Application of TADA1 gene in enhancing fetal hemoglobin expression

By downregulating the TADA1 gene, using gene editing technology to improve fetal hemoglobin expression and promote erythrocyte differentiation, the problem of insufficient targets in the existing technology is solved, and new possibilities for the treatment of sickle anemia and thalassemia are provided.

CN119932032BActive Publication Date: 2025-07-08THE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510422724.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-07
Publication Date
2025-07-08
Estimated Expiration
2045-04-07

AI Technical Summary

Technical Problem

The prior art lacks effective targets in the treatment of sickle anemia and thalassemia, and it is difficult to significantly improve the expression of fetal hemoglobin and promote erythrocyte differentiation.

Method used

The TADA1 gene or its expression product is downregulated by gene editing technology, and the TADA1 gene is knocked out using gRNA and Cas nuclease compositions targeting the TADA1 gene to improve the expression of fetal gamma globin and fetal hemoglobin and promote differentiation of hematopoietic cells into hematopoietic cells.

Benefits of technology

It significantly improved the expression levels of gamma globin and fetal hemoglobin, promoted erythrocyte differentiation, provided new therapeutic targets, and was expected to achieve better therapeutic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119932032B_ABST
    Figure CN119932032B_ABST
Patent Text Reader

Abstract

The present invention provides an application of the TADA1 gene in enhancing the expression of fetal hemoglobin, which relates to the field of biotechnology. The present invention discovers a new therapeutic target, TADA1. After knocking out the TADA1 gene in HUDEP2 cells and hematopoietic stem cells by gene editing technology, it is found that the edited cells can significantly increase the expression levels of γ-globin and fetal hemoglobin (HbF), and promote erythroid differentiation. Applying substances that down-regulate the level of the TADA1 gene or its expression product includes using them in the preparation of products for enhancing the expression of fetal hemoglobin in a subject, providing a new drug target.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of the TADA1 gene in enhancing the expression of fetal hemoglobin. Background Art

[0002] The following statements provide only background information related to the present invention and do not necessarily constitute prior art.

[0003] Hemoglobin switching is the change in hemoglobin chains that occurs during specific periods of vertebrate development, enabling red blood cells to better adapt to the physiological needs of each period functionally. Starting from the neonatal stage, fetal hemoglobin (HbF) is converted to adult hemoglobin (HbA). Hemoglobin switching not only provides a model for studying gene expression during human development but also has important medical research value.

[0004] The human genome encodes three β-like globins, namely embryonic ε-globin, fetal γ-globin, and adult β-globin. During the embryonic period, embryonic ε-globin is mainly expressed in the blood; during the fetal period, ε is turned off and fetal γ-globin begins to be expressed; after birth, γ is turned off and adult β-globin begins to be expressed. Sickle cell anemia and thalassemia are caused by mutations in adult β-globin genes. Activating fetal γ-globin can replace adult β-globin to perform the oxygen-carrying function. Screening for targets or drugs that can promote the activation of fetal hemoglobin is of great significance for the treatment of sickle cell anemia and thalassemia.

[0005] Currently, there have been many reports on methods of activating γ-globin using gene editing or small molecule drugs. In particular, the methods of interfering with the expression of BCL11A, ZBTB7A, WIZ, etc. have made the fastest progress, and there are currently small-scale clinical trials underway. The prior art CN109735497A uses gene editing technology to disrupt the BCL11A genomic region at positions 60495219 to 60495336 on chromosome 2 in hematopoietic stem cells. It involves a cell therapy protocol for treating anemia diseases such as thalassemia and sickle cell anemia, efficiently and safely gene-modifying the enhancer site of BCL11A in human hematopoietic stem cells, upregulating the expression of γ-globin and fetal hemoglobin, and achieving the purpose of treating diseases.

[0006] Screening for more targets or drugs that can promote the activation of fetal hemoglobin is of great significance for the treatment of sickle cell anemia and thalassemia. It can provide more treatment products for diseases caused by the deficiency of β-like globin, which not only helps to improve the clinical symptoms of patients but may also provide new directions for the treatment of other inherited blood diseases.

[0007] In view of this, the present invention is specifically proposed. Summary of the Invention

[0008] The object of the present invention is to provide the application of the TADA1 gene in increasing the expression of fetal hemoglobin, and to provide a new therapeutic target.

