Gene MlDHN1 for regulating saline-alkaline tolerance of miscanthus sinensis and application of gene MlDHN1

Abstract

The invention discloses a gene MsDHN1 for regulating and controlling the salt tolerance of miscanthus sinensis. The nucleotide sequence of the gene MsDHN1 is as shown in SEQ ID No. 1. The amino acid sequence of the protein product expressed by the MlDHN1 is as shown in SEQ ID No.2. The expression quantity of the DNH gene of the plant is knocked down through VIGS, under saline-alkali treatment, the plant shows a certain degree of wilting, the survival rate is reduced, and the fresh weight and chlorophyll are reduced at present, which indicates that the gene plays a positive regulation role in plant salt stress response, and the gene has important application value in the field of energy plant miscanthus sinensis salt tolerance breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a gene DHN1 regulating Miscanthus salt tolerance and an application thereof. Background Art

[0002] Soil salinization is a major challenge facing global agriculture, affecting crop yields and sustainable agricultural development. According to FAO data, the global area of ​​saline-alkali land exceeds 833 million hectares. China, as one of the countries with the most widespread distribution of saline-alkali land, has about 99.13 million hectares of saline-alkali land. Its complex diversity and wide distribution require innovative solutions. Saline-alkali land seriously inhibits crop growth and leads to low yields due to high salinity, pH imbalance and poor soil structure. Saline-alkali soils are divided into saline soils, alkaline soils and saline-alkali soils, each containing different types of salt, which have multiple negative effects on plants, including water absorption disorders, ion imbalance, nutrient deficiency and cell membrane damage. Salt-alkali stress runs through the entire life cycle of plants from the seed stage, not only interfering with photosynthesis and respiration, but also affecting the physiological, biochemical and morphological structure of plants by changing gene expression and protein synthesis, ultimately restricting their growth and development and yield.

[0003] Miscanthus, as a plant of the genus Miscanthus in the Poaceae family, has shown great potential in saline-alkali land management and ecological restoration due to its strong drought resistance, salt-alkali resistance, and barrenness resistance. However, salt-alkali stress is an important environmental factor affecting the biomass of Miscanthus and other crops. The identification and utilization of genes related to salt-alkali tolerance are of great significance for improving the salt tolerance of crops. At present, research on the salt tolerance of Miscanthus mainly focuses on the physiological level, and there is a lack of in-depth research on its genetic level. Therefore, in-depth research on genes related to salt tolerance in Miscanthus and exploring its application in genetic engineering breeding are of great scientific and practical significance. Summary of the invention

[0004] Purpose of the invention: In view of the shortcomings of the prior art, the purpose of the present invention is to provide a Miscanthus gene MlDHN1 , which is a key gene regulating Miscanthus salt tolerance. The present invention discovered the Miscanthus DNH1 gene whose expression was significantly upregulated under salt-alkali stress by transcriptome sequencing after salt stress, alkali stress, and salt-alkali mixed stress. DN H1 . By using the VIGS technology, the MlDNH1 gene in Miscanthus sinensis was knocked down, and the gene-knocked-down plants were subjected to salt stress treatment, and the salt tolerance, alkali tolerance, and salt-alkali tolerance phenotypes of the plants were further observed to determine its function in salt-alkali stress. Another object of the present invention is to provide a key gene for regulating salt-alkali tolerance of Miscanthus sinensis. DN H1 application.

[0005] Technical solution: In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention is as follows: The invention provides a Miscanthus salt-alkali tolerance gene MlDHN1 , the Miscanthus salt-alkali tolerance gene MlDHN1 The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0006] The present invention also provides a Miscanthus salt-alkali tolerance gene MlDHN1 The acquisition method comprises the following steps: RNA was extracted from young leaves of Miscanthus sinensis and reverse transcribed into cDNA. The cDNA was used as a template and PCR amplification was performed using primers MlDNH1-VIGS-F and MlDNH1-VIGS-R to construct DN H1 The virus-mediated gene silencing (VIGS) vector was used to infect Miscanthus sinensis and to analyze and identify the salt-alkali tolerance of the infected Miscanthus sinensis.

