A method for inhibiting expression of receptor tyrosine kinase EPHA2 and application of RNA

Abstract

A method for inhibiting expression of receptor tyrosine kinase EPHA2, which comprises inhibiting expression of receptor tyrosine kinase EPHA2 of tumor cells by regulating expression of a ubiquitin ligase RNF114, and the mode of regulating the ubiquitin ligase RNF114 comprises knocking down expression level of RNF114 protein by RNA interference technology, or knocking out RNF114 protein expression gene by CRISPR / Cas9 method. The present application uses biochemical and tumor molecular biology means to study ubiquitination of receptor tyrosine kinase EPHA2 regulated by ubiquitin ligase RNF114 and its role in proliferation and migration of hepatocarcinoma cells. Meanwhile, the present application effectively knocks down or knocks out expression of RNF114 in hepatocarcinoma cells by designing specific siRNA, shRNA and sgRNA, and finds that the proliferation and migration ability of hepatocarcinoma cells can be effectively inhibited.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, in particular to a method for inhibiting the expression of receptor tyrosine kinase EPHA2 and RNA used therein. Background Art

[0002] Hepatocellular carcinoma (HCC) is the sixth most common malignant tumor worldwide and the third leading cause of cancer-related death, with a 5-year survival rate of only 18%. Currently, the main treatments for HCC include surgery, radiofrequency ablation, transarterial chemoembolization (TACE), and other physical therapies. The similar incidence and mortality rates of HCC indicate an extremely poor prognosis, and patients benefit poorly from existing treatments. This is primarily due to the lack of specific target proteins and targeted drugs. Therefore, identifying new therapeutic targets for HCC and developing more effective drugs and approaches are crucial to reducing the mortality rate of HCC patients.

[0003] Ubiquitin is a small signaling protein that binds to substrates. It consists of 76 amino acids and is only 8.56 kDa. Ubiquitin can be covalently attached to substrate proteins by a cascade of ubiquitin E1-E2-E3 enzymes, a process known as ubiquitination. Ubiquitination is a key component of post-translational protein modification, capable of altering the function of substrate proteins. To date, over 14,692 ubiquitinated proteins and at least 43,948 ubiquitination sites have been identified in the human genome, implying that ubiquitination is involved in complex signaling regulation. Abnormal ubiquitination is closely associated with numerous human diseases, such as cancer, autoimmune diseases, neurodegenerative diseases, and viral diseases. Ubiquitination is a specific process, whose specificity is primarily determined by the E3 ubiquitin ligase. A growing number of studies have shown that ubiquitin ligases are oncoproteins or tumor suppressors in HCC and could serve as targets for cancer therapy.

[0004] RNF114 is a poorly studied ubiquitin ligase, and its biological function and mechanism of action in liver cancer remain unclear. This study found that RNF114 is specifically and highly expressed in liver cancer cells and is closely associated with the development and progression of liver cancer, making it an innovative target protein for liver cancer treatment.

[0005] EPHA2 is a receptor tyrosine kinase that is closely associated with tumor development and progression. Previous studies have shown that inhibiting EPHA2 kinase activity can significantly inhibit tumor cell proliferation, thereby playing a therapeutic role in pancreatic cancer. Currently, the development of drugs targeting EPHA2 in tumors has attracted widespread attention, but the precise mechanism of EPHA2 upregulation in tumors remains unclear. Therefore, interventions targeting EPHA2 expression are one of the most effective clinical strategies for controlling tumor development and progression. Summary of the Invention

[0006] This application aims to provide a method and application of RNA to inhibit the expression of the receptor tyrosine kinase EPHA2. RNF114 ubiquitinates EPHA2, increasing its protein stability and thereby promoting the proliferation and migration of liver cancer cells. Therefore, by inhibiting the expression and activity of RNF114, the proliferation and migration of liver cancer cells can be effectively inhibited.

[0007] The above technical objectives of the present invention are achieved through the following technical solutions: a method for inhibiting the expression of receptor tyrosine kinase EPHA2, which inhibits the expression of tumor cell receptor tyrosine kinase EPHA2 by regulating the expression of targeted ubiquitin ligase RNF114;

[0008] Targeting of the ubiquitin ligase RNF114 can be achieved through the following methods:

[0009] Knock down the expression level of RNF114 protein by RNA interference technology; or

[0010] The RNF114 protein expression gene was knocked out by CRISPR / Cas9 method.

