Gynostemma pentaphylla GpERF gene, recombinant vector, preparation method and application thereof

Abstract

The invention discloses a gynostemma pentaphyllum GpERF gene, a recombinant vector, a preparation method and application of the gynostemma pentaphyllum GpERF gene. The sequence of the gynostemma pentaphyllum GpERF gene is shown as SEQ ID NO. 1. The invention also provides a recombinant vector and a preparation method of the gynostemma pentaphyllum GpERF gene, also discloses a new application of the gynostemma pentaphyllum GpERF gene in regulation and control of plant height, provides important basis and theoretical support for crop character improvement and dwarf cultivation, and has important scientific value and application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. More specifically, the present invention relates to a GpERF Gene, recombinant vector, preparation method and application thereof. Background Art

[0002] Gynostemma pentaphyllum ( Gynostemma pentaphyllum ), belonging to the genus Gynostemma of the Cucurbitaceae family, is a perennial herbaceous vine plant with a wide natural distribution, especially in the south of the Qinling Mountains and the Yangtze River Basin in China. As a food ingredient, Gynostemma is picked in spring and summer, and its tender stems and leaves can be cooked into a variety of delicious dishes, such as stir-frying, making soups, cold salads, making porridge and soaking in wine. At the same time, the whole plant of Gynostemma is also known as the "Southern Ginseng", which has a variety of medicinal effects such as sedation, hypnosis, relieving tension, anti-allergy, black hair, lowering blood pressure and treating migraines. Therefore, Gynostemma is not only a delicacy, but also a precious medicinal material. In addition, Gynostemma has emerald green leaves, membranous or papery, with a unique shape and bird-foot shape, including three leaves, five to seven leaves and nine leaves, and has a high ornamental value. With its excellent ecological adaptability and rapid growth rate, Gynostemma shows a unique beauty in the arrangement of flower beds and flower ponds. However, due to its growth characteristics, it is not suitable as a potted plant. Therefore, discovering the dwarfing genes of Gynostemma pentaphyllum is of great significance for cultivating ornamental potted Gynostemma pentaphyllum plants.

[0003] The AP2 / ERF transcription factor family, as a family unique to the plant kingdom, has members that play a pivotal role in the signal transduction process mediated by plant hormones, including the signal transmission of hormones such as gibberellins, jasmonic acid and salicylic acid. At the same time, they also actively respond to adverse stress and participate in regulating the growth and development of plant meristems. Although many biological functions of AP2 / ERF transcription factors have been clarified, there have been no reports on the use of ERF genes to regulate plant dwarfing. This status quo provides a broad space for exploration and potential invention value for the present invention. Summary of the invention

[0004] An object of the present invention is to solve at least the above problems and to provide at least the advantages which will be described hereinafter.

[0005] Another object of the present invention is to provide a kind of Gynostemma pentaphyllum GpERF Genes also revealed that Jiaogulan GpERF The new function of genes in regulating plant height provides important basis and theoretical support for crop trait improvement and dwarfing breeding, and has important scientific value and application prospects.

[0006] In order to achieve these purposes and other advantages according to the present invention, there is provided a GpERF Gene, the JiaogulanGpERF The gene sequence is shown in SEQ ID NO.1.

[0007] The present invention provides a recombinant vector comprising the above-mentioned Gynostemma pentaphyllum GpERF Recombinant gene vector.

[0008] The present invention provides a method for preparing a recombinant vector, which comprises the following steps: 1) Double digest the pCY-35D-GFP plasmid with SacI and SalI to obtain the pCY-35D-GFP linearized vector; 2) Put the above-mentioned Gynostemma pentaphyllum GpERF The full-length cDNA sequence fragment of the gene was subjected to homologous recombination reaction with the pCY-35D-GFP linearized vector, and the reaction product was transformed into the competent Escherichia coli DH5α cells. The positive clone cells were screened on LB medium containing kanamycin. After sequencing verification, the plasmid was extracted to obtain pCY-35D-GFP- GpERF Recombinant vector.