[0007] Furthermore, the sequences of the primers M1DNH1-VIGS-F and M1DNH1-VIGS-R are: MlDNH1-VIGS-F: agaaggcctccatggggatccGCCGCTGCTGAGGAGCAC MlDNH1-VIGS-R: cgtgagctcggtaccggatccGTGGTGGCCAGGAAGCTTC (lowercase letters indicate that the sequence is the vector homology arm) Furthermore, the PCR amplification system is ddH2O, containing Mg 2+ buffer, dNTPs, MlDNH1-VIGS-F, MlDNH1-VIGS-R, high-fidelity PCR enzyme and Miscanthus cDNA template.

[0008] Furthermore, the reaction conditions of the PCR amplification reaction are: pre-denaturation at 95°C for 30s; denaturation at 95°C for 10s, annealing at 55°C for 10s, and 72°C for 30s, for 36 cycles; and post-extension at 72°C for 5min.

[0009] Furthermore, the expression level of the Miscanthus salt-tolerance gene M1DNH1 is reduced in the Miscanthus with gene silencing.

[0010] Furthermore, the Miscanthus salt-tolerance gene can be used to reduce the salt tolerance of Miscanthus.

[0011] Beneficial effect: Compared with the prior art, the advantages of this application are: This application discloses a gene for regulating salt and alkali tolerance of Miscanthus sinensis MlDHN1 ,Will MlDHN1 After gene knockdown, the salt tolerance, alkali tolerance and salt-alkali tolerance of Miscanthus sinensis were significantly reduced, indicating that MlDHN1Genes are key regulatory factors in regulating plant salt-alkali tolerance. This invention provides a gene for regulating Miscanthus salt tolerance and its application, which can be used for the breeding of soil salinity indicator plants, and provides a theoretical research basis and gene sequence for the molecular mechanism of gene expression regulation of Miscanthus salt-alkali tolerance, which has important application value in the field of salt-alkali tolerance breeding of energy plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 WT (wild type), pTRV:00 (empty vector control plant) and pTRV: MlDHN1 ( MlDHN1 Phenotypes of gene knockdown plants) seedlings before and after NaCl treatment.

[0013] Figure 2 WT, pTRV:00, and pTRV: MlDHN1 Expression level of MlDHN1 gene in plants.

[0014] Figure 3 WT, pTRV:00, and pTRV: MlDHN1 Comparison of survival rate (A), fresh weight (B) and chlorophyll content (C) of plants before and after salt stress treatment.

[0015] Figure 4 WT, pTRV:00, and pTRV: MlDHN1 DAB staining results of plant leaves before and after salt stress treatment.

[0016] Figure 5 WT, pTRV:00, and pTRV: MlDHN1 NBT staining results of plant leaves before and after salt stress treatment.

[0017] Figure 6 WT, pTRV:00, and pTRV: MlDHN1 Phenotypes of plants before and after alkaline stress and saline-alkali stress treatment, and comparison of their survival rate, fresh weight, chlorophyll content and MDA content. DETAILED DESCRIPTION

[0018] The present invention is further described below in conjunction with specific examples. Molecular biology experimental methods not specifically described in the following examples can be performed with reference to the methods listed in the book Molecular Cloning Laboratory Manual (3rd Edition) by J. Sambrook or conventional methods in the art, or according to the kits and product instructions.

[0019] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0020] Example 1: Cloning of Miscanthus sinensis M1DHN1 gene 1. Extraction of Total RNA from Miscanthus sinensis Young leaf tissues of Miscanthus sinensis were collected and ground in liquid nitrogen, and RNA was extracted from Miscanthus sinensis using the Trizol method.

