Application of TADA1 gene in improvement of fetal hemoglobin expression

Abstract

The invention provides application of a TADA1 gene in improvement of fetal hemoglobin expression, and relates to the technical field of biology. A new therapeutic target TADA1 is found, and after TADA1 gene knockout is carried out on HUDEP2 cells and hematopoietic stem cells through a gene editing technology, it is found that the edited cells can significantly improve the expression level of gamma globin and fetal hemoglobin (HbF) and promote erythroid differentiation; the application of the substance for down-regulating the level of the TADA1 gene or the expression product of the TADA1 gene comprises the preparation of a product for improving the expression of fetal hemoglobin of a subject, and a new target spot of a medicine is provided.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an application of a TADA1 gene in improving the expression of fetal hemoglobin. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] Hemoglobin conversion is the change in the hemoglobin chain during a specific period of vertebrate development, so that the red blood cells can better adapt to the physiological needs of each period. From the birth stage, fetal hemoglobin (HbF) changes to adult hemoglobin (HbA). Hemoglobin conversion not only provides a model for studying gene expression during human development, but also has important medical research value.

[0004] The human genome encodes three types of β-like globins, namely embryonic ε globin, fetal γ globin and adult β globin. During the embryonic period, embryonic ε globin is mainly expressed in the blood; during the fetal period, ε is shut down and fetal γ globin begins to be expressed; after birth, γ is shut down and adult β globin begins to be expressed. Sickle cell anemia and thalassemia are caused by mutations in the adult β globin gene. Activating fetal γ globin can replace adult β globin to perform oxygen-carrying functions. Screening for targets or drugs that can promote the activation of fetal hemoglobin is of great significance for the treatment of sickle cell anemia and thalassemia.

[0005] At present, there have been many reports on the use of gene editing or small molecule drugs to activate γ-globin, especially the method of interfering with the expression of BCL11A, ZBTB7A, WIZ, etc. has made the fastest progress, and small sample clinical trials are currently underway. Prior art CN109735497A destroys the BCL11A genomic region from position 60495219 to position 60495336 of chromosome 2 in hematopoietic stem cells through gene editing technology. It involves a cell therapy program for the treatment of anemia diseases such as thalassemia and sickle cell anemia, which efficiently and safely modifies the enhancer site of BCL11A in human hematopoietic stem cells, upregulates the expression of γ-globin and fetal hemoglobin, and achieves the purpose of treating the disease.

[0006] Screening more targets or drugs that can promote the activation of fetal hemoglobin is of great significance for the treatment of sickle cell anemia and thalassemia, and can provide more therapeutic products for diseases caused by the lack of β-like globin, which will not only help improve the clinical symptoms of patients, but also may provide new directions for the treatment of other genetic blood diseases.

[0007] In view of this, the present invention is proposed. Summary of the invention

[0008] The purpose of the present invention is to provide the application of TADA1 gene in improving the expression of fetal hemoglobin, providing a new therapeutic target.

[0009] In order to solve the above technical problems, the present invention particularly adopts the following technical solutions: In a first aspect, a substance for downregulating the level of TADA1 gene or its expression product is provided for use in one or more of (I) to (IX): (I) increasing the expression of fetal hemoglobin in subjects; (II) preparing products for increasing fetal hemoglobin expression in a subject; (III) increasing fetal γ-globin expression in subjects; (IV) preparing products for increasing fetal γ-globin expression in a subject; (V) increasing the expression of ε-globin in the embryos of the subject; (VI) preparing a product for increasing the expression of ε globin in the embryo of a subject; (VII) Promote the differentiation of hematopoietic cells into blood cells; (VIII) Preparation of products for promoting differentiation of hematopoietic cells into blood cells; (IX) Preparation of a medicament for treating anemic diseases.

[0010] In a second aspect, a gRNA targeting the TADA1 gene is provided, the gRNA comprising at least one gRNA targeting the TADA1 gene, the target sequence of the gRNA comprising at least one of the sequence shown in SEQ ID NO.1, the sequence shown in SEQ ID NO.2, the reverse complementary sequence of SEQ ID NO.1, and the reverse complementary sequence of SEQ ID NO.2.

