Gene SlLHP1 for regulating and controlling parthenocarpy of tomato as well as encoding protein and application of gene SlLHP1

Abstract

The invention discloses a gene SlLHP1 for regulating and controlling parthenocarpy of tomatoes as well as an encoded protein and application thereof. The sequence of the gene SlLHP1 is shown as SEQ ID NO. 1. According to the present invention, the new tomato parthenocarpy regulating gene SlLHP1 is identified, and the tomato maturing rate of the tomato parthenocarpy regulating gene SlLHP1 is improved through CRISPR / Cas9 editing so as to indicate that the SlLHP1 gene has the regulation effect in the tomato parthenocarpy process; therefore, the invention provides a new gene resource and method for obtaining the parthenocarpy character of the tomato, and the method has a better application prospect in the aspect of parthenocarpy breeding of the tomato.

Description

Technical Field

[0001] The invention belongs to the field of molecular breeding of horticultural crops, and in particular relates to a regulating tomato parthenocarpy gene SlLHP1 and a coded protein and application thereof. Background Art

[0002] Parthenocarpy refers to the phenomenon that the ovary produces seedless fruits without pollination and fertilization. This trait can not only ensure the fruiting of horticultural plants under adverse conditions such as low temperature and weak light, and reduce the labor cost caused by the exogenous application of growth regulators, but also parthenocarpy fruits are favored by consumers and processors due to their high soluble solids content, large fruit volume and seedless advantages. Tomato (Solanum lycopersicum L.) is one of the important vegetables widely cultivated. At present, tomato production mostly adopts facility cultivation, but the weak light, high and low temperature environment in the facility often affects the development of tomato flower organs and pollination and fertilization, thereby reducing tomato yield. Therefore, tomato breeding with parthenocarpy as the goal is particularly important. However, in the natural germplasm resources of tomatoes, only a small number of parthenocarpy genes have been successfully located, and these genes often lead to abnormal growth and development of leaves, stems and fruits, which greatly limits the application of traditional breeding methods in tomato parthenocarpy breeding. Therefore, tomato breeding materials with parthenocarpy traits and other organ morphology not affected are urgently needed to be created.

[0003] Genome editing technologies represented by CRISPR / Cas9 technology can achieve precise modification of target sequences, thereby improving related traits and accelerating the breeding process. The selection of targets is related to the efficiency of gene editing and is one of the key factors for the successful implementation of CRISPR / Cas9 technology. Summary of the invention

[0004] Purpose of the invention: In order to solve the above technical problems, the present invention aims to provide a method for regulating tomato parthenocarpy gene SlLHP1. The present invention identifies a new tomato parthenocarpy gene SlLHP1. Knocking out the gene using CRISPR / Cas9 gene editing technology will increase the tomato fruit setting rate. Therefore, it has good application prospects in breeding tomato parthenocarpy varieties.

[0005] The present invention also provides a coding protein for regulating the tomato parthenocarpy gene SlLHP1 and its application.

[0006] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a gene SlLHP1 for regulating tomato parthenocarpy, and the sequence of the gene SlLHP1 is shown in SEQ ID NO.1.

[0007] Furthermore, the primer pair used to amplify the gene S1LHP1 is:

[0008] LHP1-F: ATGAAAGGAGGGAAAACAAGAAT,

[0009] LHP1-R: TCATAGAGACGGATGATGTTGAATATG.

[0010] The amino acid sequence of the protein encoded by the tomato parthenocarpy gene S1LHP1 of the present invention is shown in SEQ ID NO.2.

[0011] The gene knockout vector pToCas9-LHP1 for regulating the tomato parthenocarpy gene SlLHP1 of the present invention.

[0012] Furthermore, the gene knockout vector construction method is to design an sgRNA that recognizes the target site, connect it to the pToCas9 vector after enzyme cutting, and finally obtain the gene knockout vector pToCas9-LHP1 through transformation.

[0013] Furthermore, the sgRNA of the target site includes target 1 and target 2, the target 1 sequence is CCGGCACCGGCACCAGCACCAG, and the target 2 sequence is: TAAGCGTAAGCGCACTCATGGG.

[0014] The invention discloses an application of the gene S1LHP1 or the encoded protein or the knockout vector in regulating tomato parthenocarpy.

[0015] Furthermore, the tomato SlLHP1 gene was edited by CRISPR / Cas9 to increase the fruit set rate of tomatoes.

[0016] The invention discloses an application of the regulating tomato parthenocarpy gene S1LHP1 or the encoding protein or the knockout vector in breeding tomato parthenocarpy varieties.

