Ustilaginoidea virens gene UvASE2 for regulating and controlling rice resistance and application thereof

Abstract

The invention provides a Ustilaginoidea virens gene UvASE2 for regulating and controlling rice resistance and application of the Ustilaginoidea virens gene UvASE2, and relates to the technical field of plant genetic engineering. The nucleotide sequence of the Ustilaginoidea virens gene UvASE2 is as shown in SEQ ID NO: 1, and the amino acid sequence of the encoding protein of the Ustilaginoidea virens gene UvASE2 is as shown in SEQ ID NO: 2. By constructing a transgenic rice plant for heterologous expression of UvASE2, it is found that the transgenic rice can significantly improve the resistance to false smut and bacterial blight and significantly induce the outbreak of active oxygen. The heterologous expression UvASE2 gene of Ustilaginoidea virens has the function of positively regulating and controlling the disease resistance of rice, and the UvASE2 gene can be used for improving the disease resistance of rice and has important significance on creation of disease-resistant germplasm of rice.

Description

Technical Field

[0001] The invention belongs to the technical field of plant gene engineering, and specifically relates to a U. smut fungus gene UvASE2 for regulating rice resistance and an application thereof. Background Art

[0002] The major diseases of rice at present include rice blast, rice bacterial leaf blight, sheath blight and false smut. In the early years, there were not many studies on false smut, but it has now risen from a minor rice disease to one of the major rice diseases. The rice smut balls formed by the infection of rice panicles by false smut contain chlorophyll and smut, which are harmful to humans, livestock and poultry.

[0003] In recent decades, with climate change, large-scale promotion of high-quality and high-yield hybrid rice, and large-scale application of nitrogen fertilizer, these fungal and bacterial diseases have occurred in rice production areas on a large scale, and there is a trend of increasing year by year. Therefore, it is urgent to discover and effectively utilize key genes, improve rice varieties, and improve rice resistance to different diseases. The disease resistance response of plants is a complex process regulated by multiple genes. Current research focuses on the main effect disease resistance genes and disease resistance-related genes involved in plant disease resistance. Some disease resistance-related genes have been cloned. These genes encode different types of proteins and participate in the disease resistance process of rice to different pathogens by regulating different reaction pathways in rice. In recent years, the functional study of effector proteins secreted by pathogens has found that pathogens can secrete a class of proteins that can induce plant immunity and thus improve plant disease resistance. However, the application of these effector protein genes that can induce plant immunity in breeding is currently limited to a certain extent. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a U.S. smut fungus gene UvASE2 for regulating rice resistance. The heterologous expression of the U.S. smut fungus UvASE2 gene has the function of positively regulating rice disease resistance.

[0005] Another object of the present invention is to provide an application of the UvASE2 gene of U.S. smut pathogen in improving rice resistance varieties.

[0006] Another object of the present invention is to provide a method for improving the resistance of rice to rice false smut and bacterial blight.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a U.S. rust pathogen gene UvASE2 for regulating rice resistance. The nucleotide sequence of the U.S. rust pathogen gene UvASE2 is shown in SEQ ID NO:1, and the amino acid sequence of a protein encoded by the U.S. rust pathogen gene UvASE2 is shown in SEQ ID NO:2.

[0009] The present invention also provides an application of the U. smut fungus gene UvASE2 in improving rice resistance varieties.

[0010] Preferably, the resistance includes resistance to rice false smut and resistance to bacterial blight.

[0011] Preferably, the U.S. smut fungus gene UvASE2 is overexpressed in a rice recipient material to obtain transgenic rice plants resistant to U.S. smut and bacterial blight.

[0012] Preferably, the U.S. smut fungus gene UvASE2 acts as an elicitor to induce rice immunity.

[0013] Preferably, the U.S. smut fungus gene UvASE2 can induce a burst of reactive oxygen species in transgenic rice plants.

[0014] The present invention also provides a method for improving the resistance of rice to rice false smut and bacterial blight, and overexpressing the rice false smut fungus gene UvASE2 in a rice receptor material to improve the resistance of the rice receptor material to rice false smut and bacterial blight.

[0015] Preferably, the rice false smut fungus gene UvASE2 is connected to the plant expression vector pCAMBIAI1305 to construct the pCAMBIAI1305-UvASE2 plant overexpression vector; the constructed pCAMBIAI1305-UvASE2 overexpression vector is introduced into the rice recipient material using the Agrobacterium-mediated method to cultivate transgenic rice plants resistant to rice false smut and bacterial blight.

[0016] Preferably, the Agrobacterium is Agrobacterium EHA105.

