Method for inhibiting expression of receptor tyrosine kinase EPHA2 and application of RNA

Abstract

According to the method for inhibiting the expression of the receptor tyrosine kinase EPHA2, the expression of the tumor cell receptor tyrosine kinase EPHA2 is inhibited by regulating and controlling the expression of targeted ubiquitin ligase RNF114, and the mode of regulating and controlling the targeted ubiquitin ligase RNF114 comprises the steps of knocking down the expression level of RNF114 protein through an RNA interference technology or knocking out an RNF114 protein expression gene through a CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated 9) method. Biochemistry and tumor molecular biology means are utilized, and ubiquitination of the ubiquitin ligase RNF114 regulating receptor tyrosine kinase EPHA2 and the effect of the ubiquitin ligase RNF114 in liver cancer cell proliferation and migration are researched. Meanwhile, by designing specific siRNA, shRNA and sgRNA, expression of RNF114 in liver cancer cells is effectively knocked down or knocked out, and it is found that proliferation and migration capacity of the liver cancer cells can be effectively inhibited.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, in particular to a method for inhibiting the expression of receptor tyrosine kinase EPHA2 and application RNA. Background Art

[0002] Hepatocellular carcinoma (HCC) is the sixth most common malignant tumor in the world and the third leading cause of cancer-related death, with a 5-year survival rate of only 18%. At present, the main treatments for HCC include surgical treatment, radiofrequency ablation, transarterial chemoembolization (TACE) and other physical treatments. Epidemiological surveys have found that in 2020, there were 410,000 new cases of liver cancer in China and 390,000 deaths, making it the second most common cancer that seriously endangers the health of our country's citizens. The similar incidence and mortality rates of liver cancer indicate that the prognosis of liver cancer is extremely poor, and patients do not benefit well from existing treatments. The main reason is the lack of specific target proteins and targeted drugs. Therefore, finding new therapeutic targets for HCC and developing more effective therapeutic drugs and methods are crucial to reducing the mortality rate of HCC patients.

[0003] Ubiquitin is a small signaling protein that can bind to substrates. It consists of 76 amino acids and is only 8.56 kDa. Ubiquitin protein can be covalently linked to substrate proteins by the ubiquitin E1-E2-E3 enzyme cascade reaction, a process called ubiquitination. Ubiquitination modification is an important component of post-translational modification of proteins and can change the function of substrate proteins. To date, more than 14,692 ubiquitinated proteins and at least 43,948 ubiquitination sites have been detected in the human genome, which means that the ubiquitination process is involved in complex signal regulation. Abnormal ubiquitination process is closely related to many human diseases, such as cancer, autoimmune diseases, neurodegenerative diseases and viral diseases. Ubiquitination modification is a specific process, and its specificity is mainly determined by E3 ubiquitin ligase. More and more studies have shown that ubiquitin ligase is a proto-oncoprotein or tumor suppressor of HCC and can be used as one of the targets for tumor treatment.

[0004] RNF114 is a ubiquitin ligase that has been less studied so far, and its biological function and mechanism of action in liver cancer are unclear. The present invention finds that RNF114 is specifically highly expressed in liver cancer cells and is closely related to the occurrence and development of liver cancer, so it is an innovative target protein for liver cancer treatment.

[0005] EPHA2 belongs to receptor tyrosine kinase and is closely related to the occurrence and development of tumors. Previous studies have shown that by inhibiting the activity of EPHA2 kinase, tumor cell proliferation can be significantly inhibited, thereby playing a role in treating pancreatic cancer. At present, the development of drugs targeting EPHA2 in tumors has received widespread attention from researchers, but the clear mechanism of upregulated expression of EPHA2 in tumors remains unclear. Therefore, intervention measures targeting EPHA2 expression are one of the effective strategies for controlling the occurrence and development of tumors in clinical practice. Summary of the invention

[0006] The purpose of this application is to provide a method and application RNA for inhibiting the expression of receptor tyrosine kinase EPHA2. RNF114 ubiquitinates EPHA2 to increase the protein stability of EPHA2, thereby promoting the proliferation and migration of liver cancer cells. Therefore, by inhibiting the expression and activity of RNF114, the proliferation and migration of liver cancer cells can be effectively inhibited.

[0007] The above technical objectives of the present invention are achieved through the following technical solutions: a method for inhibiting the expression of receptor tyrosine kinase EPHA2, which inhibits the expression of tumor cell receptor tyrosine kinase EPHA2 by regulating the expression of targeted ubiquitin ligase RNF114; Regulating the targeting of ubiquitin ligase RNF114 includes the following: Knock down the expression level of RNF114 protein by RNA interference technology; or The RNF114 protein expression gene was knocked out by CRISPR / Cas9 method.