[0011] An interfering RNA for knocking down cellular RNF114 protein, wherein the nucleotide sequences thereof are siRNAs as shown in SEQ ID No. 1 and SEQ ID No. 2 and / or the nucleotide sequences thereof are shRNAs as shown in SEQ ID No. 3 and SEQ ID No. 4, and the expression of RNF114 protein in cells is silenced by gene knockdown technology.

[0012] Furthermore, the siRNA and / or shRNA is used in biological preparations for inhibiting cancer cell proliferation and migration.

[0013] Furthermore, the biological preparation also includes other biologically acceptable ligands.

[0014] A sgRNA for knocking out a cell RNF114 protein, the nucleotide sequence of which is shown in SEQ ID No. 5, or the nucleotide sequence of which is shown in SEQ ID No. 6; the sgRNA uses gene knockout technology to perform gene editing on the RNF114 protein to inhibit its expression.

[0015] Furthermore, the sgRNA is used in biological preparations that inhibit cancer cell proliferation and migration.

[0016] Furthermore, the biological preparation also includes other biologically acceptable ligands.

[0017] In summary, the present invention has the following beneficial effects:

[0018] This study, using biochemical and tumor molecular biology methods, primarily investigates how the ubiquitin ligase RNF114 promotes the development and progression of liver cancer by regulating the ubiquitination and expression of the receptor tyrosine kinase EPHA2. By studying how RNF114 ubiquitinates EPHA2 in liver cancer cells, regulating EPHA2 expression, and its role in liver cancer cell proliferation and metastasis, the study clarifies the role of RNF114 in regulating EPHA2 expression and the functional changes in liver cancer cells caused by the RNF114-EPHA2 signaling axis, further revealing the mechanisms of liver cancer development and progression.

[0019] At the same time, the present invention uses RNA interference technology to knock down the expression of RNF114 in liver cancer cells by designing RNF114-specific siRNA and shRNA. In addition, the present invention uses CRISPR / Cas9 technology to design small guide RNA (sgRNA) that can specifically knock out RNF114. Using these two technologies, the present invention effectively knocks out or knocks down the expression of RNF114 in liver cancer cells and is found to effectively inhibit the proliferation and migration ability of liver cancer cells.

[0020] RNF114 is a newly discovered liver cancer target protein. Currently, there are no therapeutic strategies targeting RNF114, which is highly expressed in liver cancer. Therefore, this invention is groundbreaking. RNF114 enhances EPHA2 expression through ubiquitination regulation. Therefore, the targeting strategy for RNF114 can also be extended to other cancer types. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 is the tumor cell viability after knockdown of RNF114 in HLF cells;

[0022] Figure 2 is the tumor cell viability after knockdown of RNF114 in Hep3B cells;

[0023] Figure 3 is the tumor cell viability after knockdown of RNF114 in Huh7 cells;

[0024] Figure 4 is the tumor cell viability after knocking out RNF114 in Huh7 cells;

[0025] Figure 5 is the inhibition rate of cell clone formation ability after knocking down or knocking out RNF114 in Huh7 cells;

[0026] Figure 6 is the inhibition rate of cell clone formation ability after knocking down RNF114 in Hep3B cells;

[0027] Figure 7 The apparent plate was used to show the inhibition of cell clonogenicity after knockdown or knockout of RNF114 in Huh7 cells;

[0028] Figure 8 The apparent plate is shown to inhibit the cell clonogenic ability after knockdown of RNF114 in Hep3B cells;

[0029] Figure 9 To investigate the inhibitory rate of knocking down RNF114 on the scratch healing ability of Hep3B cells;

[0030] Figure 10 Images are shown for the scratch wound healing experiment on Hep3B cells after knocking down RNF114;

[0031] Figure 11 To investigate the inhibitory rate of knocking down RNF114 on the migration ability of Huh7 cells;

[0032] Figure 12 The figure shows the inhibition of Huh7 cell migration ability after knocking down RNF114. DETAILED DESCRIPTION

[0033] The present invention is described in detail below with reference to the accompanying drawings and embodiments.