[0011] In a third aspect, a composition for editing the TADA1 gene is provided, the composition comprising (i) and (ii): (i) the gRNA targeting the TADA1 gene according to the second aspect, or a polynucleotide encoding the gRNA targeting the TADA1 gene according to the second aspect; (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

[0012] In a fourth aspect, a modified hematopoietic cell is provided, wherein the level of TADA1 gene or its expression product in the modified hematopoietic cell is downregulated.

[0013] In a fifth aspect, a method for preparing the modified hematopoietic cells described in the fourth aspect is provided, the method comprising obtaining the composition described in the third aspect, and introducing the composition into hematopoietic cells, thereby knocking out the TADA1 gene.

[0014] In the sixth aspect, a modified red blood cell is provided, wherein the modified red blood cell is differentiated from the modified hematopoietic cell described in the fourth aspect; or is differentiated from the hematopoietic cell prepared by the preparation method of the fifth aspect.

[0015] In the seventh aspect, there is provided the use of the modified hematopoietic cells of the fourth aspect, or the preparation method of the fifth aspect, or the modified red blood cells of the sixth aspect in the preparation of a drug for treating anemic diseases; or in the preparation of a product for blood transfusion.

[0016] In an eighth aspect, a pharmaceutical composition is provided, which comprises the modified hematopoietic cells described in the fourth aspect, or the hematopoietic cells prepared by the preparation method described in the fifth aspect, or the modified red blood cells described in the sixth aspect.

[0017] Compared with the prior art, the present invention has the following beneficial effects: This invention discovered a new therapeutic target, TADA1. After knocking out the TADA1 gene in HUDEP2 cells and hematopoietic stem cells through gene editing technology, it was found that the edited cells could significantly increase the expression levels of γ-globin and fetal hemoglobin (HbF) and promote erythroid differentiation. This discovery suggests that TADA1 is expected to become a new target for the treatment of β-thalassemia and sickle cell anemia.

[0018] Unlike existing technologies that mainly focus on the single target of BCL11A enhancer, downregulating TADA1 can not only significantly promote the expression of fetal hemoglobin, but also promote erythroid differentiation, which is expected to achieve better therapeutic effects. This innovative target discovery provides new possibilities for meeting clinical needs, especially in the context of existing gene editing therapies such as CRISPR / Cas9 that have made certain progress in the application of BCL11A enhancer region. The discovery of TADA1 provides a wider range of strategic options for gene therapy of related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1The relative expression of each globin mRNA detected by RT-qPCR in Example 2 was tested using T test for significance. "*" indicates a significant difference, 0.01≤P<0.05; "**" indicates a very significant difference, 0.001≤P<0.01; "****" indicates a very significant difference, P<0.0001; Figure 2 The expression levels of γ-globin and β-globin were detected by immunoblotting in Example 2; Figure 3 The results of fetal hemoglobin (HbF) detected by flow cytometry on days 0, 3, and 5 of differentiation in Example 2; Figure 4 The differentiation of HUDEPE2 cells was detected by flow cytometry on days 0, 3, and 5 of differentiation in Example 2, wherein ProE is primitive erythrocyte, EBaso is early basophilic erythroblast, LBaso is late basophilic erythroblast, and Poly is polychromatic erythroblast; Figure 5 The relative expression of fetal γ-globin and embryonic ε-globin mRNA detected by RT-qPCR in Example 3, using T test to test the significance, "**" indicates a very significant difference, 0.001≤P<0.01; Figure 6 The expression levels of γ-globin and β-globin were detected by immunoblotting in Example 3; Figure 7 The expression of fetal hemoglobin (HbF) and cell differentiation of CD34+ hematopoietic stem cells detected by flow cytometry on the 10th day of differentiation in Example 3, wherein ProE is primitive erythrocyte, EBaso is early basophilic erythroblast, LBaso is late basophilic erythroblast, Poly is polychromatic erythroblast, and Ortho represents orthochromatic erythroblast; Figure 8 The expression of fetal hemoglobin (HbF) and cell differentiation of CD34+ hematopoietic stem cells detected by flow cytometry on the 12th day of differentiation in Example 3, ProE is primitive erythrocyte, EBaso is early basophilic erythroblast, LBaso is late basophilic erythroblast, Poly is polychromatic erythroblast, and Ortho indicates orthochromatic erythroblast; Fig. 9 The expression of fetal hemoglobin (HbF) and cell differentiation of CD34+ hematopoietic stem cells detected by flow cytometry on the 15th day of differentiation in Example 3, ProE is primitive erythrocyte, EBaso is early basophilic erythroblast, LBaso is late basophilic erythroblast, Poly is polychromatic erythroblast, and Ortho represents orthochromatic erythroblast; Fig.10This is the MGG staining result of red blood cell morphology in Example 3. DETAILED DESCRIPTION

[0021] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or action from another entity or action, and does not necessarily require or imply any actual such relationship, order, or importance between such entities or actions, such as numbers (I), (II)...(IX); and (i) and (ii), etc.

