SgRNA targeting silver carp isg15 gene and application thereof in improving fish ability to resist herpes virus

Abstract

This invention provides a targeted silver carp isg15 This invention relates to the sgRNA of a gene and its application in enhancing the resistance of fish to herpesviruses. It utilizes CRISPR / Cas9 technology to target and knock out the sgRNA of a silver carp. isg15-a Genes and isg15-b Genes were used to obtain F0 generation chimeras. The F0 generation underwent gynogenesis and selection to obtain... isg15 homozygous mutant silver carp isg15 ‑ / ‑ / ‑ Silver carp. After infection with crucian carp herpesvirus... isg15 ‑ / ‑ / ‑ The survival rate of silver carp was significantly increased; the expression of isg15 protein in tissues was significantly reduced; and viral genes were observed in the kidneys. 39ring The transcription level was significantly reduced. This demonstrates that the gene-edited fish prepared using the method of this invention have improved the crucian carp's resistance to herpesvirus, providing a foundation for disease-resistant breeding of silver crucian carp and also providing important reference value for disease-resistant breeding of other farmed fish.

Description

Technical Field

[0001] This invention belongs to the field of fish disease resistance gene technology, specifically relating to a targeted silver crucian carp isg15 The sgRNA of the gene and its application in enhancing the resistance of fish to herpesvirus. Background Technology

[0002] Interferon stimulated gene 15 (ISG15) is a protein induced by stimuli such as viruses, playing an important role in immune regulation and tumorigenesis (Perng, et al. 2018). ISG15 is the earliest identified ubiquitin-like protein (UBL), composed of two ubiquitin-like domains (UBQ). As a ubiquitin-like protein, ISG15 can regulate the host cell's immune response by binding to proteins through an enzyme cascade reaction (similar to ubiquitination, called ISGylation). Unbound ISG15 can also exert immunomodulatory effects, inhibiting type I interferon-induced inflammation (Du, et al. 2018, Zhang, et al. 2015). ISG15 is present in all vertebrates, and studies have shown that its function varies across species (Speer, et al. 2018). Currently, in live fish... isg15 There is very little research on the construction and function of gene mutants.

[0003] Aquaculture ensures global food supply and food security. Aquatic products provide essential nutrients such as protein, vitamins, and trace elements, and also enrich people's dietary choices. Silver carp ( Carassius gibelio The silver carp is an important economic fish species in my country, with an annual production of nearly 3 million tons (Zhou and Gui, 2017), making it one of the most important freshwater aquaculture fish in the country. The silver carp is a triploid crucian carp with more than 150 chromosomes (also known as an allohexaploid AAABBBB), capable of parthenogenesis and reproducing through gynogenesis (Zhou and Gui, 2002). Utilizing the characteristics of gynogenesis in silver carp, new aquatic varieties such as the tall-sized allogeneic silver carp and the allogeneic silver carp "Zhongke No. 3" have been successively cultivated.

[0004] Fish diseases caused by pathogenic microorganisms are a major cause of significant economic losses in aquaculture, severely impacting the production and quality of aquatic products. With the large-scale promotion and cultivation of superior hybrid silver carp breeds, high-density farming has led to outbreaks of numerous diseases, particularly herpesvirus diseases. Crucian carp herpesvirus (CaHV) primarily infects the kidneys and gills of silver carp, causing acute gill hemorrhage, and resulting in a high mortality rate (Zeng, et al. 2016). Therefore, it is necessary to develop silver carp resistant to CaHV to address herpesvirus outbreaks and reduce economic losses to the aquaculture industry. Summary of the Invention

[0005] The purpose of this invention is to provide a targeted silver carp isg15 This invention relates to the sgRNA of a gene and its application in enhancing the resistance of fish to herpesviruses. It targets silver carp... isg15 sgRNA knockout of genes isg15 Genes were constructed and screened using CRISPR / Cas9 technology. isg15 A homozygous silver carp strain with gene deletion has a higher resistance to crucian carp herpesvirus.

[0006] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0007] This invention provides a targeted silver carp isg15 The sgRNA of the gene, wherein the sgRNA includes isg15-A-sgRNA and isg15-B-sgRNA, the sequence of which isg15-A-sgRNA is shown in SEQ ID No.1 and the sequence of which isg15-B-sgRNA is shown in SEQ ID No.2.