[0009] To solve the above technical problems, the present invention specifically adopts the following technical solutions:

[0010] In the first aspect, there is provided the application of a substance for down-regulating the level of the TADA1 gene or its expression product in one or more of (I) to (IX):

[0011] (I) increasing the expression of fetal hemoglobin in a subject;

[0012] (II) preparing a product for increasing the expression of fetal hemoglobin in a subject;

[0013] (III) increasing the expression of fetal γ-globin in a subject;

[0014] (IV) preparing a product for increasing the expression of fetal γ-globin in a subject;

[0015] (V) increasing the expression of embryonic ε-globin in a subject;

[0016] (VI) preparing a product for increasing the expression of embryonic ε-globin in a subject;

[0017] (VII) promoting the differentiation of hematopoietic cells into blood cells;

[0018] (VIII) preparing a product for promoting the differentiation of hematopoietic cells into blood cells;

[0019] (IX) preparing a drug for treating anemic diseases.

[0020] In the second aspect, there is provided a gRNA targeting the TADA1 gene, which gRNA comprises at least one gRNA targeting the TADA1 gene, and the target sequence of the gRNA includes at least one of the sequence shown in SEQ ID NO.1, the sequence shown in SEQ ID NO.2, the reverse complementary sequence of SEQ ID NO.1 and the reverse complementary sequence of SEQ ID NO.2.

[0021] In the third aspect, there is provided a composition for editing the TADA1 gene, which composition comprises (i) and (ii):

[0022] (i) the gRNA targeting the TADA1 gene described in the second aspect, or a polynucleotide encoding the gRNA targeting the TADA1 gene described in the second aspect;

[0023] (ii) a Cas nuclease or a polynucleotide encoding a Cas nuclease.

[0024] Fourthly, a modified hematopoietic cell is provided, wherein the level of the TADA1 gene or its expression product in the modified hematopoietic cell is downregulated.

[0025] Fifthly, a method for preparing the modified hematopoietic cell described in the fourth aspect is provided. The preparation method includes obtaining the composition described in the third aspect and introducing the composition into hematopoietic cells, so that the TADA1 gene is knocked out.

[0026] Sixthly, a modified red blood cell is also provided. The modified red blood cell is differentiated from the modified hematopoietic cell described in the fourth aspect; or is differentiated from the hematopoietic cell prepared by the preparation method of the fifth aspect.

[0027] Seventhly, the modified hematopoietic cell described in the fourth aspect, or the preparation method described in the fifth aspect, or the modified red blood cell described in the sixth aspect are provided for use in preparing a drug for treating anemic diseases; or for preparing a product for blood transfusion.

[0028] Eighthly, a pharmaceutical composition is provided. The pharmaceutical composition contains the modified hematopoietic cell described in the fourth aspect, or the hematopoietic cell prepared by the preparation method described in the fifth aspect, or the modified red blood cell described in the sixth aspect.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention discovers a new therapeutic target, TADA1. After knocking out the TADA1 gene in HUDEP2 cells and hematopoietic stem cells through gene editing technology, it is found that the edited cells can significantly increase the expression levels of γ-globin and fetal hemoglobin (HbF), and promote erythroid differentiation. This discovery indicates that TADA1 is expected to become a new target for treating β-thalassemia and sickle cell anemia.

[0031] Different from the prior art which mainly focuses on a single target, the BCL11A enhancer, downregulating TADA1 can not only significantly promote the expression of fetal hemoglobin, but also promote erythroid differentiation, and is expected to achieve better therapeutic effects. This innovative target discovery provides new possibilities to meet clinical needs. Especially in the context where existing gene editing therapies such as CRISPR / Cas9 have made certain progress in the application of the BCL11A enhancer region, the discovery of TADA1 provides a wider range of strategic choices for gene therapy of related diseases. Description of the Drawings

[0032] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0033] Figure 1 For detecting the relative expression levels of each globin mRNA by RT-qPCR in Example 2, the T test was used to test for significance. "*" indicates a significant difference, where 0.01 ≤ P < 0.05; "**" indicates a highly significant difference, where 0.001 ≤ P < 0.01; "****" indicates a highly significant difference, where P < 0.0001.

[0034] Figure 2 For detecting the expression levels of γ-globin and β-globin by immunoblotting in Example 2.

[0035] Figure 3 For the results of flow cytometry detection of fetal hemoglobin (HbF) at day 0, 3, and 5 of differentiation in Example 2.

[0036] Figure 4 For the detection of the differentiation of HUDEPE2 cells by flow cytometry at day 0, 3, and 5 of differentiation in Example 2. Among them, ProE is pronormoblast, EBaso is early basophilic normoblast, LBaso is late basophilic normoblast, and Poly is polychromatic normoblast.