[0009] Preferably, the reaction system of step 1) is 2.5 uL of SacI enzyme, 2.5 μL of SalI enzyme, 30 μL of pCY-35D-GFP plasmid, 5 μL of 1.5*T+BSA Universal Buffer, and 10 μL of ddH2O; and the enzyme digestion reaction conditions are 37°C for 12 hours.

[0010] Preferably, in step 2), the reaction system of the homologous recombination reaction is: 4 μL of pCY-35D-GFP linearized vector, GpERF cDNA fragment 3 μL, 5 × CE II Buffer 2 μL, Exnase II 1 μL; reaction conditions: 37 ℃ reaction for 30 minutes.

[0011] The present invention provides a method for cloning Gynostemma pentaphyllum GpERF The primers for the gene, the upstream primer is shown in SEQ ID NO.2, and the downstream primer is shown in SEQ ID NO.3.

[0012] The invention provides a method of using Gynostemma pentaphyllum GpERF Genes are used to regulate the application of plant strains.

[0013] The invention provides a method of using Gynostemma pentaphyllum GpERF Application of genes in breeding dwarf plants.

[0014] The invention provides a method of using Gynostemma pentaphyllum GpERF The application of genes in regulating gibberellins in plants.

[0015] The invention provides a method of using Gynostemma pentaphyllum GpERF The application of genes in inhibiting plant growth.

[0016] The invention provides a method of using Gynostemma pentaphyllum GpERF Gene application, Gynostemma pentaphyllum GpERF Gene transformation to obtain transgenic plants, wherein the Gynostemma pentaphyllum in the transgenic plants GpERF The gene can regulate the synthesis and metabolic gene expression of the plant hormone gibberellin, thereby affecting the growth and development of the plant and causing changes in plant height.

[0017] The invention provides a method for cultivating dwarf plants, which comprises the following steps: transforming the above gene or recombinant vector into Agrobacterium to obtain dwarf plants.

[0018] The present invention has at least the following beneficial effects: First, the present invention reveals that Gynostemma pentaphyllum GpERF The effect of the gene on the plant height of Arabidopsis thaliana (Arabidopsis thaliana, as a model organism, is highly representative in botanical inventions, and the invention results for Arabidopsis thaliana can be extended to the entire angiosperm category) proved that the gene regulates the synthesis and metabolic pathways of gibberellins (GA), especially reducing the content of biologically active GA1, GA3 and GA4, while increasing the content of inactive GA8 and GA 34 The content of 2,4-dihydropyridine in the plant is increased, thereby inhibiting the growth and development of the plant, resulting in dwarfing of the plant. This discovery provides a new perspective for understanding the mechanism of plant dwarfing.

[0019] Second, the invention results of the present invention provide strong theoretical support for the involvement of AP2 / ERF transcription factor family in regulating plant height. GpERF The invention enriches our understanding of the role of this transcription factor family in the regulation of plant growth and development by studying the influence of genes on the expression of GA synthesis and metabolism genes.

[0020] Third, the discovery of the present invention provides a possibility for improving the plant height and phenotypic traits of Gynostemma pentaphyllum and other crops. GpERF The expression of the gene can breed Gynostemma pentaphyllum varieties with a dwarf phenotype, which not only helps to improve the crop's resistance to lodging, but also may improve its ornamental value and economic value.

[0021] Fourth, the present invention provides a direct basis for cultivating dwarf varieties of Gynostemma pentaphyllum. Dwarf varieties have significant advantages in horticultural appreciation, potted plants and high-density planting, so the application prospects of the present invention are broad.