[0008] The present invention provides amplification primers for the sgRNA, wherein the upstream primer sequence of isg15-A-sgRNA is shown in SEQ ID No. 7; the upstream primer sequence of isg15-B-sgRNA is shown in SEQ ID No. 8; and the downstream primer sequences of isg15-A-sgRNA and isg15-B-sgRNA are shown in SEQ ID No. 9.

[0009] The present invention provides a vector containing sgRNA.

[0010] This invention provides a CRISPR / Cas9 gene editing system, which includes the Cas9 protein and the sgRNA.

[0011] This invention provides the application of the sgRNA or the CRISPR / Cas9 gene editing system described herein in improving the resistance of fish to herpesviruses.

[0012] Furthermore, the method of application involves injecting a mixture of Cas9 protein and sgRNA into mature fish eggs for targeted knockout. isg15-A Genes and isg15-B Genes were used to obtain F0 generation chimeras, and gynogenesis and selection were performed on the F0 generation to obtain... isg15 Gene-deleted strains are fish species with enhanced resistance to herpesviruses.

[0013] Furthermore, the application specifically includes the following steps:

[0014] (1) Mix the sgRNA and Cas9 protein with nuclease-free water evenly and inject it into the mature eggs of silver carp;

[0015] (2) Collect sperm and fertilize the injected mature fish eggs, and obtain F0 generation after hatching;

[0016] (3) The eggs produced by the successfully knocked-out F0 generation were fertilized with sperm and hatched through gynogenesis to produce the F1 generation;

[0017] (4) Select homozygous F1 generation, and obtain fish eggs after gynogenesis. isg15 Gene-deleted silver carp are herpesvirus resistant silver carp.

[0018] Furthermore, the concentration of the sgRNA is 100 ng / μL to 500 ng / μL; the volume ratio of isg15-A-sgRNA, isg15-B-sgRNA to Cas9 protein and nuclease-free water is 4:4:1:5.

[0019] Furthermore, the screening steps for successful F0 generation knockout are as follows: fertilized embryos are lysed and used as PCR templates, utilizing... isg15-A Genes and isg15-B PCR amplification was performed using primers for detecting the gene target site, and the size of the target band was verified after electrophoresis of the PCR product. isg15-A The amplified fragment is 450bp and isg15-B The amplified fragment is 911bp. Sequencing the PCR product reveals overlapping peaks in the sequencing chromatogram, indicating... isg15 Gene knockout was successful.

[0020] Furthermore, the aforementioned isg15-A The primer sequences for detecting the gene target sites are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively; isg15-BThe primer sequences for detecting the gene target sites are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively.

[0021] Furthermore, the incubation water temperature is 22℃~23℃.

[0022] Furthermore, the herpesvirus is crucian carp herpesvirus.

[0023] Furthermore, the freshwater fish include silver carp.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] This invention uses CRISPR / Cas9 technology to knock out isg15-A Genes and isg15-B Genes, acquired isg15 Homozygous mutant silver carp, after infection with crucian carp herpesvirus, isg15 - / - / - The survival rate of silver carp was significantly increased, and the expression of isg15 protein in tissues was significantly reduced; at the same time, viral genes in the kidneys were also reduced. 39ring The transcription level was significantly reduced. Gene-edited fish prepared using the method of this invention showed improved resistance to crucian carp herpesvirus, providing a foundation for disease-resistant breeding of silver crucian carp and also offering important reference value for disease-resistant breeding of other farmed fish. Attached Figure Description

[0026] Figure 1 for isg15-A Genes and isg15-B A schematic diagram of gene mutation targets.

[0027] Figure 2 Wild-type silver carp and ISG15 - / - / - Survival rate of silver carp infected with CaHV.

[0028] Figure 3 Wild-type silver carp and ISG15 - / - / - ISG15 protein expression in crucian carp infected with CaHV.

[0029] Figure 4 Wild-type silver carp and ISG15 - / - / - Silver carp infected with CaHV have viral genes in their kidneys. 39ring Transcription level.

[0030] Figure 5 To prove isg15 Sequencing peak patterns of successful gene knockout. Detailed Implementation

[0031] Unless otherwise specified, the technical solutions described in this invention are conventional methods in the art; the reagents or materials used, unless otherwise specified, are all from commercial sources. The application methods of this invention are applicable not only to silver carp but also to other freshwater fish.