[0008] An interfering RNA for knocking down the RNF114 protein in a cell, wherein the nucleotide sequence of the siRNA is as shown in SEQ ID No. 1 and SEQ ID No. 2 and / or the nucleotide sequence of the shRNA is as shown in SEQ ID No. 3 and SEQ ID No. 4, and the expression of the RNF114 protein in the cell is silenced by gene knockdown technology.

[0009] Furthermore, the siRNA and / or shRNA is used in biological preparations for inhibiting cancer cell proliferation and migration.

[0010] Furthermore, the biological preparation also includes other biologically acceptable ligands.

[0011] A sgRNA for knocking out a cell RNF114 protein, wherein the nucleotide sequence is shown in SEQ ID No.5, or the nucleotide sequence is shown in SEQ ID No.6; the sgRNA performs gene editing on the RNF114 protein through gene knockout technology to inhibit its expression.

[0012] Furthermore, the sgRNA is used in biological preparations that inhibit cancer cell proliferation and migration.

[0013] Furthermore, the biological preparation also includes other biologically acceptable ligands.

[0014] In summary, the present invention has the following beneficial effects: This invention uses biochemistry and tumor molecular biology methods to mainly study how the ubiquitin ligase RNF114 promotes the occurrence and development of liver cancer by regulating the ubiquitination and expression of the receptor tyrosine kinase EPHA2. By studying how RNF114 ubiquitinates EPHA2 in liver cancer cells, regulates the expression of EPHA2 and its role in the proliferation and metastasis of liver cancer cells, the role of RNF114 in regulating the expression of EPHA2 and the functional changes of liver cancer cells caused by the RNF114-EPHA2 signal axis are clarified, thereby further revealing the mechanism of the occurrence and development of liver cancer.

[0015] At the same time, the present invention uses RNA interference technology to knock down the expression of RNF114 in liver cancer cells by designing specific siRNA and shRNA of RNF114. In addition, the present invention uses CRISPR / Cas9 technology to design a small guide RNA (sgRNA) that can specifically knock out RNF114. Using these two technologies, the present invention effectively knocks out or knocks down the expression of RNF114 in liver cancer cells, and it is found that it can effectively inhibit the proliferation and migration ability of liver cancer cells.

[0016] RNF114 is the latest liver cancer target protein discovered by the present invention. Currently, there is no therapeutic strategy targeting RNF114 which is highly expressed in liver cancer. Therefore, the present invention is a groundbreaking invention. RNF114 enhances the expression of EPHA2 through ubiquitination regulation. Therefore, the targeting strategy for RNF114 can also be extended to other cancer types. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 for tumor cell viability after knockdown of RNF114 in HLF cells; Figure 2 for tumor cell viability after knockdown of RNF114 in Hep3B cells; Figure 3 for tumor cell viability after knockdown of RNF114 in Huh7 cells; Figure 4 is the tumor cell viability after knocking out RNF114 in Huh7 cells; Figure 5 is the inhibition rate of cell clone formation ability after knocking down or knocking out RNF114 in Huh7 cells; Figure 6is the inhibition rate of cell clone formation ability after knocking down RNF114 in Hep3B cells; Figure 7 The apparent plate was used to show the inhibition of cell colony formation ability after knockdown or knockout of RNF114 in Huh7 cells; Figure 8 The apparent plate was used to show the inhibition of cell clone formation ability after knockdown of RNF114 in Hep3B cells; Fig. 9 To knock down RNF114 and inhibit the scratch healing ability of Hep3B cells; Fig.10 Showing pictures for scratch healing experiment of Hep3B cells after knocking down RNF114; Fig.11 To investigate the inhibition rate of RNF114 knockdown on the migration ability of Huh7 cells; Fig.12 The picture shows the inhibition of Huh7 cell migration ability by knocking down RNF114. DETAILED DESCRIPTION

[0018] The present invention is described in detail below in conjunction with the accompanying drawings and embodiments.

[0019] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0020] Example 1: Knockout or knockdown of RNF114 inhibits the proliferation of liver cancer cells Human liver cancer cell lines Huh7, Hep3B and HLF were selected, and the cells were inoculated in DMEM cell culture medium containing 10% fetal bovine serum, placed in a cell culture incubator at 37°C with 5% CO2, and passaged every 2 days. RNF114 was knocked out in Huh7 cells by CRISPR / Cas9 method; RNF114 in Hep3B and Huh7 cells was knocked down by shRNA technology; RNF114 was silenced in Huh7 and HLF cell lines by siRNA technology (specific sequences are shown in Table 1), and the regulation of RNF114 on the proliferation ability of liver cancer cells was evaluated by combining the following biological function experiments.