[0022] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through the invention and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 pCY-35D-GFP- GpERF Schematic diagram of the recombinant plasmid; Figure 2 The figure is a comparison of the phenotypes of wild-type and overexpressing Arabidopsis plants; Figure 3 This is a bar graph comparing the growth changes of wild-type and overexpressing Arabidopsis plants; Figure 4 It is a bar graph comparing the changes of endogenous GAs in wild-type and overexpressing Arabidopsis plants; Figure 5 The figure is a bar graph showing the expression comparison of genes related to gibberellin synthesis and metabolism in wild-type and overexpressing Arabidopsis plants. DETAILED DESCRIPTION

[0024] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0025] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0026] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0027] <Example> 1. Gynostemma pentaphyllum GpERF Gene cloning Take 0.2g of Gynostemma pentaphyllum leaves, freeze them in liquid nitrogen and grind them into powder. Use Eastep®Super Total RNA Extraction Kit from Promega Biotech to extract total RNA from Gynostemma pentaphyllum plants, and use HiScript II1st Strand cDNA Synthesis Kit (+gDNA wiper) from Novazonics to reverse transcribe total RNA into cDNA. The steps are as follows: 4×gDNA wiper Mix 4μL, 1000μg of Gynostemma pentaphyllum plant RNA, add RNase-free ddH2O to make the total system 16μL, set the PCR instrument to 42°C, react for 2min, add 5×HiScript III qRT SuperMix 4μL, set the PCR instrument to 37°C, 15min, 85°C, 5s for a two-step reverse transcription reaction program. According to the Gynostemma pentaphyllum plant RNA, 4μL of 5×HiScript III qRT SuperMix was added to the PCR instrument. GpERF The full-length cDNA sequence of Gynostemma pentaphyllum was used to design and synthesize the upstream and downstream primers using Primer6 (upstream primer SEQ ID NO.2: ATGGCGATGAGAGAAAAGACTAAAG; downstream primer SEQ ID NO.3: CTAAGCTGTCTCCAACGGAGGA), and the high-fidelity enzyme 2 × Phanta MaxMaster Mix from Novozymes was used to amplify Gynostemma pentaphyllum cDNA as a template. The PCR reaction system was: 25 μL high-fidelity enzyme, 2 μL upstream primer, 2 μL downstream primer, 2 μL cDNA, 19 μL ddH2O; the PCR reaction conditions were: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 1 min, 72°C final extension for 5 min, 35 cycles. The PCR product was tested by 1% agarose gel electrophoresis, and the PCR product was recovered by gel using the DNA purification and recovery reagent of Tiangen Biochemical Technology Co., Ltd. Gynostemma pentaphyllum GpERF The gene sequence SEQ ID NO.1 is as follows: ATGGCGATGAGAGAAAAGACTAAAGATCGGGTTGTGACTAACGATAACAACAACGGGGTAGAGAGGCATTATAGAGGTGTGCGTAAGAGGCCATGGGGAAGATACGCGGCTGAGATAAGAGATCCAGCT AAAAAAACACGCGTTTGGTTAGGTACATTCGACACGGCCGAAGATGCAGCTCGGGCTTACGACAAAGCCGCAAGAGAATTCCGTGGCGCTAAGGCTAAAACCAACTTTCCTTTTTCTTGGTTGCCAAGATCTCA AGATTGATCTTAACCAAAAAAGTAACGACCTGATCAAACATAGTCCCAGCCAAAGTAGTACCGTTGAATCATCAACTCCTCTTGATCTCAATATTTCTCAGTTCGATTCGGTTCGGTTTTTATACTACGATCC GGTTTTACGATCAGGAACGTTGAGTGATTCAGATTCGTCATCGGTTATAGATTTGAATCAAGATGAGTTGAAATCAGGAGGAAGAGTATTGGATATTGATCTCAATTACCCTCCTCCGTTGGAGACAGCTTAG two, GpERF Gene recombination vector plasmid construction Construction of dicotyledonous plant overexpression vector pCY-35D-GFP GpERF Gene overexpression vector. The steps are as follows: (1) Use the plasmid extraction kit of Tiangen Biochemical Technology Co., Ltd. to extract the pCY-35D-GFP plasmid, and perform double restriction digestion with SacI and SalI. The reaction conditions are: 2.5 μL each of SacI and SalI, 30 μL of pCY-35D-GFP plasmid, 5 μL of 1.5*T+BSA UniversalBuffer, 10 μL of ddH2O; react at 37℃ for 12 hours to linearize the vector; (2) Use the ClonExpress Ⅱ OneStep Cloning Kit of Novozymes to linearize the vector. GpERF The cDNA full-length sequence fragment was homologously recombined with the pCY-35D-GFP linearized vector. The reaction system was: 4 μL of the linearized pCY-35D-GFP vector, GpERFcDNA fragment 3μL, 5 × CE II Buffer 2μL, Exnase II 1μL; reaction conditions: 37℃, 30min; (3) The reaction product was transformed into DH5α cells, and positive clones were screened on LB medium containing 50mg / L kanamycin; (4) After sequencing verification, the plasmid was extracted using the plasmid extraction kit of Tiangen Biochemical Technology Co., Ltd. to obtain pCY-35D-GFP- GpERF Recombinant vector plasmid, vector plasmid construction schematic diagram is attached Figure 1 shown.