[0023] Herein, the term "downregulation" can be used interchangeably with "reduction", "silencing", "suppression" and other similar terms, and includes any level of downregulation. Downregulation can be assessed by a reduction in the absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level used in the art, such as a baseline level before intervention or a level determined from an untreated or control (e.g., a buffer-only control or an inert agent control) treated subject, cell, or sample.

[0024] As used herein, the terms "subject," "patient," or "individual" are used interchangeably and include humans or non-human animals, or cells or tissues derived from humans or non-human animals, such as humans, monkeys, mice, rats, rabbits, donkeys, cows, horses, pigs, or dogs.

[0025] As used herein, the terms "treat," "alleviate," or "ameliorate" are used interchangeably herein. These terms refer to an approach for obtaining beneficial or desired results, including but not limited to therapeutic benefit. "Therapeutic benefit" means the eradication or amelioration of one or more physiological symptoms associated with the underlying disorder being treated.

[0026] As used herein, unless otherwise stated, "optionally", "optional", "optional" or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs or does not occur.

[0027] Herein, the terms "comprise" or "comprising" are intended to include stated elements, integers or steps, but not to exclude any other elements, integers or steps.

[0028] As used herein, the terms “each...is independently selected from” are interchangeable with “...are each independently selected from” and “...are independently selected from” and should all be understood in a broad sense, meaning that the selection process of multiple objects or elements is independent of each other, each object can freely choose from the given options, and the result of the selection is not affected by the selection of other objects.

[0029] Herein, "hematopoietic cells" refer to cells that are capable of differentiating into various blood cells, including stem cells and progenitor cells.

[0030] Herein, "Cas nuclease" refers to a Cas nuclease that can bind to a target sequence, or cut or create an incision in a target sequence, or mutate a target sequence, and the Cas nuclease includes but is not limited to a natural Cas nuclease or a polypeptide or complex containing the main functional domain of the Cas nuclease; or a mutated Cas nuclease or polypeptide; or a fusion protein containing a Cas nuclease or a Cas nuclease functional domain fused with other functional regions. The Cas nuclease includes but is not limited to Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9; or a protein, polypeptide or complex formed by mutation of the above Cas nuclease and / or fusion with other functional domains.

[0031] The term "polynucleotide" herein refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases. The terms "polynucleotide" and "nucleic acid" are used interchangeably herein.

[0032] The TADA1 gene, also known as Transcriptional Adaptor 1, encodes a protein subunit of the STAGA complex (SPT3; (MIM 602947) / TAF9 (MIM 600822) / GCN5 (MIM 602301) acetyltransferase complex), which is a chromatin-modifying multiprotein complex. The TADA1 gene is expressed in multiple tissues, including the brain and bone marrow. The protein product of this gene is involved in multiple biological processes, including protein heterodimer activity and histone acetyltransferase activity. Experimental verification has shown that knocking out the TADA1 gene can promote the expression of fetal γ-globin, embryonic ε-globin, and fetal hemoglobin, as well as promote the differentiation of hematopoietic cells into blood cells. Based on this discovery, the following technical solution is proposed.

[0033] In the first aspect, a substance for down-regulating the TADA1 gene or its expression product is provided for use in one or more of (I) to (IX): (I) increasing the expression of fetal hemoglobin in subjects; (II) preparing products for increasing fetal hemoglobin expression in a subject; (III) increasing fetal γ-globin expression in subjects; (IV) preparing products for increasing fetal γ-globin expression in a subject; (V) increasing the expression of ε-globin in the embryos of the subject; (VI) preparing a product for increasing the expression of ε globin in the embryo of a subject; (VII) Promote the differentiation of hematopoietic cells into blood cells; (VIII) Preparation of products for promoting differentiation of hematopoietic cells into blood cells; (IX) Preparation of a medicament for treating anemic diseases.