[0021] 2. MlDHN1 Cloning of genes. MlDHN1 Gene-specific fragment amplification: Use specific primers primerF:ATGGAGTACGGTCAGCAGGGA, primerR:TTAGTGCTGTCCGGGCAGC to amplify MlDHN1 ( Misin17G118100 ) gene-specific fragment.

[0022] 3. Construction of pTRV: MlDHN1 :Use ClonExpress Ultra One Step kit (Vazyme) for homologous recombination reaction to construct pTRV: MlDHN1.

[0023] The primers used were: MlDNH1-VIGS-F: agaaggcctccatggggatccGCCGCTGCTGAGGAGCAC MlDNH1-VIGS-R: cgtgagctcggtaccggatccGTGGTGGCCAGGAAGCTTC (lowercase letters indicate that the sequence is the vector homology arm) Example 2: VIGS infection For in-depth research MlDHN1 The specific function of the gene in salt stress response was investigated by using VIGS technology to infect Miscanthus seeds and obtain specific inhibition MlDHN1 TRV-mediated gene expression in plants MlDHN1 Gene silencing was performed according to the Miscanthus VIGS infection method, referring to (An efficient virus-induced gene silencing (VIGS) system for gene functional studies in Miscanthus, Volume 15, Issue 6 June 2023). Compared with the wild-type (WT) and empty vector control plants (pTRV:00), pTRV: MlDHN1 In plant MlDHN1The expression level of MlDHN1 Effective gene silencing (attached Figure 2 ).

[0024] Example 3: Chlorophyll content determination The chlorophyll content was calculated according to the method of Lichtenthaler and Wellburn (Lichtenthaler and Wellburn, 1983).

[0025] (1) Material preparation Collect about 20 to 50 mg of fresh leaf material, transfer it into a 2 mL centrifuge tube, and record the weight accurately.

[0026] (2) Extraction Add 2 mL of methanol to the centrifuge tube and store it in a refrigerator. Invert the centrifuge tube from time to time to facilitate extraction. If the extraction is incomplete, remove the upper layer of methanol, add 1 mL of methanol, and incubate overnight. Combine the supernatants of the two extractions.

[0027] (3) Determination 300 μL of the combined supernatant was transferred to a 96-well plate. 300 μL of methanol was used as a blank control. Next, the absorbance of the supernatant was precisely measured at specific wavelengths of 653 nm and 666 nm.

[0028] (4) Concentration calculation Chlorophyll a (Chla) concentration calculation: Chla = (15.65 × OD666 - 7.34 × OD653) × dilution ratio Chlorophyll b (Chlb) concentration calculation: Chlb = (27.05 × OD653 - 11.21 × OD666) × dilution ratio The unit of calculation result is μg / mL.

[0029] (5) Results The chlorophyll concentration calculated above was converted to μg / mg (fresh weight) for subsequent analysis.

[0030] Example 4: DAB and NBT staining of leaves Take pTRV respectively: MlDHN1 Leaves of , pTRV:00, and WT plants were stained with DAB (3,3-diaminobenzidine tetrahydrochloride) and NBT (nitro blue tetrazolium) as follows.

[0031] (1) Leaf DAB staining Usually 0.1% DAB solution is used for staining. It should be prepared and used immediately and stored at 4°C away from light. Weigh 0.1g of DAB powder and dissolve it in 100mL phosphate buffer (pH 3.8) to a final concentration of 1 mg / mL. During the preparation process, use ultrasound to assist dissolution.

[0032] Collect the leaves to be stained and place them in a container containing DAB solution, making sure that the leaves are completely immersed in the solution; stain at room temperature and away from light for 2 to 6 hours until the positive parts appear dark brown and the rest of the parts are nearly colorless or the color of the plant itself (adjust the staining time according to the tenderness of the plant and the degree of color development); after completing the staining steps, rinse the leaves with distilled water to remove the DAB dye remaining on the surface; add 95% ethanol and treat at 40℃ for 3 to 16 hours to decolorize the leaves. During this period, fresh 95% ethanol can be replaced several times to ensure that the chlorophyll can be completely removed; after decolorization is completed, gently spread the leaves on filter paper so that the residual liquid on the surface is absorbed by the filter paper; finally, carefully observe the staining of the leaves and take photos to record.