[0028] three, GpERF Gene overexpression strain verification The correctly sequenced pCY-35D-GFP- GpERF The recombinant vector plasmid was transformed into Agrobacterium GV3101 by the heat shock method, and the steps were as follows: 1 μg of recombinant vector plasmid DNA was added to 100 μL of GV3101 competent cells, mixed, ice bathed for 30 min, placed on ice for 10 min; 42°C water bath for 1 min, placed on ice for 2 min, added 900 μL of YEB liquid culture medium, 220 rpm / min, 28°C, cultured for 3 hours, then spread on YEB solid culture medium containing 50 mg / L kanamycin, cultured at 28°C for 2 days, and screened positive cloned Agrobacterium cells. The inflorescence infection method was used to infect the Arabidopsis inflorescence to obtain T0 generation plants. The steps are as follows: Agrobacterium containing the recombinant vector plasmid was activated, and YEP liquid medium was used for overnight culture, and cultured at 28°C and 220r / min until the OD value was 0.8-1.0 at an absorbance of 600; the bacteria were collected by centrifugation at 6000r / min for 10min; the bacteria were resuspended in 100ml of infiltration solution (MS, 30% sucrose, 3mg / L6-BA, 2% Siwet-77) to prepare Agrobacterium infection solution; robust Arabidopsis plants were selected, the inflorescence was immersed in the Agrobacterium infection solution, and the infection was carried out once every 10 days for 3 times; when the seeds matured, the seeds were collected, sieved, other impurities were removed, and dried to obtain T0 generation plants. The seeds of T0, T1 and T2 generation plants were used to carry out 50mg / L kanamycin resistance culture to screen the homozygous plants of T3 generation, and finally the T3 generation homozygous plants were obtained. The DNA of leaves of T3 plants was extracted by CTAB method and verified by PCR amplification. Total RNA of leaves of T3 plants was extracted by RNA extraction kit of Takara Company, reverse transcribed into cDNA, and verified by qRT-PCR using fluorescent quantitative primers (upstream primer SEQ ID NO.4: GAATCATCAACTCCTCTT; downstream primer SEQ ID NO.5: CAATATCCAATACTCTTCCT). Three strains with positive identification results and high gene expression were selected and named OE-1, OE-2, and OE-3.

[0029] Four, GpERF Overexpression strain analysis 1. Phenotypic Observation To verify the GpERF Gene function, phenotypic observation of wild-type and transgenic Arabidopsis plants. Seedlings were sown on 1 / 2MS solid medium, and when the seedlings grew true leaves, they were transplanted into peat soil. The culture conditions were 21°C, 70% humidity, and long-day conditions. After 3 months of culture, the plant height, number of branches, number of rosette leaves, leaf length and leaf width were observed and counted. Each treatment was repeated 3 times, and 10 plants were used as 1 replicate.