[0034] The expression product of the TADA1 gene includes the product produced by the TADA1 gene through the processes of transcription and translation, which may be a direct product or a product after shearing, recombination, replication or metabolism of the direct product. Exemplary "gene expression products" include but are not limited to RNA, polypeptides or proteins. Down-regulating the level of the TADA1 gene or its expression product includes reducing the content and / or activity of the TADA1 gene or its expression product, such as but not limited to inhibiting TADA1 gene transcription, reducing the number of copies of the subject's TADA1 gene, knocking out the subject's TADA1 gene, inhibiting the translation of mRNA encoding TADA1 and reducing the content or activity of TADA1 protein.

[0035] In an optional embodiment, the substance that downregulates the TADA1 gene or its expression product includes a polynucleotide targeting the TADA1 gene or TADA1 mRNA and / or an anti-TADA1 antibody or an antigen-binding fragment thereof.

[0036] In an optional embodiment, the polynucleotide targeting TADA1 gene or TADA1 mRNA includes at least one of antisense oligonucleotide (ASO), siRNA (Small interfering RNA), shRNA (short hairpin RNA), dsRNA (double-stranded RNA) and gRNA (guide RNA).

[0037] In an optional embodiment, the downregulation of the TADA1 gene includes knocking out the TADA1 gene by at least one gene editing system, and the substance that downregulates the level of the TADA1 gene or its expression product includes a reagent that constitutes a gene editing system. The gene editing system includes but is not limited to a zinc finger nuclease (ZFN) gene editing system, a transcription activator-like effector nuclease (TALEN) gene editing system, or a CRISPR-Cas gene editing system.

[0038] In an optional embodiment, the downregulation of the TADA1 gene includes knocking out the TADA1 gene by a CRISPR-Cas gene editing system. The substance that downregulates the TADA1 gene or its expression product includes, but is not limited to, one or more of gRNA (guide RNA), Cas nuclease, delivery system, and buffer component.

[0039] In an optional embodiment, the downregulation of the TADA1 gene includes a gRNA targeting the TADA1 gene, the gRNA targeting the TADA1 gene includes at least one gRNA targeting the TADA1 gene, the target sequence of the gRNA includes at least one of the sequence shown in SEQ ID NO.1, the sequence shown in SEQ ID NO.2, the reverse complementary sequence of SEQ ID NO.1 and the reverse complementary sequence of SEQ ID NO.2, and the target sequence of the gRNA preferably includes the sequence shown in SEQ ID NO.1.

[0040] In an optional embodiment, the subjects described in (I) to (VI) independently include hematopoietic stem cells or erythroid progenitor cells.

[0041] In an optional embodiment, the hematopoietic cells described in (VII) or (VIII) independently include hematopoietic stem cells or erythroid progenitor cells.

[0042] In an optional embodiment, the promoting the differentiation of hematopoietic cells into blood cells in (VII) or (VIII) includes promoting the differentiation of hematopoietic cells into red blood cells.

[0043] In an optional embodiment, the anemic disease in (IX) includes at least one of sickle cell anemia and β-thalassemia.

[0044] In an optional embodiment, the use of any one of the above (I) to (IX) is for non-diagnostic and non-therapeutic purposes.

[0045] In a second aspect, a gRNA targeting the TADA1 gene is provided, wherein the gRNA targeting the TADA1 gene comprises at least one gRNA targeting the TADA1 gene, and the target sequence of the gRNA comprises at least one of the sequence shown in SEQ ID NO.1, the sequence shown in SEQ ID NO.2, the reverse complementary sequence of SEQ ID NO.1, and the reverse complementary sequence of SEQ ID NO.2.

[0046] In a third aspect, a composition for editing the TADA1 gene is provided, the composition comprising (i) and (ii): (i) The gRNA targeting the TADA1 gene as described in the second aspect, or a polynucleotide encoding the gRNA targeting the TADA1 gene as described in the second aspect.

[0047] (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

[0048] In an optional embodiment, the polynucleotide encoding the gRNA is DNA or RNA, and the DNA or RNA is transformed into a test cell to express the gRNA. The DNA encoding the gRNA is, for example but not limited to, a recombinant plasmid, and the RNA encoding the gRNA is, for example but not limited to, mRNA.