[0037] Figure 5 For detecting the relative expression levels of fetal γ-globin and embryonic ε-globin mRNA by RT-qPCR in Example 3, the T test was used to test for significance. "**" indicates a highly significant difference, where 0.001 ≤ P < 0.01.

[0038] Figure 6 For detecting the expression levels of γ-globin and β-globin by immunoblotting in Example 3.

[0039] Figure 7 For the detection of the expression of fetal hemoglobin (HbF) and cell differentiation of CD34+ hematopoietic stem cells by flow cytometry at day 10 of differentiation in Example 3. Among them, ProE is pronormoblast, EBaso is early basophilic normoblast, LBaso is late basophilic normoblast, Poly is polychromatic normoblast, and Ortho represents orthochromatic normoblast.

[0040] Figure 8For the detection of the expression of fetal hemoglobin (HbF) and cell differentiation of CD34+ hematopoietic stem cells by flow cytometry on day 12 of differentiation in Example 3, ProE represents pronormoblasts, EBaso represents early basophilic normoblasts, LBaso represents late basophilic normoblasts, Poly represents polychromatic normoblasts, and Ortho represents orthochromatic normoblasts;

[0041] Figure 9 For the detection of the expression of fetal hemoglobin (HbF) and cell differentiation of CD34+ hematopoietic stem cells by flow cytometry on day 15 of differentiation in Example 3, ProE represents pronormoblasts, EBaso represents early basophilic normoblasts, LBaso represents late basophilic normoblasts, Poly represents polychromatic normoblasts, and Ortho represents orthochromatic normoblasts;

[0042] Figure 10 For the results of MGG staining of red blood cell morphology in Example 3. Detailed implementation manners

[0043] Next, the technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0044] In this article, unless otherwise specified, any numbering is used to distinguish one entity or behavior from another entity or behavior, rather than necessarily requiring or implying any actual such relationship, order, or importance between these entities or behaviors, such as numbers (Ⅰ), (Ⅱ)......(Ⅸ); and (ⅰ) and (ⅱ), etc.

[0045] In this article, the term "downregulation" can be used interchangeably with "reduction", "silencing", "inhibition", and other similar terms, and includes any level of downregulation. Downregulation can be evaluated by a decrease in the absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level used in the art, such as the baseline level before intervention or the level determined from subjects, cells, or samples that have not been treated or have been treated with a control (such as a buffer control or an inert agent control) only.

[0046] In this article, the terms "subject", "patient", or "individual" can be used interchangeably and include human or non-human animals, or cells or tissues derived from human or non-human animals. The mammals include, for example, humans, monkeys, mice, rats, rabbits, donkeys, cows, horses, pigs, or dogs.

[0047] As used herein, the terms "treat", "alleviate", or "ameliorate" may be used interchangeably herein. These terms refer to methods of obtaining a beneficial or desired result, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradicating or ameliorating one or more physiological symptoms associated with the underlying disorder being treated.

[0048] As used herein, unless otherwise indicated, "optionally", "optional", "alternatively", or "alternate" means that the subsequently described event or circumstance can but does not have to occur, and the description includes instances where the event or circumstance occurs or does not occur.

[0049] As used herein, the term "comprising" or "including" means including the recited element, integer, or step, but not excluding any other element, integer, or step.

[0050] As used herein, the terms "each... independently selected from", "each... individually and independently selected from", and "independently selected from" may be used interchangeably and are to be construed broadly to mean that the selection process of multiple objects or elements is independent of each other, each object can freely select from the given options, and the selection result is not affected by the selection of other objects.

[0051] As used herein, "hematopoietic cell" refers to a cell capable of differentiating into various blood cells, including stem cells and progenitor cells.

[0052] As used herein, "Cas nuclease" refers to a Cas nuclease capable of binding to a target sequence, or cleaving or nicking a target sequence, or inducing mutations in a target sequence, including but not limited to a native Cas nuclease or a polypeptide or complex containing the main functional domain of a Cas nuclease; or a mutated Cas nuclease or polypeptide; or a fusion protein containing a Cas nuclease or a Cas nuclease functional domain fused to other functional regions. The Cas nuclease includes but is not limited to Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9, or SpCas9; or a protein, polypeptide, or complex resulting from mutation and / or fusion of the above Cas nucleases with other functional domains.