[0032] Example 1: isg15 Obtaining a homozygous silver carp strain with gene deletion

[0033] 1.1 Selection of sgRNA targets

[0034] First, search through NCBI. isg15-A ( Carassius gibelio The complete gene sequence (gene ID: 128012972) and isg15-B ( Carassius gibelio The complete gene sequence (gene ID: 127958337), according to isg15-A and isg15-B Design different sequences of the second exon. isg15-A and isg15-B Two specific knockout target sites were identified. Target site prediction and screening were performed using http: / / zifit.partners.org, and the sites selected in this invention... isg15-A The target sequence is: GTGAGCGGTGAAGCCACAGT (SEQ ID No. 1). isg15-B The target sequence is: GCCAGGAAACTCAGCGAATA (SEQ ID No. 2). In this experiment, sgRNA was designed on the second exon, and a pair of amplification primers were designed upstream and downstream of the target gene:

[0035] Detection isg15-A The amplified fragment is 450 bp, and the primer sequences are:

[0036] F: GAACACTTCGGCAAACCACG (SEQ ID No. 3);

[0037] R: CTTCATACGTTCCAATCTGGCC (SEQ ID No. 4).

[0038] Detection isg15-B The amplified fragment is 911 bp, and the primer sequence is:

[0039] F: GCTCACCTCCATCCAGAGAC (SEQ ID No.5);

[0040] R: GGCCAGCAGCACATATGTAG (SEQ ID No. 6).

[0041] 1.2 In vitro synthesis of sgRNA

[0042] sgRNA with isg15-A The upstream primer for the target site, isg15-A-sgRNA-F: GTAATACGACTCACTATAGTGAGCGGTGAAGCCACAGTGTTTTAGAGCTAGAAATAGC (SEQ ID No. 7) and isg15-B The upstream primer isg15-B-sgRNA-F: GTAATACGACTCACTATAGCCAGGAAACTCAGCGAATAGTTTTAGAGCTAGAAATAGC (SEQ ID No. 8) of the target site was used for PCR amplification with the conserved downstream primer sgRNA-R: AAAAGCACCGACTCGGTGCC (SEQ ID No. 9).

[0043] The amplification system is as follows:

[0044]

[0045] (1) All PCR products were subjected to agarose gel electrophoresis and purified and recovered using a DNA gel recovery kit;

[0046] (2) In vitro transcription was performed using the Thermo Transcript Aid T7 High Yield Transcription Kit. The transcription system was as follows:

[0047]

[0048] (3) After mixing, centrifuge and incubate in a 37 ℃ incubator for 3 h;

[0049] (4) Add 1 µL of DNase, incubate at 37 °C for 30 min to remove the DNA template;

[0050] (5) Add 1 µL of EDTA, incubate at 60 °C for 10 min to terminate the reaction;

[0051] (6) Add 30 µL LiCl and 30 µL RNase-free water, mix well, and precipitate overnight at -20 °C;

[0052] (7) Centrifuge at 4 ℃, 15000 g for 15 min;

[0053] (8) Discard the supernatant, add 1 mL of RNase-free 70% ethanol to wash, centrifuge at 4 ℃, 15000 g for 5 min;

[0054] (9) Repeat the previous step;

[0055] (10) After discarding the supernatant, dry for 5 min, add 30 µL of RNase-free water to dissolve for 5 min, take 1 µL and use a NanoDrop2000 nucleic acid quantification instrument to measure the RNA concentration and mass, dilute to 100 ng / µL, aliquot and store at -80 ℃ for later use.

[0056] 1.3 Microinjection

[0057] 2 μL of isg15-A-sgRNA (SEQ ID No. 1) 200 ng / μL, 2 μL of isg15-B-sgRNA (SEQ ID No. 2) 200 ng / μL, 0.5 μL of 10X Cas9 protein, and 2.5 μL of nuclease-free water were mixed thoroughly. Using a nitrogen-pressurized PLI100A quantitative microinjection system (Warner), 1-2 nL of the mixture was injected into A... + Approximately 200 eggs were injected into mature silver carp eggs each time, while some uninjected eggs were left as a control; Xingguo red carp ( Cyprinus carpio Artificial fertilization was performed using sperm from [unspecified source] to fertilize mature fish eggs. The fertilized eggs were then transferred to an incubation tank at a water temperature of 22–23°C to hatch, yielding the F0 generation. isg15 Gene knockout chimera).