[0049] In an optional embodiment, the polynucleotide encoding the Cas nuclease is DNA or RNA, and the DNA or RNA is transformed into a test cell to express the Cas nuclease. The DNA encoding the Cas nuclease is, for example but not limited to, a recombinant plasmid, and the RNA encoding the Cas nuclease is, for example but not limited to, mRNA.

[0050] In an optional embodiment, the same recombinant vector contains a fragment encoding the above-mentioned gRNA and a fragment encoding the Cas nuclease.

[0051] In an optional embodiment, the composition for editing the TADA1 gene comprises a ribonucleoprotein complex (RNP) formed by a Cas nuclease and a gRNA.

[0052] In a fourth aspect, a modified hematopoietic cell is provided, wherein the level of TADA1 gene or its expression product in the modified hematopoietic cell is downregulated.

[0053] In an optional embodiment, the TADA1 gene of the modified hematopoietic cells is knocked out.

[0054] In an optional embodiment, the TADA1 gene of the modified hematopoietic cell is knocked out using the composition of the third aspect.

[0055] In an optional embodiment, the modified hematopoietic cells include hematopoietic stem cells or erythroid progenitor cells.

[0056] In a fifth aspect, a method for preparing modified hematopoietic cells is provided, the method comprising obtaining the composition of the third aspect, and introducing the composition into hematopoietic cells, thereby knocking out the expression of the TADA1 gene.

[0057] In an optional embodiment, the preparation method can introduce the composition for editing the TADA1 gene into hematopoietic stem cells or erythrocyte progenitor cells by any conventional method known in the art, such as but not limited to liposome introduction, nanoparticle delivery, vector, transfection, heat shock, electrofection, transduction, gene gun or microinjection.

[0058] In an optional embodiment, the above-mentioned composition for editing the TADA1 gene includes an RNP complex formed by Cas nuclease and gRNA, which is introduced into the hematopoietic cells to be edited by electrotransfection.

[0059] In a sixth aspect, a modified red blood cell is provided, wherein the modified red blood cell is differentiated from the modified hematopoietic cell of the fifth aspect; or is differentiated from the hematopoietic cell prepared by the preparation method described in the fifth aspect.

[0060] In an optional embodiment, the modified red blood cells are differentiated from modified hematopoietic stem cells or red blood cell progenitor cells.

[0061] In the seventh aspect, there is provided the use of the modified hematopoietic cells of the fourth aspect, or the preparation method of the fifth aspect, or the modified red blood cells of the sixth aspect in the preparation of a drug for treating anemic diseases; or in the preparation of a product for blood transfusion.

[0062] In an optional embodiment, the anemic disease includes at least one of sickle cell anemia and β-thalassemia.

[0063] In an eighth aspect, a pharmaceutical composition is provided, which comprises the modified hematopoietic cells described in the fourth aspect, or the hematopoietic cells prepared by the preparation method described in the fifth aspect, or the modified red blood cells described in the sixth aspect.

[0064] In an optional embodiment, the pharmaceutical composition further comprises pharmaceutically acceptable excipients, including but not limited to anticoagulants, diluents, buffers, protective agents, stabilizers, suspending agents, solvents and buffer systems, or a combination of several thereof.

[0065] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0066] Example 1 TADA1 gene knockout method: 1. sgRNA target sequence: sgTADA1#1: AGCTCATAGACTTCTCACAC (SEQ ID NO.1); sgTADA1#2:ACTGGGCTAACCTAAAGCTG (SEQ ID NO. 2).

[0067] 2. Transfection: Use LONZA electroporation kit (V4XP-3024) to electroporate sgRNA / cas9 RNP complex into cells.

[0068] (1) Dissolve sgRNA in ddH2O to a concentration of 100 pmol / μL. Pipette 1 μL of cas9 protein (concentration 10 μg / μL) and 1 μL of sgRNA, mix well, and incubate at room temperature for 10 minutes.

[0069] (2) Resuspend the cells in resuspension buffer, mix evenly with the complex prepared in (1), and place in an electrode tube.

[0070] (3) Perform electroporation using the CM137 program.

[0071] 3. After electroporation, the red blood cells are differentiated.

[0072] Example 2 1. According to the method of Example 1, the TADA1 gene in HUDEPE2 cells (Human Umbilical cord blood-derived Erythroid Progenitor cells, Human Umbilical cord blood-derived Erythroid Progenitor cells) was knocked out, and after electroporation, erythroid blood cell differentiation was performed. The steps of HUDEPE2 cell differentiation are as follows: Resuspend HUDEP2 cells in the first stage medium and count them to 3 × 10 5 Cells were seeded into 12-well cell culture plates, 1 mL of the first-stage culture medium was added to each well, and the cells were differentiated until the third day.