[0053] As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include but are not limited to single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemical, or biochemical modifications, unnatural, or derivatized nucleobases. The terms "polynucleotide" and "nucleic acid" may be used interchangeably herein.

[0054] The TADA1 gene, also known as Transcriptional Adaptor 1, encodes a protein subunit of the STAGA complex (SPT3; (MIM 602947) / TAF9 (MIM 600822) / GCN5 (MIM 602301) acetyltransferase complex), which is a chromatin-modifying multi-protein complex. The TADA1 gene is expressed in multiple tissues, including the brain, bone marrow, etc. The protein product of this gene is involved in multiple biological processes, including protein heterodimer activity and histone acetyltransferase activity. It has been experimentally verified that knocking out the TADA1 gene can promote the expression of fetal γ-globin, embryonic ε-globin, and fetal hemoglobin, as well as promote the differentiation of hematopoietic cells into blood cells. Based on this discovery, the following technical solutions are proposed.

[0055] In a first aspect, there is provided the use of a substance for downregulating the TADA1 gene or its expression product in one or more of (I) to (IX):

[0056] (I) increasing the expression of fetal hemoglobin in a subject;

[0057] (II) preparing a product for increasing the expression of fetal hemoglobin in a subject;

[0058] (III) increasing the expression of fetal γ-globin in a subject;

[0059] (IV) preparing a product for increasing the expression of fetal γ-globin in a subject;

[0060] (V) increasing the expression of embryonic ε-globin in a subject;

[0061] (VI) preparing a product for increasing the expression of embryonic ε-globin in a subject;

[0062] (VII) promoting the differentiation of hematopoietic cells into blood cells;

[0063] (VIII) preparing a product for promoting the differentiation of hematopoietic cells into blood cells;

[0064] (IX) preparing a drug for treating anemic diseases.

[0065] The expression products of the TADA1 gene include the products generated by the TADA1 gene through processes such as transcription and translation, which can be direct products or products after cleavage, recombination, replication, or metabolism of the direct products. Exemplary "expression products of the gene" include, but are not limited to, RNA, polypeptides, or proteins. Downregulating the level of the TADA1 gene or its expression products includes reducing the content and / or activity of the TADA1 gene or its expression products. For example, but not limited to, inhibiting the transcription of the TADA1 gene, reducing the copy number of the TADA1 gene in a subject, knocking out the TADA1 gene in a subject, inhibiting the translation of the mRNA encoding TADA1, and reducing the content or activity of the TADA1 protein, one or more of these.

[0066] In an alternative embodiment, the substances for downregulating the TADA1 gene or its expression products include polynucleotides targeting the TADA1 gene or TADA1 mRNA and / or anti-TADA1 antibodies or antigen-binding fragments thereof.

[0067] In an alternative embodiment, the polynucleotides targeting the TADA1 gene or TADA1 mRNA include at least one of antisense oligonucleotides (ASO), siRNA (Small interfering RNA), shRNA (short hairpin RNA), dsRNA (double-stranded RNA), and gRNA (guide RNA).

[0068] In an alternative embodiment, downregulating the TADA1 gene includes knocking out the TADA1 gene through at least one gene editing system, and the substances for downregulating the level of the TADA1 gene or its expression products include the reagents constituting the gene editing system. The gene editing system includes, but is not limited to, the Zinc Finger Nucleases (ZFN) gene editing system, the Transcription Activator-Like Effector Nucleases (TALEN) gene editing system, or the CRISPR-Cas gene editing system.

[0069] In an alternative embodiment, downregulating the TADA1 gene includes knocking out the TADA1 gene through the CRISPR-Cas gene editing system. The substances for downregulating the TADA1 gene or its expression products include, but are not limited to, one or more of gRNA (guide RNA), Cas nuclease, delivery system, and buffer components.

[0070] In an alternative embodiment, the downregulation of the TADA1 gene comprises a gRNA targeting the TADA1 gene, the gRNA targeting the TADA1 gene comprises at least one gRNA targeting the TADA1 gene, and the target sequence of the gRNA comprises at least one of the sequences shown in SEQ ID NO.1, the sequence shown in SEQ ID NO.2, the reverse complementary sequence of SEQ ID NO.1, and the reverse complementary sequence of SEQ ID NO.2. Preferably, the target sequence of the gRNA comprises the sequence shown in SEQ ID NO.1.

[0071] In an alternative embodiment, the subjects described in (I)-(VI) each independently comprise hematopoietic stem cells or erythroid progenitor cells.