[0033] (2) Leaf NBT staining NBT solution: 0.5 mg / mL NBT solution is usually used, and it also needs to be prepared before use. Specifically, weigh 0.05 g NBT powder and dissolve it in 100 mL phosphate buffer, adjust the pH to 7.8, and store at 4°C away from light.

[0034] During the experiment, the required plant leaves were collected and completely immersed in NBT staining solution. The staining was carried out at room temperature and in the dark. The staining time was adjusted according to the tenderness of the plant and the degree of color development, generally 2 to 6 hours. When the positive part showed dark blue, and other parts showed light blue, nearly colorless or maintained the color of the plant itself, the leaves were gently removed with tweezers and immersed in distilled water. The leaves were gently rinsed back and forth 3 to 5 times to remove the staining solution on the surface. Then, the leaves were placed on filter paper, excess water was absorbed, immersed in 95% ethanol, and treated at 40°C for 3 to 16 hours to ensure effective removal of chlorophyll. Fresh 95% ethanol could be replaced several times during the period. After dehydration, the leaves were immersed in distilled water and rinsed 3 to 5 times again. After being placed on filter paper to absorb excess water, they were carefully observed and photographed for record.

[0035] Example 5: Salt stress, alkali stress, and salt-alkali mixed stress treatment

[0036] The wild-type (WT) and empty vector control (pTRV:00) plants were cloned with pTRV: MlDHN1 ( MlDHN1Gene knockdown plants) were treated in 1 / 2 Hoagland's hydroponic solution, including salt treatment: 100mM NaCl, pH5.8, alkali treatment: 100mMNaHCO3, pH7.5, and salt-alkali mixed treatment: 100mM NaCl+100mM NaHCO3, pH5.8, with 20 plants in each group. The survival rate, fresh weight and chlorophyll content were measured seven days after treatment. The activities of malondialdehyde (MDA), superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were measured according to the kit instructions.

[0037] Under normal growth conditions, pTRV: MlDHN1 There was no significant difference in growth phenotype between the strains and the pTRV:00 control plants (see Appendix Figure 1 A). After salt stress treatment, both the wild type (WT) and empty vector control (pTRV:00) plants showed a certain degree of wilting (see Figure 2). Figure 1 B), the final survival rates were 76.6% and 83.3%, respectively. In contrast, pTRV: MlDHN1 The sensitivity of transgenic plants to salt stress was significantly enhanced, and their wilting phenotype was more prominent than that of WT and pTRV:00 controls, with a final survival rate of only 64.3% ( Figure 3 A). Accordingly, after salt stress treatment, pTRV: MlDHN1 The fresh weight and chlorophyll content of the strains were significantly reduced compared with the WT and pTRV:00 control plants (see Appendix Figure 3 B, C). These results illustrate MlDHN1 It plays a positive regulatory role in the salt stress tolerance of Miscanthus. In addition, DAB and NBT staining experiments found that under normal growth conditions, WT, pTRV:00 and pTRV: MlDHN1 The difference in leaf color was not obvious. However, when subjected to salt stress, it was clear that pTRV: MlDHN1 The lines showed more intense and darker coloration, indicating higher ROS accumulation compared to WT and pTRV:00 control plants (see Figure 5). Figure 4 , Attachment Figure 5 ).

