Asiatic corn borer MSL2 gene and application thereof in prevention and control of Asiatic corn borer

Abstract

The invention discloses an ostrinia furnacalis MSL2 gene and application thereof in prevention and treatment of the ostrinia furnacalis. Wherein the nucleotide sequence of the Asiatic corn borer MSL2 gene is as shown in SEQ ID NO: 1. The nucleotide sequence of the RNA interference sequence fragment of the Asiatic corn borer MSL2 gene is shown as SEQ ID NO: 2. The invention also provides application of the dsRNA synthesized by the RNA interference sequence fragment of the Asiatic corn borer MSL2 gene in prevention and treatment of the Asiatic corn borer. According to the invention, dsRNA synthesis is carried out aiming at a specific fragment of the Asiatic corn borer MSL2 gene, and the synthesized dsRNA is used for carrying out RNA interference on a target gene, so that the gene transcription level is knocked down, the survival rate of Asiatic corn borer larvae is remarkably reduced, and the dsRNA has the potential of research, development and application of targeted nucleic acid pesticides.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an Asian corn borer MSL2 gene and application thereof in the prevention and treatment of the Asian corn borer. Background Art

[0002] The Asian corn borer (Ostrinia furnacalis) is an important pest of corn. At present, the control of the Asian corn borer is mainly based on chemical control, but chemical pesticides have a wide range of insecticides and can also control some natural enemy insects. Frequent use of the same or the same type of chemical pesticides can easily lead to pesticide resistance problems. Therefore, screening and discovering new targets for the control of the Asian corn borer is of great practical significance.

[0003] In Drosophila (XY type), the MSL complex is the core of its dosage compensation mechanism. It transcriptionally upregulates some specific sites on the X chromosome of male Drosophila and is a key factor in determining the survival of male Drosophila. The MSL complex includes five protein subunits: MSL1, MSL2, MSL3, MLE and MOF. MSL2 is used to bind to MSL1 and bind to some high-affinity sites on the X chromosome together with MSL1, thereby mediating the assembly of the remaining MSL factors. The loss of MSL2 causes male-specific lethality. In XY species, the MSL complex has also been found to be involved in the regulation of insect growth and development. However, the function of the MSL2 gene of the Asian corn borer is still unclear. It is an urgent research topic to study the function of the MSL2 gene of the Asian corn borer, so as to apply it to the control of the Asian corn borer and provide environmentally friendly control technology for the Asian corn borer.

[0004] Therefore, the prior art urgently needs an Asian corn borer MSL2 gene, an Asian corn borer MSL2 gene RNA interference sequence fragment, and a dsRNA synthesized from the Asian corn borer MSL2 gene RNA interference sequence fragment for use in the prevention and control of Asian corn borer. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an Asian corn borer MSL2 gene, an Asian corn borer MSL2 gene RNA interference sequence fragment and a dsRNA synthesized from the Asian corn borer MSL2 gene RNA interference sequence fragment for use in the prevention and control of Asian corn borer.

[0006] The objective of the present invention is achieved through the following technical solutions: An Asian corn borer MSL2 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0007] The present invention also provides an RNA interference sequence fragment of the MSL2 gene of the Asian corn borer, and the nucleotide sequence is shown in SEQ ID NO: 2. The nucleotide sequence of the primer used to synthesize the RNA interference sequence fragment is as follows: dsMSL2-F: taatacgactcactataggggCAGCTACGCCTGGGAAATTA (SEQ ID NO3); dsMSL2-R: taatacgactcactataggggTCGTCGTTGTCTTGGTCTTG (SEQ ID NO4).

[0008] The present invention further synthesizes dsRNA based on the RNA interference sequence fragment of the MSL2 gene of Asian corn borer.

[0009] The invention also provides the application of dsRNA in the prevention and treatment of Asian corn borer, which performs RNA interference on the Asian corn borer, inhibits its growth and development, and causes its death.