[0072] In an alternative embodiment, the hematopoietic cells described in (VII) or (VIII) each independently comprise hematopoietic stem cells or erythroid progenitor cells.

[0073] In an alternative embodiment, promoting the differentiation of hematopoietic cells into blood cells in (VII) or (VIII) comprises promoting the differentiation of hematopoietic cells into red blood cells.

[0074] In an alternative embodiment, the anemia diseases in (IX) include at least one of sickle cell anemia and β-thalassemia.

[0075] In an alternative embodiment, the applications of any one of the above (I)-(IX) are for non-diagnostic and non-therapeutic purposes.

[0076] In a second aspect, there is provided a gRNA targeting the TADA1 gene, the gRNA targeting the TADA1 gene comprises at least one gRNA targeting the TADA1 gene, and the target sequence of the gRNA comprises at least one of the sequences shown in SEQ ID NO.1, the sequence shown in SEQ ID NO.2, the reverse complementary sequence of SEQ ID NO.1, and the reverse complementary sequence of SEQ ID NO.2.

[0077] In a third aspect, there is provided a composition for editing the TADA1 gene, the composition comprising (i) and (ii):

[0078] (i) The gRNA targeting the TADA1 gene according to the second aspect, or a polynucleotide encoding the gRNA targeting the TADA1 gene according to the second aspect.

[0079] (ii) A Cas nuclease or a polynucleotide encoding a Cas nuclease.

[0080] In an alternative embodiment, the polynucleotide encoding the gRNA is DNA or RNA, and the DNA or RNA is transformed into a test cell for expressing the gRNA. The DNA encoding the gRNA is, for example but not limited to, a recombinant plasmid, and the RNA encoding the gRNA is, for example but not limited to, mRNA.

[0081] In an alternative embodiment, the polynucleotide encoding the Cas nuclease is DNA or RNA, and the DNA or RNA is transformed into a test cell for expressing the Cas nuclease. The DNA encoding the Cas nuclease is, for example but not limited to, a recombinant plasmid, and the RNA encoding the Cas nuclease is, for example but not limited to, mRNA.

[0082] In an alternative embodiment, the same recombinant vector contains a fragment encoding the above gRNA and a fragment encoding the Cas nuclease.

[0083] In an alternative embodiment, the composition for editing the TADA1 gene comprises a ribonucleoprotein complex (RNP) formed by a Cas nuclease and a gRNA.

[0084] In a fourth aspect, a modified hematopoietic cell is provided, wherein the level of the TADA1 gene or its expression product in the modified hematopoietic cell is down-regulated.

[0085] In an alternative embodiment, the TADA1 gene in the modified hematopoietic cell is knocked out.

[0086] In an alternative embodiment, the TADA1 gene in the modified hematopoietic cell is knocked out using the composition of the third aspect.

[0087] In an alternative embodiment, the modified hematopoietic cell includes a hematopoietic stem cell or an erythroid progenitor cell.

[0088] In a fifth aspect, a method for preparing a modified hematopoietic cell is provided, the method comprising obtaining the composition of the third aspect and introducing the composition into a hematopoietic cell, thereby knocking out the expression of the TADA1 gene.

[0089] In an alternative embodiment, any known and conventional method in the art can be used to introduce the composition for editing the TADA1 gene into a hematopoietic stem cell or an erythroid progenitor cell in the preparation method, and the introduction methods are, for example but not limited to, liposome introduction, nanoparticle delivery, vector, transfection, heat shock, electroporation, transduction, gene gun or microinjection.

[0090] In an alternative embodiment, the composition for editing the TADA1 gene includes an RNP complex formed by a Cas nuclease and a gRNA, and it is introduced into the hematopoietic cell to be edited by electroporation.

[0091] In a sixth aspect, a modified red blood cell is provided, which is differentiated from the modified hematopoietic cell of the fifth aspect; or is differentiated from the hematopoietic cell prepared by the preparation method described in the fifth aspect.

[0092] In an optional embodiment, the modified red blood cell is differentiated from a modified hematopoietic stem cell or erythrocyte progenitor cell.

[0093] In a seventh aspect, there is provided the use of the modified hematopoietic cell of the fourth aspect, or the preparation method described in the fifth aspect, or the modified red blood cell described in the sixth aspect in the preparation of a drug for treating anemic diseases; or in the preparation of a product for blood transfusion.

[0094] In an optional embodiment, the anemic disease includes at least one of sickle cell anemia and β-thalassemia.