[0073] Phase I culture medium components: SFEM-II (StemCell, Canada, Catalog #09655) was supplemented with the following components: 2% FBS, 3% AB serum, 50 ng / mL stem cell factor (SCF), 3 U / mL erythropoietin (EPO), 10 μg / mL insulin, 3 U / mL heparin, 1 mg / mL transferrin, 1 μg / mL doxycycline (DOX), 100 U / mL penicillin, and 100 μg / mL streptomycin.

[0074] Resuspend HUDEP2 cells in the second stage medium and count them to 3 × 10 5 cell / mL cells were seeded into a 12-well cell culture plate, 1 mL of the second stage culture medium was added to each well, and differentiation was continued until the 5th day.

[0075] The second stage culture medium composition: SFEM-II (StemCell, Canada, Catalog # 09655) was added with the following components: 2% FBS, 3% AB serum, 3 U / mL erythropoietin (EPO), 10 μg / mL insulin, 3 U / mL heparin, 1 mg / mL transferrin, 1 μg / mL doxycycline (DOX), 100 U / mL penicillin, and 100 μg / mL streptomycin.

[0076] 2. qPCR detection of the expression of corresponding genes: Differentiated on different days, 1×10 6 The cells were washed once with PBS, and RNA was extracted using the Trizon method and reverse transcribed using a reverse transcription kit (Novozyme R323-01). RT-qPCR was then performed, and the results were as follows. Figure 1 As shown in the figure, after TADA1 gene knockout, the expression of fetal γ-globin and embryonic ε-globin increased, and there was no significant effect on the expression of adult β-globin and α-globin, and the knockout effect of sgTADA1#1 was better than that of sgTADA1#2.

[0077] 3. Western Blot to detect the expression of γ-globin, β-globin and TADA1: 1×10 6The cells were washed once with PBS, 40uL 1×SDS loading was added, and the samples were boiled at 95℃ for 30 minutes, followed by immunoblotting. The results were as follows Figure 2 As shown, it was confirmed that the expression of fetal γ-globin was increased after TADA1 gene knockout.

[0078] 4. Flow cytometry detection of fetal hemoglobin (HbF) and differentiation, including the following steps: (1) Preparation of cell suspension: For the red blood cells at different stages of differentiation to be tested, take 1×10 5 The cells were added to the flow cytometry tube, resuspended and washed with 1 mL PBS, centrifuged at 300 g for 5 min, and the supernatant was discarded.

[0079] (2) Antibody labeling: Resuspend the cells in 100 μL PBS to form a single-cell suspension, add 1 μL of the antibody to detect the surface antigen, and incubate at 4°C in the dark for 30 min.

[0080] (3) Washing: Add 1 mL of PBS buffer to each tube, mix well, centrifuge at 300 g for 5 min at room temperature, and discard the supernatant; (4) Add 300-400 μL PBS to the flow cytometer to resuspend the cells and detect them on the flow cytometer.

[0081] (5) Data were analyzed using FlowJo X 10.0.7r2 software.

[0082] The experimental results are as follows Figure 3 and Figure 4 As shown, after TADA1 gene knockout, the expression of fetal hemoglobin (HbF) in HUDEPE2 cells increased with the differentiation time; CD105, GPA (Glycophorin A, glycoprotein A) is a protein mainly expressed on the surface of red blood cells, which is used to identify and analyze red blood cell populations, such as Figure 4 As shown, HUDEPE2 cells differentiated faster after TADA1 gene knockout, and the sgTADA1#1 group and sgTADA1#2 group had more early basophils and late basophils.

[0083] In summary, the experimental results showed that after HUDEP2 cells differentiated for 3 and 5 days, qPCR and western were used to detect the expression of γ-globin, and flow cytometry was used to detect the HbF ratio and differentiation indicators. The results showed that after knocking out the TADA1 gene, the expression of γ-globin increased significantly, the HbF ratio increased, and the differentiation of HUDEP2 cells was promoted. In addition, the gene editing effect of sgTADA1#1 was better than that of sgTADA1#2.