[0010] The beneficial effects of the present invention are as follows: the present invention synthesizes dsRNA for a specific fragment of the MSL2 gene of the Asian corn borer, uses the synthesized dsRNA to perform RNA interference on the target gene, achieves gene transcription level knockdown, significantly reduces the survival rate of the Asian corn borer larvae, and has the research and development and application potential of targeted nucleic acid pesticides. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 is the RNA interference efficiency of the MSL2 gene (the ordinate represents the relative expression of the MSL2 gene; in the abscissa, dsGFP represents the control group, and dsMSL2 represents the MSL2 gene RNA interference group); Figure 2 is the larval mortality rate after RNA interference of the MSL2 gene (the ordinate represents the mortality rate of the Asian corn borer larvae; the abscissa dsGFP represents the control group, and dsMSL2 represents the MSL2 gene RNA interference group). DETAILED DESCRIPTION

[0012] The present invention is described in detail below in conjunction with the accompanying drawings.

[0013] Example

[0014] 1. Extraction of genomic RNA from Ostrinia furnacalis 1) Place the Asian corn borer sample in a 1.5mL centrifuge tube, add 200uL TRIzol, grind the tissue evenly with a tissue grinder, then add 800uL TRIzol, mix thoroughly, and let stand at room temperature for 5 minutes; 2) Add 200uL of chloroform to the solution obtained in step 1), shake vigorously for 15s, and let stand at room temperature for 10min; 3) Centrifuge at 4°C (12000 rpm × 15 min), transfer the upper aqueous phase to a new 1.5 mL centrifuge tube; 4) Add 500 μL of isopropanol, gently invert upside down to mix, and let stand at room temperature for 10 minutes; 5) Centrifuge at 4°C (12000rpm × 10min). At this time, the RNA will precipitate at the bottom of the tube. Remove the supernatant. If the amount is large, a white gelatinous precipitate will appear. 6) Add 1 mL of 75% ethanol (prepared with RNase-free water), flick the precipitate with your fingers, and gently invert it to wash the precipitate. Centrifuge at 4 °C (12000 rpm × 5 min), and discard the supernatant; 7) Repeat step 6) once; 8) Let it dry at room temperature for 5-10 minutes. Add 20-40 μL of RNase-free water to dissolve the precipitate. If necessary, use a pipette to gently blow or incubate at 55-60℃ for 5-10 minutes to assist in dissolution. After the precipitate is completely dissolved, store the resulting RNA solution in a -80℃ refrigerator for subsequent experiments.

[0015] 2. Reverse transcription of RNA Add 1 μg of the above RNA solution to a 200 μl centrifuge tube, and obtain the first strand cDNA according to the instructions of TAKARA's 1st strand cDNA Synthesis Kit (6110A), and store it at -20°C for later use.

[0016] 3. Amplification and purification of target fragment of MSL2 gene of Asian corn borer Using the above cDNA as a template, the double-stranded synthesized target fragment was amplified by PCR. The amplified RNA interference sequence fragment is shown in SEQ ID NO: 2. The nucleotide sequences of the primers used are as follows: dsMSL2-F: taatacgactcactataggggCAGCTACGCCTGGGAAATTA (SEQ ID NO3); dsMSL2-R: taatacgactcactataggggTCGTCGTTGTCTTGGTCTTG (SEQ ID NO4).

[0017] The PCR reaction system is shown in Table 1.

[0018]

[0019] The PCR reaction program is shown in Table 2.

[0020]

[0021] The PCR product was purified using a PCR clean-up kit and stored at -20°C to serve as a template for the next step of dsRNA synthesis.

[0022] 4. Synthesis and purification of dsRNA of the MSL2 gene of Ostrinia furnacalis 1) Mix the reagents according to the system in Table 3, flick to mix, centrifuge briefly, and place in a 37℃ metal bath for 4 hours.