[0021] Table 1 RNF114 siRNA, shRNA and gRNA sequences name sequence siRNF114-1 (SEQ ID No. 1) GUGUGAAGGCCACCAUUAA siRNF114-2 (SEQ ID No. 2) GCUUAGAGGUGUACGAGAA shRNF114-1 (SEQ ID No. 3) CCATGGCTGCCGTAAGAATTT shRNF114-2 (SEQ ID No. 4) CGCCAACTTCAGAGAGCACAT sgRNF114-1 (SEQ ID No. 5) GGACACGTGAAGCGTCCTAG sgRNF114-2 (SEQ ID No. 6) GGTGTACGAGAAGCCGGTAC sF3 GAGCTCCCGTGAATTGGAATC siCK GAUCCGCAGCGACAUCAACCU ikB GATCCGCAGCGACATCAACCT The designed siRNA nucleotide sequence has a dTdT or UU sequence added to its 3' end. siCK is a siRNA technology control; shCK is a shRNA technology control; sgFF3 is a CRISPR / Cas9 method control.

[0022] 1.1. CCK8 experiment: After HLF, Huh7 and Hep3B cells were treated accordingly, the cell lines with knockout or knockdown of RNF114 were obtained and their counts were diluted to 10 4 / mL, 1000 cells (100μL) were added to a 96-well cell culture plate per well, and 5 parallel wells were set up for each group. 100μL PBS was added to the outermost wells of the 96-well plate, and the plate was placed in a 37°C incubator for continued culture. At each time point to be measured, the culture medium was discarded, 100μL of fresh culture medium containing 10% CCK8 was added to each well, and the plate was placed in a cell culture incubator for incubation for 2 hours. The absorbance (OD value) was detected by an enzyme reader, the detection wavelength was 450 nm, and the reference wavelength was 650 nm. Data processing: Relative cell viability value = OD value of the experimental group (or OD value of the control group) / OD value of the control group on the first day. GraphPad Prism software v7.0 was used for plotting. Specific results are shown in Tables 2-5 and Figure 1-Figure 3 .

[0023] Table 2 Tumor cell viability after knockout of RNF114 in HLF cells Number of days siCK siRNF114-1 siRNF114-2 Day 0 1 1 1 1 day 2.46 2.03 2.37 2 days 6.93 4.52 5.42 3 days 11.37 7.52 8.28 Table 3 Tumor cell viability after knockdown of RNF114 in Huh7 cells Number of days siCK siRNF114-1 siRNF114-2 Day 0 1 1 1 1 day 2.02 0.95 1.49 2 days 3.75 1.22 2.06 3 days 6.81 3.03 3.41 Table 4 Tumor cell viability after knockdown of RNF114 in Hep3B cells Number of days ikB shRNF114-1 shRNF114-2 Day 0 1 1 1 1 day 2.67 1.93 1.94 2 days 11.12 7.41 10.37 3 days 26.98 15.21 23.07 4 days 52.7 30.38 41.8 5 days 72.52 41.12 55.53 6 days 73.28 52.31 75.02 Table 5 Tumor cell viability after knockout of RNF114 in Huh7 cells Number of days sF3 sgRNF114-1 sgRNF114-2 Day 0 1 1 1 1 day 2.34 2.40 2.57 2 days 5.51 4.46 4.66 3 days 11.10 6.84 7.00 4 days 19.34 10.27 11.15 5 days 31.22 13.80 17.94 6 days 41.73 18.40 23.01 1.2. Clone formation experiment: After Huh7 and Hep3B cells were treated accordingly, cell lines with knockout or knockdown of RNF114 were obtained, and the cells were gradiently diluted to 1000 cells / mL with culture medium. 1000 diluted cells were inoculated into a 6-well plate and repeated 3 times. After the clones were visible to the naked eye, the culture medium was removed, the cells were gently washed once with PBS, fixed with methanol for 15 minutes, and stained with crystal violet for 10 minutes. After staining, the cells were slowly washed with running water, dried, and photographed. Data processing: Image J software was used for statistics, and the clone formation ability inhibition rate = (control group clone density - experimental group clone density) / control group clone density × 100%. Specific results are shown in Table 6 and Figure 5-8 .