[0084] Example 3 1. Obtaining CD34+ hematopoietic stem cells: (1) Collect single blood samples for peripheral blood mobilization.

[0085] (2) Resuspend 5 mL of single-collected blood in 25 mL of red blood cell lysis buffer, centrifuge at 400G for 5 minutes, and discard the supernatant.

[0086] (3) Wash twice with PBS.

[0087] (4) Use the CD34 positive selection kit (StemCell, Canada, Catalog #17856) to sort CD34 positive hematopoietic stem cells in single nuclei; (5) Adjust the concentration of mononuclear cells to 5 × 10 cells / mL using PBS containing 0.5% BSA. 7 / mL.

[0088] (6) Transfer the cells in (5) to a 5 mL sterile flow cytometry tube, add 50 μL of separation antibody combination (StemCell, Canada, Catalog #17856) per mL of sample and mix well, and incubate at room temperature for 5 min.

[0089] (7) RapidSpheres TM (StemCell, Canada, Catalog #17856) 30s, add 40μL RapidSpheres per mL of sample TM Mix well and incubate at room temperature for 30 seconds.

[0090] (8) Add a certain amount of PBS containing 0.5% BSA to a total volume of 2.5 mL.

[0091] (9) Place the sterile flow tube containing the sample into the EasySep TM The cells were placed in a magnetic pole (StemCell, Canada, Catalog #18000) at room temperature for 3 min.

[0092] (10) Tip over the magnetic pole and the sterile flow tube connected to it to pour out the supernatant in the sterile flow tube. The cells adsorbed to the tube wall by the magnetic pole are CD34-positive hematopoietic stem cells.

[0093] (11) Remove the flow tube from the magnet, add 2.5 mL of PBS containing 0.5% BSA to resuspend it, and then pour out the supernatant according to step (10).

[0094] (12) Repeat step (11) 2 to 3 times; (13) Remove the flow tube from the magnetic pole, add 2.5 mL of PBS containing 0.5% BSA to resuspend the cells, and centrifuge at 300 g for 5 min. The cell pellet is CD34-positive hematopoietic stem cells.

[0095] 2. Knock out the TADA1 gene in CD34-positive hematopoietic stem cells according to the method of Example 1, and perform erythroid differentiation after electroporation. The steps of inducing CD34-positive hematopoietic stem cells to differentiate into erythroid cells are as follows: Differentiation stage 1: Erythroid differentiation: Resuspend the CD34-positive hematopoietic stem cells from umbilical cord blood in the stage 1 medium and count them at 1-2×10 5 cell / mL CD34 positive hematopoietic stem cells were seeded into 12-well cell culture plates, and 1 mL of the first stage culture medium was added to each well. On the 4th day of differentiation, 1 mL of culture medium was added and cultured for up to 7 days.

[0096] Phase I culture medium composition: SFEM-II (StemCell, Canada, Catalog # 09655) was supplemented with 100 ng / mL 50 ng / mL stem cell factor (SCF), 3 U / mL erythropoietin (EPO), 10 ng / mL IL3, 50 μg / mL transferrin, 40 ng / mL insulin-like growth factor 1 (IGF1), 50 μM IBMX (3-isobutyl-1-methylxanthine), 1 μM dexamethasone, 100 U / mL penicillin, and 100 μg / mL streptomycin.

[0097] 3×10 5 Cells were seeded at a density of 5×10 cells / mL in a 12-well cell culture plate, and 1 mL of the second stage medium was added to each well. Cells were passaged on the 10th day of differentiation (the 3rd day of the second stage) at a density of 5×10 5 cell / mL until day 12.

[0098] Second stage culture medium composition: SFEM-II (StemCell, Canada, Catalog # 09655) was supplemented with the following ingredients: 50 ng / mL SCF, 3 U / mL EPO, 50 μg / mL transferrin, 100 U / mL penicillin, and 100 μg / mL streptomycin.

[0099] 3. qPCR was used to detect the expression of the corresponding genes. The experimental method was the same as in Example 2. The results were as follows: Figure 5 As shown, the expression of fetal γ-globin and embryonic ε-globin increased after TADA1 gene knockout in CD34-positive hematopoietic stem cells.

[0100] 4. The expression of γ-globin, β-globin and TADA1 was detected by immunoblotting, and the experimental method was the same as in Example 2. The results are as follows Figure 6 As shown, it was confirmed that the expression of fetal γ-globin increased after TADA1 gene knockout in CD34-positive hematopoietic stem cells.

