

[0058] Example 7 HPLC analysis of degradation products of different substrates by alginate lyases AlyW1 and AlyW2 5 mg / mL substrate (Alg, poly M and poly G), 150 mM NaH2PO4-Na2HPO4 buffer (pH8.0 / pH7.0), alginate lyase AlyW1 or AlyW2 enzyme solution (0.05 mg / mL) and deionized water were mixed in a ratio of 10:10:3:7 (volume ratio), and reacted overnight under optimal conditions. The degradation products were analyzed by HPLC. The HPLC analysis conditions were as follows: gel column: superdex peptide 10 / 300 GL (GE); mobile phase: 0.2 M ammonium bicarbonate; flow rate: 0.4 mL / min; detection conditions: UV 232 nm.

[0059] Test results such as Figure 7 , Figure 8 As shown, the alginate lyase AlyW1 degrades Alg ( Figure 7 A) and poly M polysaccharide ( Figure 7 B), the final product is a series of unsaturated oligosaccharides, including unsaturated disaccharides to unsaturated heptasaccharides, and the degradation of poly G polysaccharides ( Figure 7 C), the final products include unsaturated disaccharides to unsaturated hexasaccharides; alginate lyase AlyW2 degrades Alg ( Figure 8 A) and poly M polysaccharide ( Figure 8 B), the final product is a series of unsaturated oligosaccharides, including but not limited to unsaturated disaccharides to unsaturated heptasaccharides, and the degradation of poly G polysaccharides ( Figure 8 C), the final products include unsaturated disaccharides, unsaturated trisaccharides, and unsaturated tetrasaccharides; both alginate lyases are more inclined to degrade the poly G segment.

[0060] Example 8 Degradation patterns of alginate lyases AlyW1 and AlyW2 5 mg / mL Alg, alginate lyase AlyW1 or AlyW2 enzyme solution (0.05 mg / mL), 150 mM NaH2PO4-Na2HPO4 buffer (pH8.0 / pH7.0) and deionized water were mixed in a ratio of 10:3:10:7 (volume ratio), and reacted at the optimal temperature and pH conditions, respectively. The degradation products of different enzymatic hydrolysis times were selected for HPLC analysis. The HPLC analysis conditions were as follows: gel column: superdex peptide 10 / 300 GL (GE); mobile phase: 0.2 M ammonium bicarbonate; flow rate: 0.4 mL / min; detection conditions: UV 232 nm.

[0061] Test results such as Fig. 9 , Fig.10As shown, when alginate lyases AlyW1 and AlyW2 degraded Alg, they first generated a large amount of large molecular weight unsaturated oligosaccharides, then the large molecular weight oligosaccharides were gradually degraded into smaller molecular weight oligosaccharides, and finally a series of unsaturated oligosaccharides were generated, including but not limited to unsaturated disaccharides to unsaturated heptasaccharides. This result indicates that alginate lyases AlyW1 and AlyW2 are both endonucleases.

[0062] Example 9 Effects of alginate lyases AlyW1 and AlyW2 on removing Pseudomonas aeruginosa biofilm Pseudomonas aeruginosa PAO1 (purchased from Beijing Bio-Bowei Biotechnology) was placed in LB liquid culture medium and activated overnight at 37°C and 200rpm. A 96-well plate was used, and 200 μL of LB liquid culture medium was added to each well. The PAO1 bacterial solution activated overnight and diluted 1000 times was added at a 1% inoculum, and cultured at 37°C for 5 days to form a mature biofilm. Three groups of experiments were set up for alginate lyase AlyW1 and AlyW2, and the concentrations of alginate lyase AlyW1 and AlyW2 were 2 mg / mL, 1 mg / mL, and 0.5 mg / mL, respectively. After continuing to culture for 24 h, the OD 600 , in order to determine the extent to which alginate lyase removes biofilm, the results are as follows Fig.11 As shown in the figure, both alginate lyase AlyW1 and AlyW2 have a clearing effect on Pseudomonas aeruginosa biofilm, and as the concentration of alginate lyase AlyW1 or AlyW2 increases, the residual degree of biofilm decreases and the clearing effect increases.

Claims

1. A bifunctional endo-alginic acid lyase, characterized in that: The bifunctional endo-algin lyase is AlyW1 or AlyW2, the amino acid sequence of AlyW1 is shown as SEQ ID NO.2, and the amino acid sequence of AlyW2 is shown as SEQ ID NO.

4.

2. A coding gene, characterized in that The encoding gene may encode the alginate lyase AlyW1 or AlyW2 according to claim 1.

3. The coding gene according to claim 2, characterized in that The nucleotide sequence of the gene encoding alginate lyase AlyW1 is shown as SEQ ID NO.1, and the nucleotide sequence of the gene encoding alginate lyase AlyW2 is shown as SEQ ID NO.

3.

4. A recombinant expression vector, characterized in that: Insertion into expression vector The invention relates to a gene encoding the alginate lyase AlyW1 or AlyW2 according to claim 2 or claim 3.

5. The recombinant expression vector according to claim 4, characterized in that The expression vector is an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a bacteriophage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector or a mammalian cell expression vector.

6. A recombinant cell, characterized in that The gene encoding the alginate lyase AlyW1 or AlyW2 according to claim 2 or claim 3 or the recombinant expression vector according to claim 4 is inserted into the host cell.

7. The recombinant cell according to claim 6, characterized in that The host cell is an Escherichia coli host cell, a yeast host cell, a Bacillus subtilis host cell, a lactic acid bacteria host cell, an actinomycete host cell, a filamentous fungus host cell, an insect cell or a mammalian cell.

8. Use of the recombinant cell according to claim 6 or claim 7 in recombinantly expressing the alginate lyase AlyW1 or AlyW2 according to claim 1.

9. Use of the alginate lyase AlyW1 or AlyW2 according to claim 1 in the preparation of alginate oligosaccharides.

10. Use of the alginate lyase AlyW1 or AlyW2 according to claim 1 in resisting Pseudomonas aeruginosa biofilm.

Images