[0024] Table 6 Inhibition rate of cell clone formation ability after knockout or knockdown of RNF114 in Huh7 and Hep3B cells Example 2: Knockdown of RNF214 inhibits the migration ability of liver cancer cells Hep3B or Huh7 liver cancer cell lines were selected, and the cells were inoculated in DMEM cell culture medium containing 10% fetal bovine serum, placed in a cell culture incubator at 37°C and 5% CO2, and passaged every 2 days. RNF114 in Hep3B or Huh7 cells was knocked down by shRNA or siRNA technology, and the regulation of RNF114 on the migration ability of liver cancer cells was evaluated by combining the following biological function experiments.

[0025] 2.1. Scratch healing experiment: Hep3B cells with RNF114 knockdown were plated in 6-well plates, and when the cells were fully grown, they were starved overnight with serum-free DMEM culture medium. The next morning, a 10μL pipette tip was used to touch the 6-well plate cover to draw a straight line in the center of each well. The culture medium was discarded, and after washing with PBS, the cells were continued to be cultured with serum-free DMEM and photographed. Pictures were taken every 24 hours to observe the healing of the scratches. Data processing: Image J software was used for statistics, and the cell migration ability inhibition rate = (scratch healing rate of the experimental group - scratch healing rate of the control group) / scratch healing rate of the control group × 100%. The specific results are shown in Table 7 and Figure 9-10 .

[0026] Table 7 Inhibition rate of RNF114 knockdown on the scratch healing ability of Hep3B cells 2.2. Transwell migration assay: RNF114 knockdown Huh7 cells were resuspended in serum-free DMEM and the cell density was adjusted to 2×10 5 / mL. Take 300μL of cell suspension and add it to the Transwell chamber (without laying matrix gel), add 500μL of DMEM containing 10% FBS to the lower chamber, and continue to culture in a 37℃ cell culture incubator for 48 hours. Gently wipe the cells in the upper chamber with a cotton swab, wash twice with PBS, fix with methanol for 30 minutes, and stain with crystal violet for 10 minutes. Gently wash off the staining solution with clean water, and observe under a microscope. Data processing: Use Image J software for statistics, cell migration inhibition rate = (cell migration ability of the control group - cell migration (ability) of the experimental group / cell migration ability of the control group × 100%. Specific results are shown in Table 8 and Figure 11-12 .

[0027] Table 8 Inhibition rate of RNF114 knockdown on Huh7 cell migration ability It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

Claims

1. A method for inhibiting the expression of receptor tyrosine kinase EPHA2, characterized in that: Inhibits the expression of tumor cell receptor tyrosine kinase EPHA2 by regulating the expression of targeted ubiquitin ligase RNF114; Regulating the targeting of ubiquitin ligase RNF114 includes the following: Knock down the expression level of RNF114 protein by RNA interference technology; or The RNF114 protein expression gene was knocked out by CRISPR / Cas9 method.

2. An interfering RNA for knocking down cellular RNF114 protein, characterized in that: The siRNA with nucleotide sequences such as SEQ ID No.1 and SEQ ID No.2 and / or the shRNA with nucleotide sequences such as SEQ ID No.3 and SEQ ID No.4 silence the expression of RNF114 protein in cells through gene knockdown technology. The siRNA shown in SEQ ID No. 1 was named siRNF114-1; The siRNA shown in SEQ ID No. 2 was named siRNF114-2; The shRNA shown in SEQ ID No. 3 was named shRNF114-1; The shRNA shown in SEQ ID No. 4 was named shRNF114-2.

3. The interfering RNA for knocking down RNF114 in human cells according to claim 2, characterized in that The siRNA and / or shRNA is used in biological preparations for inhibiting cancer cell proliferation and migration.

4. The interfering RNA for knocking down RNF114 in human cells according to claim 3, characterized in that The biological preparation also includes other biologically acceptable ligands.

5. A sgRNA for knocking out cell RNF114 protein, characterized in that: Its nucleotide sequence is shown in SEQ ID No.5, or its nucleotide sequence is shown in SEQ ID No.6; the sgRNA performs gene editing on the RNF114 protein through gene knockout technology to inhibit its expression; The sgRNA shown in SEQ ID No. 5 was named sgRNF114-1; The sgRNA shown in SEQ ID No.6 was named sgRNF114-2.

6. The sgRNA for knocking out cell RNF114 protein according to claim 5, characterized in that The sgRNA is used in biological preparations for inhibiting cancer cell proliferation and migration.

7. The sgRNA for knocking out cell RNF114 protein according to claim 6, characterized in that The biological preparation also includes other biologically acceptable ligands.

Images