[0101] 5. Flow cytometry was used to detect fetal hemoglobin (HbF) and its differentiation. The experimental method was the same as in Example 2. The results were as follows: Figure 7 , Figure 8 and Fig. 9 The results showed that after TADA1 gene knockout in CD34-positive hematopoietic stem cells, the expression of HbF increased with the increase of differentiation time, and the differentiation of cells into blood cells was promoted.

[0102] 6. MGG staining to detect red blood cell morphology: Take 50,000 cells differentiated for 12 days, slide them, and stain them using the Giemsa staining kit (Biyuntian C0131). The results are as follows: Fig.10 As shown, CD34-positive hematopoietic stem cells produced late-stage red blood cells at the same time after TADA1 gene knockout.

[0103] In summary, qPCR and Western Blot were used to detect the expression of γ-globin on day 12 of hematopoietic stem cell differentiation, Giemsa staining was used to detect cell morphology, and flow cytometry was used to detect the HbF ratio and differentiation indicators on days 10, 12, and 15. The results showed that the expression of γ-globin increased significantly after knockout, the HbF ratio increased, and differentiation was promoted.

[0104] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a substance that downregulates the level of TADA1 gene or its expression product in one or more of (I) to (IX): (I) increasing the expression of fetal hemoglobin in subjects; (II) preparing products for increasing fetal hemoglobin expression in a subject; (III) increasing fetal γ-globin expression in subjects; (IV) preparing products for increasing fetal γ-globin expression in a subject; (V) increasing the expression of ε-globin in the embryos of the subject; (VI) preparing a product for increasing the expression of ε globin in the embryo of a subject; (VII) Promote the differentiation of hematopoietic cells into blood cells; (VIII) Preparation of products for promoting differentiation of hematopoietic cells into blood cells; (IX) Preparation of a medicament for treating anemic diseases.

2. The use according to claim 1, characterized in that: The down-regulating of the TADA1 gene comprises knocking out the TADA1 gene by at least one gene editing system, and the substance that down-regulates the level of the TADA1 gene or its expression product comprises reagents that constitute the gene editing system.

3. The use according to claim 1, characterized in that: The subjects described in (I) to (VI) independently include hematopoietic stem cells or erythroid progenitor cells; and / or, The hematopoietic cells described in (VII) or (VIII) independently include hematopoietic stem cells or erythroid progenitor cells; and / or, The promoting of differentiation of hematopoietic cells into blood cells in (VII) or (VIII) includes promoting differentiation of hematopoietic cells into erythrocytes; and / or, The anemia disease in (IX) includes at least one of sickle cell anemia and β-thalassemia.

4. A gRNA targeting the TADA1 gene, characterized in that: It comprises at least one gRNA targeting the TADA1 gene, wherein the target sequence of the gRNA comprises at least one of the sequence shown in SEQ ID NO.1, the sequence shown in SEQ ID NO.2, the reverse complementary sequence of SEQ ID NO.1 and the reverse complementary sequence of SEQ ID NO.

2.

5. A composition for editing the TADA1 gene, characterized in that Contains (i) and (ii): (i) the gRNA targeting the TADA1 gene according to claim 4, or a polynucleotide encoding the gRNA targeting the TADA1 gene; (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

6. A modified hematopoietic cell, characterized in that The level of the TADA1 gene or its expression product in the modified hematopoietic cells is downregulated.

7. The method for preparing the modified hematopoietic cells according to claim 6, characterized in that: The method comprises obtaining the composition according to claim 5, and introducing the composition into hematopoietic cells, thereby knocking out the TADA1 gene.

8. A modified red blood cell, characterized in that The modified red blood cells are obtained by differentiation of the modified hematopoietic cells described in claim 6; or by differentiation of hematopoietic cells prepared by the preparation method described in claim 7.

9. Use of the modified hematopoietic cell according to claim 6, or the preparation method according to claim 7, or the modified red blood cell according to claim 8 in the preparation of a drug for treating anemic diseases; or in the preparation of a product for blood transfusion.

10. A pharmaceutical composition, characterized in that It comprises the modified hematopoietic cell according to claim 6, or the hematopoietic cell prepared by the preparation method according to claim 7, or the modified red blood cell according to claim 8.

Images