[0017] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0018] The present invention uses gene editing technology to knock out the SlLHP1 gene. Compared with wild-type non-parthenocarpic tomato varieties, the Sllhp1 mutant bred by gene editing produces seedless fruits. This shows that the SlLHP1 gene has a regulatory role in the parthenocarpic process of tomatoes. Therefore, the present invention provides a new gene resource and method for obtaining the parthenocarpic trait of tomatoes, and the method has a good application prospect in tomato parthenocarpic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is a map of the pToCas9 vector;

[0020] Figure 2Schematic diagram of the mutant DNA sequence obtained for CRISPR / Cas9 knockout of the SlLHP1 gene target sequence;

[0021] Figure 3 This is the parthenocarpic phenotype of the Sllhp1 mutant strain obtained. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0023] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Experimental methods without specific conditions specified in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0024] The tomato variety 'Ailsa Craig' (AC) (Sun et al. A Transscriptional Network Promotes Anthocyanin Biosynthesis in Tomato Flesh. Mol Plant, 2020, 13(1): 42-58.) in the present invention was provided by Yangzhou University.

[0025] The vectors pCE2 TA / Blunt-Zero and pCBC-DT1T2 in the present invention are commercially available or disclosed vectors.

[0026] Example 1

[0027] 1. Construction of SlLHP1 cloning and pToCas9-LHP1 vector:

[0028] The cDNA of tomato variety 'Ailsa Craig' (AC) tissue was used as a template to design primers LHP1-F and LHP1-R, and the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme) was used for cloning.

[0029] The primer sequences were: LHP1-F: ATGAAAGGAGGGAAAAACAAGAAT and LHP1-R: TCATAGAGACGGATGATGTTGAATATG.

[0030] The reaction system is: ddH 2O 18μL, Buffer 25μL, dNTP 1μL, upstream and downstream primers 2μL each, cDNA 1μL, enzyme 1μL. The reaction procedure is: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 30 seconds, a total of 35 cycles; 72℃ thorough extension for 5 minutes. The PCR reaction product was purified using FastPure Gel DNA Extraction Mini Kit (Vazyme), and the product was connected to pCE2 TA / Blunt-Zero (Vazyme). The plasmid was sequenced, and the nucleotide sequence of the SlLHP1 gene is shown in SEQ ID No.1, and the amino acid sequence encoded by the sequence is shown in SEQ ID No.2.

[0031] Two 22 bp target sites were screened on the coding sequence of SlLHP1 and primers were designed. The target 1 sequence was CCGGCACCGGCACCAGCACCAG, and the target 2 sequence was TAAGCGTAAGCGCACTCATGGG. The corresponding primers CR-LHP1-F: ATTATTGGTCTCGAAACGCACCGGCACCAGCACCAGCA AACTACACTGTTAGATTC; CR-LHP1-R: ATATATGGTCTCGTTTGTAAGCGTAAGCG CACTCATGTTTTAGAGCTAGAAATAGC were designed. Plasmid pCBC-DT1T2 (Addgene, Plasmid #50590) was used as a template and 2×Phanta Max Master Mix (Vazyme) was used for PCR cloning. The PCR-recovered and purified fragments were ligated to the pToCas9 vector (pToCas9 vector as shown in Figure 2) through the Gol den Gate system. Figure 1 The specific system of Golden Gate is as follows: T4 DNA ligase buffer 2μL, T4 DNA ligase 1μL (Promega), Bsa I-HF-V2 1μL (NEB), PCR recovery and purification fragment 1μL, pCBC-DT1T2 1μL, ddH 2O 14μL. The ligation product was transformed into E. coli Trans5α competent cells, Kan resistance medium was incubated at 37℃ overnight, and positive clones were screened by PCR. The colony PCR primers were pTo Cas9-F: GCAGGCATGCAAGCTTATTGG and pToCas9-Seq-R: CAGCTGGCGAAAGGGG GAT. Positive clones were sequenced by Sanger sequencing, and the sequencing primer was pToCas9-Seq-R. After sequencing was correct, plasmids were extracted using a plasmid extraction kit (Takara) and named pToCas9-LHP1. Glycerol was added to the corresponding E. coli strain and then quickly frozen with liquid nitrogen and stored at -80℃.

[0032] 2. Construction and testing of genome editing materials:

[0033] The obtained plasmid pToCas9-LHP1 was transferred into the Agrobacterium strain LBA4404 (Weidi Biotechnology), and the positive clones were screened by PCR. The colony PCR primers were pToCas9-F and pToCas9-Seq-R. The positive colonies were used to infect the cotyledons of the tomato variety 'A ilsaCraig' (AC). Before infection, the cotyledons need to be pre-cultured. The pre-culture process is as follows: select the tomato cotyledons one week after sowing, leaving only the middle section, soak them in the pre-culture solution (MS liquid medium + 0.2mg / L 2,4-D + 0.1mg / L Kinetin) for 1 hour, dry them with filter paper, and place them on the pre-culture medium (MS solid medium + 1mg / L IAA + 1.75mg / L zeatin). One day later, soak the pre-cultured cotyledons in the Agrobacterium bacterial solution for infection for 15 minutes (the OD value of the bacterial solution is 2.0), dry the excess bacterial solution with filter paper, and culture them for 2 days. After 2 days, the cotyledons were transferred to a resistance medium (MS solid medium + 1.0 mg / L IAA + 1.75 mg / L zeatin + 75 mg / L kanamycin + 200 mg / L timentin). After callus formation at the incision, it was transferred to a budding medium (MS solid medium + 1.0 mg / L zeatin + 50 mg / L kanamycin + 200 mg / L timentin). After the buds grew out, they were cut onto a rooting medium (MS solid medium + 200 mg / L timentin). The Cas9 gene in the obtained regenerated plants was detected by PCR, and the amplification primers were Cas9-F: CCACATGATTAAGTTCAGGGGCCAT and Cas9-R: GAGCCTTCGTAATCTCGGTGTTC. The PCR products were subjected to agarose gel electrophoresis. The positive plants were further tested for editing sites, and the amplification primer sequences were CRLHP1-F: ATGAAAGGAGGGAAAAACAAGAATTCC GATTTG and CRLHP2-R: ATCCACGTGATCCAATGTAGGCAG. After Sanger sequencing, the mutant plants were successfully constructed, and 21 successfully edited plants were finally obtained. The above 21 plants were kept as seeds to obtain T1 generation seeds for sowing and self-pollination. PCR detection was performed again using primers Cas9-F and Cas9-R, and two homozygous T2 generation mutant strains without Cas9 sequences were selected, named CR-lhp1-1 and CR-lhp1-2, respectively. The gene editing site sequences are as follows: Figure 2 As shown, CR-lhp1-1 has a 1 bp deletion in the first target site, while CR-lhp1-2 has a 2 bp deletion in the first target site and a 1 bp deletion in the second target site. Due to the deletion of bases, the reading frame of CR-lhp1-1 and CR-lhp1-2 at the first target site is changed.

[0034] 3. Parthenocarpy phenotype detection:

[0035] Ten plants of CR-lhp1-1, CR-lhp1-2 and control 'AC' were planted in a glass greenhouse. The emasculation was performed one day before flowering, and the parthenocarpy rate was calculated 7 days later. The parthenocarpy rates of CR-lhp1-1 and CR-lhp1-2 were 75.4% and 81.2%, respectively, while that of 'AC' was 0%. Figure 3 As shown, CR-lhp1-1 and CR-lhp1-2 plants can produce seedless fruits after emasculation.

[0036] The present invention uses CRISPR / Cas9 gene editing technology to construct a tomato SlLHP1 mutant and conducts functional research on the SlLHP1 gene. The present invention proves through experiments that tomatoes of tomato SlLHP1 gene editing materials can form seedless fruits, indicating that the SlLHP1 gene plays a negative regulatory role in the parthenocarpy trait of tomatoes. The discovery of the function of the SlLHP1 gene provides a basis for the creation of parthenocarpy tomato germplasm materials and has good application prospects.

Claims

1. A method for regulating the tomato parthenocarpy gene S1LHP1, characterized in that: The sequence of the gene S1LHP1 is shown in SEQ ID NO.

1.

2. The method for regulating tomato parthenocarpy gene S1LHP1 according to claim 1, characterized in that: The primer pair used to amplify the gene S1LHP1 was: LHP1-F: ATGAAAGGAGGGAAAACAAGAAT, LHP1-R: TCATAGAGACGGATGATGTTGAATATG.

3. A protein encoded by the tomato parthenocarpy regulating gene S1LHP1 according to claim 1, characterized in that: The amino acid sequence is shown in SEQ ID NO.

2.

4. A gene knockout vector pToCas9-LHP1 for regulating the tomato parthenocarpy gene S1LHP1 according to claim 1.

5. The gene knockout vector pToCas9-LHP1 according to claim 4, characterized in that The gene knockout vector construction method comprises designing an sgRNA that recognizes the target site, enzymatically connecting it to the pToCas9 vector, and then transforming it to finally obtain the gene knockout vector pToCas9-LHP1.

6. The gene knockout vector pToCas9-LHP1 according to claim 5, characterized in that The sgRNA of the target site includes target 1 and target 2, the target 1 sequence is CCGGCACCGGCACCAGCACCA G, and the target 2 sequence is: TAAGCGTAAGCGCACTCATGGG.

7. Use of the gene S1LHP1 according to claim 1 or the encoded protein according to claim 3 or the knockout vector according to claim 4 in regulating tomato parthenocarpy.

8. The use according to claim 7, characterized in that: Editing the tomato SlLHP 1 gene through CRISPR / Cas9 increased the fruit set rate of tomatoes.

9. Use of the tomato parthenocarpic regulating gene S1LHP1 according to claim 1 or the encoded protein according to claim 3 or the knockout vector according to claim 4 in breeding tomato parthenocarpic varieties.

Images