[0095] In an eighth aspect, a pharmaceutical composition is provided, which comprises the modified hematopoietic cell described in the fourth aspect, or the hematopoietic cell prepared by the preparation method described in the fifth aspect, or the modified red blood cell described in the sixth aspect.

[0096] In an optional embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient. The excipients include, but are not limited to, one or a combination of anticoagulants, diluents, buffers, protectants, stabilizers, suspending agents, solvents and buffer systems.

[0097] The present invention will be further illustrated by specific examples below. However, it should be understood that these examples are only for more detailed illustration and should not be construed as limiting the present invention in any way.

[0098] Example 1

[0099] Method for knocking out the TADA1 gene:

[0100] 1. sgRNA target sequence:

[0101] sgTADA1#1: AGCTCATAGACTTCTCACAC (SEQ ID NO.1);

[0102] sgTADA1#2: ACTGGGCTAACCTAAAGCTG (SEQ ID NO.2).

[0103] 2. Transfection: Using the LONZA electroporation kit (V4XP-3024), the sgRNA / cas9 RNP complex was transfected into cells by electroporation.

[0104] (1) Dissolve sgRNA with ddH2O to a final concentration of 100 pmol / μL. Pipette 1 μL of cas9 protein (concentration: 10 μg / μL) and 1 μL of sgRNA, mix well, and incubate at room temperature for 10 minutes.

[0105] (2) Resuspend the cells with resuspension buffer. After mixing well with the complex in (1), transfer the mixture into an electroporation cuvette.

[0106] (3) Perform electroporation using the CM137 program.

[0107] 3. After electroporation, induce differentiation towards erythroid blood cells.

[0108] Example 2

[0109] 1. Knock out the TADA1 gene in HUDEPE2 cells (Human Umbilical cord blood-derived Erythroid Progenitor cells) according to the method of Example 1. After electroporation, induce differentiation towards erythroid blood cells. The differentiation steps of HUDEPE2 cells are as follows:

[0110] Resuspend HUDEP2 cells with the first-stage medium, count the cells, and seed 3×10 5 cells / mL into a 12-well cell culture plate. Add 1 mL of the first-stage medium to each well and differentiate for 3 days.

[0111] Composition of the first-stage medium: Add the following components to SFEM-II (StemCell Technologies, Catalog #09655): 2% FBS, 3% AB serum, 50 ng / mL stem cell factor (SCF), 3 U / mL erythropoietin (EPO), 10 μg / mL insulin, 3 U / mL heparin, 1 mg / mL transferrin, 1 μg / mL doxycycline (DOX), 100 U / mL penicillin, and 100 μg / mL streptomycin.

[0112] Resuspend HUDEP2 cells with the second-stage medium, count the cells, and seed 3×10 5 cells / mL into a 12-well cell culture plate. Add 1 mL of the second-stage medium to each well and differentiate for 5 days.

[0113] Components of the second-stage culture medium: Add the following components to SFEM-II (StemCell Technologies, Catalog # 09655), 2% FBS, 3% AB serum, 3 U / mL erythropoietin (EPO), 10 μg / mL insulin, 3 U / mL heparin, 1 mg / mL transferrin, 1 μg / mL doxycycline (DOX), 100 U / mL penicillin, and 100 μg / mL streptomycin.

[0114] 2. qPCR detection of the expression of corresponding genes:

[0115] Collect 1×10 6 cells at different days of differentiation, wash them once with PBS, extract RNA using the Trizon method, reverse transcribe with a reverse transcription kit (Vazyme R323-01), and then perform RT-qPCR detection. The results are as Figure 1 shown. After knocking out the TADA1 gene, the expression of fetal γ-globin and embryonic ε-globin increased, and there was no significant effect on the expression of adult β-globin and α-globin. Moreover, the knockout effect of sgTADA1#1 was better than that of sgTADA1#2.

[0116] 3. Detection of the expression of γ-globin, β-globin, and TADA1 by Western Blot: Collect 1×10 6 cells at different days of differentiation, wash them once with PBS, add 40 μL of 1×SDS loading, boil the samples at 95°C for 30 minutes, and then perform Western Blot detection. The results are as Figure 2 shown, confirming that the expression level of fetal γ-globin increased after knocking out the TADA1 gene.

[0117] 4. Flow cytometry detection of fetal hemoglobin (HbF) and differentiation status, including the following steps:

[0118] (1) Preparation of cell suspension: For red blood cells at different differentiation stages to be detected, take 1×10 5 cells and add them to a flow cytometry tube, resuspend and wash them with 1 mL of PBS, centrifuge at 300 g for 5 min, and discard the supernatant.