[0030] 2. Hormone content determination To verify the GpERF Gene function, bioactive endogenous GA1, GA3 and GA4 and bioactive GA8 and GA in wild-type and transgenic Arabidopsis plants 34 Hormone content was determined. Weigh 50 mg of wild-type and transgenic Arabidopsis leaf samples, put them into a 2.0 ml centrifuge tube containing grinding beads, freeze them quickly in liquid nitrogen, and grind them into powder using a tissue grinder (Shanghai Jingxin, JXFSTPRP-64L). Hormone extraction was performed using 2 ml methanol: water: formic acid = 15:4:1 volume ratio, and the extraction was performed under shaking for 12 h at 4 °C. The extraction was repeated 3 times and the extracts were combined; the extracts were concentrated using a vacuum concentrator, and the concentrated extracts were re-dissolved with 30 μL methanol, filtered through a 0.22 μm PTFE filter, and placed in an injection bottle for LC-MS / MS analysis. The liquid phase conditions were as follows: Waters ACQUITY UPLC HSS T3 C18 column; the mobile phase was ultrapure water containing 0.05% formic acid, and the organic phase was acetonitrile containing 0.05% formic acid; the elution gradient was 0 min water / acetonitrile (95:5 V / V), 1 min water / acetonitrile (95:5 V / V), 8.0 min water / acetonitrile (5:95 V / V), 9.0 min water / acetonitrile (5:95 V / V), 9.1 min water / acetonitrile (95:5 V / V), 12.0 min water / acetonitrile (95:5 V / V); the flow rate was 0.35 mL / min; the column temperature was 40 °C, and the injection volume was 2 μL. The mass spectrometry conditions mainly included: the electrospray ion source temperature was 500 °C, the mass spectrometry voltage was 4500V, the curtain gas was 35 psi, and the collision-induced ionization parameter was set to medium for scanning detection.

[0031] 3. Detection of gene expression in GA synthesis pathway To verify the GpERFGene function, the expression of GA synthesis pathway genes in wild-type and transgenic Arabidopsis plants was measured. 0.2 g of Arabidopsis leaves were taken, quick-frozen in liquid nitrogen and ground into powder. The total RNA of Gynostemma pentaphyllum plants was extracted using Eastep® Super Total RNA Extraction Kit from Promega Biotech, and the total RNA was reverse transcribed into cDNA using HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) from Novazonics. Specific primers were used to target genes in the GA synthesis pathway. AtKS (Ent-kaurene synthase), AtKO (Ent-kaureneoxidase), AtKAO (Ent-kaurenoic acid oxidase), AtGA20ox (GA20-oxidase), AtGA2ox (GA3-oxidase) and AtGA3ox The expression of GA2-oxidase was detected, and the specific primers are shown in Table 1. The housekeeping gene Actin was used as the internal reference gene (upstream primer SEQ ID NO.6: gcaccctgttcttcttaccga; downstream primer SEQ ID NO.7: agtaaggtcacgtccagcaagg), and the relative expression of the gene was calculated by the 2-△△CT method.