[0023]

[0024] 2) The solution obtained in step 1) was treated with DEPC H 2 HO to make up to 200 μL.

[0025] 3) Add half equal volume (100 μL) of water-saturated phenol reagent and half equal volume of chloroform (100 μL).

[0026] 4) Mix gently and centrifuge in a 4°C centrifuge (12,000 rpm, 4°C) for 15 min.

[0027] 5) Take the upper phase, add an equal volume of chloroform (200 μL), mix gently, and centrifuge in a 4°C centrifuge (12,000 rpm, 4°C) for 15 min.

[0028] 6) Take the upper phase, add 1 / 10 volume (20 μL) of 3M sodium acetate (pH 5.2) and 2.5 volumes (500 μL) of 100% ethanol (stored at -20°C), mix gently and place at -20°C for half an hour.

[0029] 7) Centrifuge in a 4°C centrifuge (12,000 rpm, 4°C) for 30 min.

[0030] 8) At this time, a white precipitate appears at the bottom of the centrifuge tube. Discard the supernatant, add 80% ethanol (stored at -20°C), mix gently, and wash the precipitate.

[0031] 9) Centrifuge in a 4°C centrifuge (7500 rpm, 4°C) for 5 min.

[0032] 10) Slowly aspirate the ethanol and slowly aspirate the supernatant close to the precipitate with a 10μL pipette. To prevent the precipitate from being aspirated together, finally open the centrifuge tube with a small amount of remaining ethanol and dry it. After about 10 minutes, all the ethanol will evaporate.

[0033] 11) Add 20 μL enzyme-free HO 2O, flick the bottom of the tube to fully dissolve the precipitate, and store it at -80℃.

[0034] 5. RNA interference of Asian corn borer MSL2 (feeding interference) According to Table 4, the 2-5th instar larvae of Asian corn borer were fed with dsGFP for 4 times in a row, and the treatment group was fed with dsMSL2. There were 5 replicates in each of the CK and treatment groups, with 20 larvae in each replicate. The specific operation was to place a single insect in an insect culture plate, add a certain amount of artificial feed, drip a certain amount of dsRNA solution on it, and raise it normally in an incubator.

[0035]

[0036] 6. RNA interference efficiency detection and mortality statistics of the MSL2 gene of Asian corn borer On the second day after the 5th instar feeding disturbance, samples were taken from each group, with 3 replicates (5 larvae / replicate) for RNA extraction and subsequent fluorescence quantitative PCR detection of MSL2 gene expression. The primer sequences for real-time fluorescence quantitative PCR of MSL2 gene and internal reference gene rpL8 were: qMSL2-F1:GAGGGTGCTGGCTTCTCTGA (SEQ ID NO5); qMSL2-R1: TGTGTCTGTGTAGATGCAGAGTTA (SEQ ID NO6); qrpL8-F: AAGCGAGGAACATCAGCC (SEQ ID NO7); qrpL8-R: GGTCTTGCCACCACGAAT (SEQ ID NO8).

[0037] The results of real-time fluorescence quantitative analysis showed that after feeding interference, the relative expression level of MSL2 gene in Asian corn borer was significantly downregulated by 48.3% compared with the control group (fed with dsGFP) (P<0.05), indicating that RNAi interference was successful (see Figure 1 ). See Figure 2 Compared with the control group, the mortality rate of the treated group increased significantly by 7.5%, indicating that knockdown of MSL2 can lead to the death of Asian corn borer.

[0038] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. An Asian corn borer MSL2 gene, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

1.

2. The RNA interference sequence fragment of the Asian corn borer MSL2 gene according to claim 1, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

2.

3. A dsRNA synthesized from the RNA interference sequence fragment of the Asian corn borer MSL2 gene according to claim 2.

4. Use of the dsRNA according to claim 3 in controlling Asian corn borer, to perform RNA interference on the Asian corn borer, thereby causing its death.

Images