[0119] (2) Antibody labeling: Resuspend the cells in 100 μL of PBS to form a single-cell suspension, add 1 μL of the antibody to detect the surface antigen, and incubate at 4°C in the dark for 30 min.

[0120] (3) Washing: Add 1 mL of PBS buffer to each tube, mix well, centrifuge at 300 g for 5 min at room temperature, and discard the supernatant;

[0121] (4) Resuspend the cells by adding 300 - 400 μL of PBS to the flow tube and detect them using a flow cytometer.

[0122] (5) Analyze the data using FlowJo X 10.0.7r2 software.

[0123] The experimental results are as Figure 3 and Figure 4 shown. After knocking out the TADA1 gene, the expression level of fetal hemoglobin (HbF) in HUDEPE2 cells increased with the increase of differentiation time; CD105 and GPA (Glycophorin A) are proteins mainly expressed on the surface of red blood cells and are used to identify and analyze red blood cell populations. As Figure 4 shown, after knocking out the TADA1 gene, the differentiation rate of HUDEPE2 cells was faster, and the sgTADA1#1 group and the sgTADA1#2 group had more early basophilic erythrocytes and late basophilic erythrocytes.

[0124] In summary, the experimental results showed that when detecting the expression of γ-globin by qPCR and western blotting, and detecting the HbF ratio and differentiation index by flow cytometry after 3 days and 5 days of differentiation of HUDEP2 cells, the results showed that the expression of γ-globin increased significantly after knocking out the TADA1 gene, the HbF ratio increased, which promoted the differentiation of HUDEP2 cells, and the gene editing effect of sgTADA1#1 was better than that of sgTADA1#2.

[0125] Example 3

[0126] 1. Obtaining CD34+ hematopoietic stem cells:

[0127] (1) Collect apheresis blood mobilized from peripheral blood.

[0128] (2) Resuspend 5 mL of apheresis blood with 25 mL of red blood cell lysate, centrifuge at 400G for 5 minutes, and discard the supernatant.

[0129] (3) Wash twice with PBS.

[0130] (4) Sort CD34+ positive hematopoietic stem cells in mononuclear cells using a CD34 positive selection kit (StemCell Technologies, Canada, Catalog #17856);

[0131] (5) Adjust the concentration of the obtained mononuclear cells to 5×10 7 / mL with PBS containing 0.5% BSA.

[0132] (6) Transfer the cells in (5) into a 5 mL sterile flow tube, add 50 μL of the separation antibody combination (StemCell Technologies, Catalog #17856) to each milliliter of the sample, and mix well. Incubate at room temperature for 5 min.

[0133] (7) Vortex RapidSpheres TM (StemCell Technologies, Catalog #17856) for 30 s, add 40 μL of RapidSpheres to each milliliter of the sample TM and mix well. Incubate at room temperature for 30 s.

[0134] (8) Add a certain amount of PBS containing 0.5% BSA to a total volume of 2.5 mL.

[0135] (9) Place the sterile flow tube containing the sample into the EasySep TM magnet pole (StemCell Technologies, Catalog#18000) and let it stand at room temperature for 3 min.

[0136] (10) Tilt the magnet pole and the attached sterile flow tube to pour out the supernatant in the sterile flow tube. The cells adsorbed on the tube wall by the magnet pole are CD34-positive hematopoietic stem cells.

[0137] (11) Remove the flow tube from the magnet pole, resuspend with 2.5 mL of PBS containing 0.5% BSA, and then pour out the supernatant according to step (10).

[0138] (12) Repeat step (11) 2 - 3 times;

[0139] (13) Remove the flow tube from the magnet pole, resuspend the cells with 2.5 mL of PBS containing 0.5% BSA, centrifuge at 300 g for 5 min, and the cell pellet is CD34-positive hematopoietic stem cells.

[0140] 2. Knock out the TADA1 gene in CD34-positive hematopoietic stem cells according to the method of Example 1. After electroporation, induce differentiation in the erythroid blood cell direction. The steps for inducing CD34-positive hematopoietic stem cells to differentiate into red blood cells are as follows:

[0141] First stage of differentiation: Erythroid lineage commitment: Resuspend CD34-positive hematopoietic stem cells derived from umbilical cord blood with the first-stage medium, count, and seed at 1 - 2×10 5 cells / mL of CD34-positive hematopoietic stem cells into a 12-well cell culture plate, and add 1 mL of the first-stage medium to each well. On the 4th day of differentiation, supplement 1 mL of the medium and culture for 7 days.