[0032] Table 1 Specific primers <Effect Verification> The experimental results showed that compared with wild-type Arabidopsis, the overexpressed Arabidopsis showed dwarfing ( Figure 2 As shown, the left one is the growth of wild-type Arabidopsis WT, and the right three are the growth of overexpressed Arabidopsis OE-1, OE-2, and OE-3). The plant height was significantly reduced by 44.44% to 69.44%, and the number of rosette leaves, leaf length, and leaf width were significantly less than those of wild-type Arabidopsis ( Figure 3 ), characterized by a small number of leaves and short leaves. The present invention is effective in inhibiting the endogenous GA1, GA3 and GA4 with biological activity and the GA8 and GA4 without biological activity in wild-type and overexpressed Arabidopsis plants. 34 Hormone content was measured. Figure 4 As shown in the figure, the contents of GA1, GA3 and GA4 in the overexpressed Arabidopsis were lower than those in the wild type, while the contents of GA8 and GA 34 The contents of GAs in the overexpression plants were higher than those in the wild type, indicating that the dwarf phenotype of the overexpression plants was closely related to the endogenous GAs content. Figure 5 As shown, overexpression GpERFCan reduce GA synthesis genes AtKS , AtKO , AtKAO , AtGA20ox and AtGA3ox , increasing GA inactivation gene AtGA2ox The results of transgenic Arabidopsis phenotype observation, endogenous GAs content, and GA metabolic gene expression analysis showed that Gynostemma pentaphyllum GpERF It is involved in regulating the expression of GA synthesis and metabolism genes, affecting the content of endogenous GAs and inhibiting the growth and development of plants. GpERF The gene is a gene that affects plant height. It mainly affects the content of endogenous GAs by regulating the expression of GA synthesis and metabolism genes, resulting in plant dwarfing. This provides theoretical support for the invention of enriching AP2 / ERF transcription factors involved in GA regulation of plant height, and provides a basis for improving the plant height and phenotypic traits of Gynostemma pentaphyllum and cultivating dwarf varieties of Gynostemma pentaphyllum.

[0033] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. Gynostemma pentaphyllum GpERF A gene characterized by Its gene sequence is shown in SEQ ID NO.

1.

2. A recombinant vector, characterized in that: Containing the Gynostemma pentaphyllum according to claim 1 GpERF Recombinant gene vector.

3. A method for preparing the recombinant vector according to claim 2, characterized in that: The following steps are involved: 1) Double digest the pCY-35D-GFP plasmid with SacI and SalI to obtain the pCY-35D-GFP linearized vector; 2) The Gynostemma pentaphyllum as claimed in claim 1 GpERF The full-length cDNA sequence fragment of the gene was subjected to homologous recombination reaction with the pCY-35D-GFP linearized vector, and the reaction product was transformed into the competent Escherichia coli DH5α cells. The positive clone cells were screened on LB medium containing kanamycin. After sequencing verification, the plasmid was extracted to obtain pCY-35D-GFP- GpERF Recombinant vector.

4. The method for preparing a recombinant vector according to claim 3, characterized in that: The reaction system of step 1) is 2.5 uL of SacI enzyme, 2.5 μL of SalI enzyme, 30 μL of pCY-35D-GFP plasmid, 5 μL of 1.5*T+BSA Universal Buffer, and 10 μL of ddH2O. The enzyme digestion reaction conditions are 37 ℃ for 12 h. In step 2), the reaction system of homologous recombination reaction is: 4 μL of pCY-35D-GFP linearized vector, GpERF cDNA fragment 3 μL, 5 × CE II Buffer 2 μL, Exnase II 1 μL; reaction conditions: 37 ℃ reaction for 30 min.

5. Used for cloning the Gynostemma pentaphyllum as claimed in claim 1 GpERF A primer for a gene, characterized in that The upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.

3.

6. The Gynostemma pentaphyllum according to claim 1 GpERF The application of genes in regulating gibberellins in plants.

7. The Gynostemma pentaphyllum according to claim 1 GpERF The application of genes in inhibiting plant growth.

8. A method of using the Gynostemma pentaphyllum according to claim 1 GpERF The application of genes is characterized in that Used to cultivate dwarf plants.

9. A method of using the Gynostemma pentaphyllum according to claim 1 GpERF The application of genes is characterized in that Gynostemma pentaphyllum GpERF Gene transformation to obtain transgenic plants, wherein the Gynostemma pentaphyllum in the transgenic plants GpERF The gene can regulate the synthesis and metabolic gene expression of the plant hormone gibberellin, thereby affecting the growth and development of the plant and causing changes in plant height.

10. A method for cultivating dwarf plants, characterized in that: The method comprises the following steps: transforming the gene according to claim 1 or the recombinant vector according to any one of claims 2 and 3 into Agrobacterium into plants to obtain dwarfed plants.

Images