[0034] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0035] Example 1: Knockout or knockdown of RNF114 inhibits the proliferation of liver cancer cells

[0036] Human hepatocellular carcinoma cell lines Huh7, Hep3B, and HLF were selected and seeded in DMEM supplemented with 10% fetal bovine serum. The cells were cultured at 37°C in a 5% CO2 incubator and passaged every two days. RNF114 was knocked out in Huh7 cells using CRISPR / Cas9, knocked down in Hep3B and Huh7 cells using shRNA, and silenced in Huh7 and HLF cell lines using siRNA (see Table 1 for specific sequences). The following biological functional experiments were performed to evaluate the regulatory effect of RNF114 on the proliferation of hepatocellular carcinoma cells.

[0037] Table 1 RNF114 siRNA, shRNA and gRNA sequences

[0038] name sequence siRNF114-1 (SEQ ID No. 1) GUGUGAAGGCCACCAUUAA siRNF114-2 (SEQ ID No. 2) GCUUAGAGGUGUACGAGAA shRNF114-1 (SEQ ID No. 3) CCATGGCTGCCGTAAGAATTT shRNF114-2 (SEQ ID No. 4) CGCCAACTTCAGAGAGCACAT sgRNF114-1 (SEQ ID No. 5) GGACACGTGAAGCGTCCTAG sgRNF114-2 (SEQ ID No. 6) GGTGTACGAGAAGCCGGTAC sgFF3 GAGCTCCCGTGAATTGGAATC siCK GAUCCGCAGCGACAUCAACCU shCK GATCCGCAGCGACATCAACCT

[0039] The designed siRNA nucleotide sequence has a dTdT or UU sequence added to its 3' end. siCK is a control for siRNA technology; shCK is a control for shRNA technology; and sgFF3 is a control for CRISPR / Cas9 technology.

[0040] 1.1. CCK8 experiment:

[0041] After HLF, Huh7 and Hep3B cells were treated accordingly, RNF114 knockout or knockdown cell lines were obtained and their counts were diluted to 10 4 Cells / mL, 1000 cells (100 μL) were added to a 96-well cell culture plate per well, with 5 parallel wells set up for each group. 100 μL PBS was added to the outermost wells of the 96-well plate, and the plate was placed in a 37°C incubator for continued culture. At each time point to be measured, the culture medium was discarded, 100 μL of fresh culture medium containing 10% CCK8 was added to each well, and the plate was placed in a cell culture incubator for incubation for 2 hours. The absorbance (OD value) was detected by an enzyme-linked microplate reader with a detection wavelength of 450 nm and a reference wavelength of 650 nm. Data processing: Relative cell viability value = OD value of the experimental group (or OD value of the control group) / OD value of the control group on the first day. GraphPad Prism software v7.0 was used for plotting. Specific results are shown in Tables 2-5 and Figure 1-Figure 3 .

[0042] Table 2 Tumor cell viability after RNF114 knockout in HLF cells

[0043] Number of days siCK siRNF114-1 siRNF114-2 0 days 1 1 1 1 day 2.46 2.03 2.37 2 days 6.93 4.52 5.42 3 days 11.37 7.52 8.28

[0044] Table 3 Tumor cell viability after RNF114 knockdown in Huh7 cells

[0045] Number of days siCK siRNF114-1 siRNF114-2 0 days 1 1 1 1 day 2.02 0.95 1.49 2 days 3.75 1.22 2.06 3 days 6.81 3.03 3.41

[0046] Table 4 Tumor cell viability after RNF114 knockdown in Hep3B cells

[0047] Number of days shCK shRNF114-1 shRNF114-2 0 days 1 1 1 1 day 2.67 1.93 1.94 2 days 11.12 7.41 10.37 3 days 26.98 15.21 23.07 4 days 52.7 30.38 41.8 5 days 72.52 41.12 55.53 6 days 73.28 52.31 75.02

[0048] Table 5 Tumor cell viability after RNF114 knockout in Huh7 cells

[0049] Number of days sgFF3 sgRNF114-1 sgRNF114-2 0 days 1 1 1 1 day 2.34 2.40 2.57 2 days 5.51 4.46 4.66 3 days 11.10 6.84 7.00 4 days 19.34 10.27 11.15 5 days 31.22 13.80 17.94 6 days 41.73 18.40 23.01

[0050] 1.2. Clone formation experiment:

[0051] After Huh7 and Hep3B cells were treated accordingly, cell lines with RNF114 knockout or knockdown were obtained, and the cells were gradiently diluted with culture medium to 1000 cells / mL. 1000 diluted cells were inoculated into 6-well plates and repeated three times. After the clones were visible to the naked eye, the culture medium was removed, the cells were gently washed once with PBS, fixed with methanol for 15 minutes, and stained with crystal violet for 10 minutes. After staining, the cells were slowly washed with running water, dried, and photographed. Data processing: Image J software was used for statistics, and the clone formation ability inhibition rate = (control group clone density - experimental group clone density) / control group clone density × 100%. Specific results are shown in Table 6 and Figure 5-8 .

[0052] Table 6 Inhibition rate of cell clone formation ability after knockout or knockdown of RNF114 in Huh7 and Hep3B cells

[0053]

[0054] Example 2: Knockdown of RNF214 inhibits the migration ability of liver cancer cells

[0055] Hep3B or Huh7 liver cancer cell lines were seeded in DMEM supplemented with 10% fetal bovine serum and cultured in a 37°C incubator with 5% CO2. Cells were passaged every two days. RNF114 was knocked down in Hep3B or Huh7 cells using shRNA or siRNA. The regulation of RNF114 on liver cancer cell migration was evaluated using the following biological function experiments.

[0056] 2.1. Scratch healing experiment:

[0057] Hep3B cells with RNF114 knockdown were plated in 6-well plates, and when the cells were fully grown, they were starved overnight with serum-free DMEM culture medium. The next morning, a 10μL pipette tip was used to measure the 6-well plate cover and draw a straight line in the center of each well. The culture medium was discarded, and after washing with PBS, the cells were cultured with serum-free DMEM and photographed. Pictures were taken every 24 hours to observe the healing of the scratches. Data processing: Image J software was used for statistics, and the cell migration ability inhibition rate = (scratch healing rate of the experimental group - scratch healing rate of the control group) / scratch healing rate of the control group × 100%. Specific results are shown in Table 7 and Figure 9-10 .

[0058] Table 7 Inhibitory effect of RNF114 knockdown on the scratch healing ability of Hep3B cells

[0059]

[0060] 2.2 Transwell migration assay:

[0061] RNF114 knockdown Huh7 cells were resuspended in serum-free DMEM and the cell density was adjusted to 2×10 5 / mL. Take 300μL of cell suspension and add it to the Transwell chamber (without laying matrix gel), add 500μL of DMEM containing 10% FBS to the lower chamber, and continue to culture in a 37℃ cell culture incubator for 48 hours. Gently wipe the cells in the upper chamber with a cotton swab, wash twice with PBS, fix with methanol for 30 minutes, and stain with crystal violet for 10 minutes. Gently wash off the staining solution with clean water, and observe under a microscope. Data processing: Use Image J software for statistics, cell migration inhibition rate = (cell migration ability of the control group - cell migration (ability) of the experimental group / cell migration ability of the control group × 100%. Specific results are shown in Table 8 and Figure 11-12 .

[0062] Table 8 Inhibitory effect of RNF114 knockdown on Huh7 cell migration

[0063]

[0064] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the invention can be embodied in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as illustrative and non-restrictive, and the scope of the invention is defined by the appended claims, not the foregoing description, and all variations within the meaning and range of equivalents of the claims are intended to be included therein. Any reference sign in a claim should not be construed as limiting the claim to which it relates.

Claims

1. Use of interfering RNA for knocking down RNF114 in human cells in the preparation of a drug for inhibiting the proliferation and migration of liver cancer cells, characterized in that: The interfering RNA is siRNA or shRNA, the siRNA is siRNF114-1 and siRNF114-2, and their sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively; the shRNA is shRNF114-1 and shRNF114-2, and their sequences are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively.

2. The use according to claim 1, characterized in that The drugs also include other biologically acceptable ligands.

3. Use of sgRNA for knocking out cell RNF114 protein in the preparation of a drug for inhibiting the proliferation and migration of liver cancer cells, characterized in that: The sgRNA performs gene editing on the RNF114 protein through gene knockout technology; the sgRNAs are sgRNF114-1 and sgRNF114-2, and their sequences are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively.

4. The application according to claim 3, characterized in that The drugs also include other biologically acceptable ligands.

Images