[0142] Composition of the first-stage culture medium: Add the following components to SFEM-II (StemCell Technologies, Catalog # 09655), 100 ng / mL 50 ng / mL stem cell factor (SCF), 3 U / mL erythropoietin (EPO), 10 ng / mL IL3, 50 μg / mL transferrin, 40 ng / mL insulin-like growth factor 1 (IGF1), 50 μM IBMX (3-isobutyl-1-methylxanthine), 1 μM dexamethasone, 100 U / mL penicillin, 100 μg / mL streptomycin.

[0143] Seed into a 12-well cell culture plate at a density of 3×10 5 cells / mL, and add 1 mL of the second-stage culture medium to each well. Passage the cells on the 10th day of differentiation (the 3rd day of the second stage) at a density of 5×10 5 cells / mL until the 12th day.

[0144] Composition of the second-stage culture medium: Add the following components to SFEM-II (StemCell Technologies, Catalog # 09655), 50 ng / mL SCF, 3 U / mL EPO, 50 μg / mL transferrin, 100 U / mL penicillin, 100 μg / mL streptomycin.

[0145] 3. Detect the expression of the corresponding genes by qPCR, and the experimental method is the same as that in Example 2. The results are as Figure 5 shown. After knocking out the TADA1 gene in CD34-positive hematopoietic stem cells, the expression of fetal γ-globin and embryonic ε-globin increases.

[0146] 4. Detect the expression of γ-globin, β-globin and TADA1 by immunoblotting, and the experimental method is the same as that in Example 2. The results are as Figure 6 shown, which confirms that the expression level of fetal γ-globin increases after knocking out the TADA1 gene in CD34-positive hematopoietic stem cells.

[0147] 5. Detect fetal hemoglobin (HbF) and the differentiation status by flow cytometry, and the experimental method is the same as that in Example 2. The results are as Figure 7 , Figure 8 and Figure 9 shown. The results show that after knocking out the TADA1 gene in CD34-positive hematopoietic stem cells, the expression level of HbF increases with the increase of differentiation time, and it promotes the differentiation of cells into blood cells.

[0148] 6. Detect the morphology of red blood cells by MGG staining: Take 50,000 cells differentiated for 12 days, make a smear, and stain with Giemsa staining kit (Beyotime C0131). The results are asFigure 10 As shown, after knocking out the TADA1 gene in CD34-positive hematopoietic stem cells, late-stage-biased erythrocytes are produced at the same time.

[0149] In summary, the expression of γ-globin was detected by qPCR and Western Blot on day 12 of hematopoietic stem cell differentiation, cell morphology was detected by Giemsa staining, the HbF ratio was detected by flow cytometry on days 10, 12, and 15, as well as the differentiation index. The results showed that the expression of γ-globin increased significantly after knockout, the HbF ratio increased, and differentiation was promoted.

[0150] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present invention, rather than limiting it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a substance for downregulating the level of the TADA1 gene or its expression product in one or more of (V) to (VIII): (V) Enhancing embryonic ε-globin expression in hematopoietic stem cells or erythroid progenitor cells for non-diagnostic and non-therapeutic purposes; (VI) Preparing a product for enhancing embryonic ε-globin expression in a subject; (VII) Promoting the differentiation of hematopoietic cells into erythrocytes in vitro for non-diagnostic and non-therapeutic purposes; (VIII) Preparing a product for promoting the differentiation of hematopoietic cells into erythrocytes; The substance for downregulating the level of the TADA1 gene or its expression product is a composition for editing the TADA1 gene using the CRISPR-Cas gene editing system, comprising (i) and (ii): (i) A gRNA targeting the TADA1 gene, and the target sequence is the sequence shown in SEQ ID NO.1 or the sequence shown in SEQ ID NO.2; (ii) A Cas nuclease or a polynucleotide encoding a Cas nuclease.

2. The application according to claim 1, wherein The subject in (VI) includes hematopoietic stem cells or erythroid progenitor cells.

3. The application according to claim 1, characterized in that, The hematopoietic cells in (VII) or (VIII) each independently include hematopoietic stem cells or erythroid progenitor cells.

Citation Information

Patent Citations

  • Method for increasing fetal hemoglobin expression level

    CN109735497A

  • Compositions and methods for increasing fetal hemoglobin and treating sickle cell disease

    US20220017908A1