[0058] 1.4 F0 target mutation efficiency detection and heritable screening

[0059] (1) Take 15 embryos from the injection group and the control group, mix them separately, add 50µL NaOH (50mM) lysis buffer using the alkaline lysis method, lyse at 95 ℃ for 30 min, and store them at 4 ℃ as PCR templates for later use.

[0060] (2) Using the above product as a template, conventional PCR amplification yielded a 450bp fragment near the isg15-A target site.

[0061] F: GAACACTTCGGCAAACCACG (SEQ ID No. 3);

[0062] R: CTTCATACGTTCCAATCTGGCC (SEQ ID No. 4);

[0063] The amplified fragment of isg15-B was 911 bp.

[0064] F: GCTCACCTCCATCCAGAGAC (SEQ ID No.5);

[0065] R: GGCCAGCAGCACATATGTAG (SEQ ID No. 6).

[0066] The PCR amplification system is as follows:

[0067] ,

[0068] (3) Take 6 μL of PCR product for 1.5% agarose gel electrophoresis to verify the size of the target band. Send the PCR product to a sequencing company (Wuhan Aikon Biotechnology Co., Ltd.) for sequencing. The results show that overlapping peaks appear at the designed knockout target site (e.g. Figure 5 As shown in the image, this indicates that the knockout was successful.

[0069] 1.5 Screening of homozygous F2 adult fish carrying target site mutations

[0070] (1) The eggs produced by the successfully knocked-out F0 generation chimera were artificially fertilized with Xingguo red carp and then hatched through gynogenesis to produce the F1 generation;

[0071] (2) Extract DNA from the fin rays of F1 generation fish fry using alkaline lysis method;

[0072] (3) PCR amplification was performed using isg15-A and isg15-B target site detection primers. After verifying the band size by agarose gel electrophoresis, the PCR products were sent to a sequencing company for sequencing. The PCR products were sequenced, and homozygous F1 generation was screened based on the sequencing results.

[0073] (4) Eggs from the homozygous F1 strain obtained through screening, after gynogenesis, become the isg15 homozygous deletion mutant line F2. The final homozygous line obtained... isg15 The gene-deleted silver carp contains the sequence shown in SEQ ID No. 10: GTGAGCGGTTGGCGAACTCAAG and the sequence shown in SEQ ID No. 11: GCCAGGAAACTCATACGGTACGGTTTGCG, specifically as follows: Figure 1 As shown.

[0074] Example 2: CaHV infection experiment

[0075] (1) Wild-type silver carp and isg15 knockout silver carp from Example 1 (isg15) - / - / - Silver carp were kept in an aquarium measuring 70.5cm×48cm×38cm, with the water temperature maintained at 22℃ (±1℃). The experimental fish were observed for any abnormalities after one week of rearing.

[0076] (2) Both wild-type and isg15 knockout silver carp were healthy silver carp weighing about 6g. They were injected intraperitoneally with 6μL of CaHV virus suspension (body weight: CaHV virus ratio of 1g:1μL), with 30 fish in each group.

[0077] (3) The aquaculture water should be kept at 22℃ (±1℃) and filtered continuously. Dead individuals should be removed in time to keep the water clean.

[0078] (4) Record the mortality of silver carp every day after infection, and continue to count until 10 dpi (days post-infection);

[0079] (5) The survival rate of fish was analyzed using Mantel-Cox.

[0080] The results are as follows Figure 2 This indicates that the survival rate of crucian carp infected with CaHV in the WT group was 0% on day 8, while that of isg15 was 0%. - / - / - Only one silver carp died, increasing the survival rate by 97%, indicating that ISG15... - / - / - Silver carp showed a significantly improved ability to resist crucian carp herpesvirus infection.

[0081] Example 3: ISG15 protein expression in tissues of wild-type and isg15 knockout crucian carp infected with CaHV

[0082] The expression of isg15 protein in different tissues of wild-type and isg15 knockout crucian carp infected with CaHV was detected.

[0083] (1) Wild-type and isg15 knockout silver carp in Example 2 were anesthetized on ice 72 hours after being infected with CaHV, and gill and body kidney samples were dissected and weighed;

[0084] (2) Add 200 mL of NP40 lysis buffer containing protease inhibitors and add milled zirconium beads to it;

[0085] (3) Pre-cooling homogenizer (Servicebio): Place the tissue in the homogenizer and completely break it down;

[0086] (4) After the sample is broken up, add 50µL of 5×SDS Sample Buffer, vortex mix, and incubate in a 100℃ metal bath for 10min.