[0038] When subjected to alkaline or mixed saline-alkali stress, pTRV:00 and WT plants showed significant differences in the abundance of pTRV: MlDHN1 Plants showed a more pronounced leaf wilting phenotype. pTRV: MlDHN1 The survival rate, fresh weight and chlorophyll content of the plants were significantly lower than those of WT and pTRV:00 plants. MlDHN1 The MDA content of the plants was significantly higher than that of WT and pTRV:00 plants (see Figure 6 Overall, this evidence suggests that MlDHN1 It may play a positive role in enhancing the tolerance of Miscanthus annuus to salt and alkali stress. Its reduced expression reduces the plant's salt tolerance, alkali tolerance and salt-alkali tolerance, and its overexpression may improve the plant's salt tolerance, alkali tolerance and salt-alkali tolerance.

[0039] Taken together, these evidences suggest that MlDHN1 The positive regulatory role in the salt stress response of Miscanthus plants, and its expression inhibition significantly enhances the sensitivity of plants to salt stress. A gene regulating Miscanthus salt tolerance and its application can be used for the breeding of soil salinity indicator plants, and has important application value in the field of salt-alkaline tolerance breeding of energy plants.

[0040] The above description is only illustrative rather than restrictive of the present invention. Those skilled in the art will understand that many modifications, changes or equivalents may be made without departing from the spirit and scope defined by the appended claims, but all will fall within the scope of protection of the present invention.

Claims

1. A method for regulating Miscanthus salt tolerance gene M1DHN1 and its application, characterized in that: When the expression of the M1DHN1 gene is reduced in Miscanthus sinensis, the salt tolerance of the plant can be reduced.

2. The method of claim 1, wherein the salt tolerance gene M1DHN1 of Miscanthus sinensis is used for regulating the salt tolerance of Miscanthus sinensis and its application, characterized in that The nucleotide sequence of the M1DHN1 gene is shown in the sequence table SEQ ID NO.

1.

3. The method of claim 1, wherein the salt tolerance regulating gene M1DHN1 of Miscanthus sinensis and its application are characterized in that The amino acid sequence encoded by the M1DHN1 gene is shown in the sequence listing SEQ ID NO.

2.

4. The method according to claim 1, wherein the gene M1DHN1 for regulating Miscanthus salt tolerance and its application are characterized in that The MlDHN1 gene is characterized in that: the method for constructing the vector for knocking down the MlDHN1 gene is to use the cDNA of young leaves of Miscanthus sinensis as a template, use primers MlDHN1-VIGS-F and MlDHN1-VIGS-R to perform PCR amplification to obtain the target fragment, and construct it into the viral vector TRV2, infect Miscanthus sinensis seeds, and obtain Miscanthus sinensis plants with reduced expression of the MlDHN1 gene.

5. The construction of the Miscanthus salt-tolerance gene M1DHN1 silencing vector according to claim 4, characterized in that: The sequences of the primers MlDHN1-VIGS-F and MlDHN1-VIGS-R are as follows (lowercase letters indicate that the sequence is a vector homology arm): MlDNH1-VIGS-F: agaaggcctccatggggatccGCCGCTGCTGAGGAGCAC MlDNH1-VIGS-R: cgtgagctcggtaccggatccGTGGGTGGCCAGGAAGCTTC.

6. A recombinant vector, characterized in that: Containing all or part of the nucleotide sequence described in claim 2.

7. A gene M1DHN1 for regulating Miscanthus salt tolerance and its use according to claim 1, wherein the expression of the M1DHN1 gene in Miscanthus is reduced, and the method used is VIGS technology.

8. A gene M1DHN1 for regulating Miscanthus salt tolerance and its application, characterized in that: When the expression of the M1DHN1 gene is reduced in Miscanthus sinensis, the alkali resistance of the plant can be reduced.

9. A gene M1DHN1 for regulating Miscanthus salt tolerance and its application, characterized in that: When the expression of the M1DHN1 gene is reduced in Miscanthus sinensis, the salt tolerance and alkali tolerance of the plant can be reduced at the same time.

10. The method for regulating Miscanthus salt-alkali tolerance gene M1DHN1 and its application according to claim 1, characterized in that: The application of the Miscanthus salt-tolerance gene M1DHN1 in regulating plant salt-alkaline tolerance breeding.

Images