[0087] (5) The expression level of isg15 protein in isg15 knockout crucian carp and wild-type crucian carp was detected by Western blotting. The results are as follows: Figure 3 As shown, the expression of isg15 protein in the tissues (gills, body, and kidneys) of crucian carp knockout was significantly reduced.

[0088] Example 4: Detection of viral gene transcription levels in the renal cells of wild-type and isg15 knockout crucian carp infected with CaHV

[0089] Detection of viral genes in the kidneys of wild-type and isg15 knockout silver carp infected with CaHV 39ring Transcriptional level. Wild-type and isg15 knockout crucian carp in Example 2 were anesthetized on ice 72 hours after infection with CaHV, and kidney samples were dissected for total RNA extraction. Reverse transcription was performed followed by qPCR detection (primer sequences CaHV-39ring-F: CGGACTGTGCCGTTTGC, CaHV-39ring-R: CGTGCCCTTCACCTTTT). Results are as follows. Figure 4 This indicates that isg15 knockout of the viral gene in the kidneys of crucian carp 39ring The transcriptional level was significantly reduced.

[0090] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A targeted silver carp isg15 The sgRNA of a gene is characterized by, The sgRNA includes isg15-A-sgRNA and isg15-B-sgRNA, the sequence of which isg15-A-sgRNA is shown in SEQ ID No. 1 and the sequence of which isg15-B-sgRNA is shown in SEQ ID No.

2.

2. The amplification primers for sgRNA according to claim 1, characterized in that, The upstream primer sequence of the isg15-A-sgRNA is shown in SEQ ID No. 7; the upstream primer sequence of the isg15-B-sgRNA is shown in SEQ ID No. 8; and the downstream primer sequences of the isg15-A-sgRNA and isg15-B-sgRNA are shown in SEQ ID No.

9.

3. A carrier, characterized in that, The vector comprises the sgRNA as described in claim 1.

4. A CRISPR / Cas9 gene editing system, characterized in that, It includes the Cas9 protein and the sgRNA as described in claim 1.

5. The application of the sgRNA of claim 1 or the CRISPR / Cas9 gene editing system of claim 4 in the breeding of herpesvirus-resistant silver carp.

6. The application according to claim 5, characterized in that, The method of application is as follows: injecting a mixture of Cas9 protein and the sgRNA described in claim 1 into mature fish eggs for targeted knockout. isg15-A Genes and isg15-B Genes were used to obtain F0 generation chimeras, and gynogenesis and selection were performed on the F0 generation to obtain... isg15 Gene-deleted strains are fish species with enhanced resistance to herpesviruses.

7. The application according to claim 6, characterized in that, The application specifically includes the following steps: (1) Mix the sgRNA and Cas9 protein with nuclease-free water evenly and inject it into the mature eggs of silver carp; (2) Collect sperm and fertilize the injected mature fish eggs, and obtain F0 generation after hatching; (3) The eggs produced by the successfully knocked-out F0 generation were fertilized with sperm and hatched through gynogenesis to produce the F1 generation; (4) Select homozygous F1 generation, and obtain fish eggs after gynogenesis. isg15 Gene-deleted silver carp are herpesvirus resistant silver carp.

8. The application according to claim 7, characterized in that, The concentration of the sgRNA is 100 ng / μL to 500 ng / μL; the volume ratio of isg15-A-sgRNA, isg15-B-sgRNA to Cas9 protein and nuclease-free water is 4:4:1:

5.

9. The application according to claim 7, characterized in that, The screening steps for successful F0 generation knockout are as follows: fertilized embryos are lysed and used as PCR templates, and then... isg15-A Genes and isg15-B PCR amplification was performed using primers for detecting the gene target site, and the size of the target band was verified after electrophoresis of the PCR product. isg15-A The amplified fragment is 450bp and isg15-B The amplified fragment is 911bp. Sequencing the PCR product reveals overlapping peaks in the sequencing chromatogram, indicating... isg15 Gene knockout was successful.

10. The application according to claim 9, characterized in that, The isg15-A The primer sequences for gene detection are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively; isg15-B The primer sequences for gene detection are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively.

Images