[0017] Preferably, the rice receptor material is Nipponbare.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention discloses a rice smut fungus gene UvASE2 (Atypical secreted effector protein 2) for regulating rice resistance, and the gene can be used as an elicitor to induce plant immunity. The present invention inoculates a rice smut fungus suspension by artificial injection, takes photos and observes 28 days after inoculation, and finds that the number of rice smut balls on the transgenic rice panicle is significantly lower than that of the Nipponbare wild type, indicating that the transgenic rice heterologously expressing UvASE2 has improved resistance to rice smut; the present invention inoculates a bacterial solution of bacterial leaf blight by the leaf cutting method, takes photos and measures the length of the lesions 14 days after inoculation, and the results show that the length of the lesions on the leaves of the transgenic rice is significantly lower than that of the Nipponbare wild type. The results show that the transgenic rice heterologously expressing UvASE2 has improved resistance to bacterial leaf blight.

[0020] Chitin, a component of fungal cell walls, can trigger a strong innate immune response in leaves, such as the burst of reactive oxygen species (ROS). In order to continue to explore the effect of UvASE2 on the defense response of host rice, the present invention used a punch to remove leaf samples, soaked them in sterile water for 16 hours, and detected the ROS level within 25 minutes. The results showed that after chitin treatment, transgenic rice lines 1 and 2 could significantly induce the burst of ROS.

[0021] The above experimental results indicate that heterologous expression of the UvASE2 gene of U.S. smut fungus has the function of positively regulating the disease resistance of rice and can be used to improve the disease resistance of rice, which is of great significance for the creation of new disease-resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a schematic diagram for verifying the secretion of the UvASE2 gene of the U.S. smut fungus of the present invention;

[0023] Figure 2 The schematic diagram of the UvASE2 gene of the rice smut fungus inducing tobacco cell necrosis of the present invention, in which A is the result of the UvASE2-induced tobacco cell necrosis test, and B is the result of the ion leakage detection test, and *** represents a significant difference of P<0.001;

[0024] Figure 3 This is a schematic diagram of protein expression detection and verification of transgenic rice heterologously expressing the UvASE2 gene of U.S. smut fungus of rice according to the present invention;

[0025] Figure 4The figure is a schematic diagram of the results of the resistance test of the transgenic rice of the present invention to rice false smut, in which A shows the incidence of the transgenic rice and Nipponbare 28 days after injection and inoculation of rice false smut fungi, and B shows the statistics of the number of rice false smut balls 28 days after injection and inoculation of rice false smut fungi, *** indicates that there is a significant difference P<0.001 in the average number of rice false smut balls per inoculated rice panicle between the transgenic rice and the wild type Nipponbare (NBP);

[0026] Figure 5 The figure is a schematic diagram of the results of the resistance test of the transgenic rice of the present invention to bacterial blight, in which A shows the incidence of bacterial blight in the transgenic rice and Nipponbare 14 days after the bacterial blight fungus was inoculated by the leaf clipping method, and B shows the statistics of the lesion length of the bacterial blight fungus 14 days after the leaf clipping method was inoculated by the bacterial blight fungus, *** indicates that there is a significant difference in the lesion length on the inoculated leaves of the transgenic rice and the Nipponbare wild type (NBP) P<0.001;

[0027] Figure 6 This is a schematic diagram of the detection results of the transgenic rice of the present invention on the active oxygen burst. DETAILED DESCRIPTION

[0028]

[0029] The present invention uses the pSUC2 yeast secretion system to verify the secretion function of the UvASE2 gene of the rice smut fungus. The experimental results show that although UvASE2 does not have a signal peptide, it can guide the secretion of the SUC2 protein and successfully guide the protein into the secretion pathway, so that the YTK12 transformant carrying UvASE2 can grow on CMD-W medium and YPRAA medium. In a further color development reaction, the enzyme activity product glucose of the SUC2 carrying UvASE2 can reduce 2,3,5-triphenyltetrazolium chloride (TTC) to insoluble red 1,3,5-triphenylformic acid (TPF), indicating that the UvASE2 gene of the rice smut fungus has a secretion function.

[0030] The present invention also provides an application of the UvASE2 gene of the rice smut fungus in improving rice resistance varieties. In the present invention, the resistance preferably includes resistance to rice smut and resistance to bacterial blight. The present invention constructs transgenic rice that heterologously overexpresses the UvASE2 gene of the rice smut fungus and finds that the transgenic rice strain can significantly improve resistance to rice smut and bacterial blight.

[0031] In the present invention, the UvASE2 gene of the rice smut fungus plays the function of inducing rice immunity as an elicitor. In order to determine the function of the UvASE2 gene of the rice smut fungus in plant immunity, the tobacco transient expression system was used for verification. After 5 days of injecting the Agrobacterium tumefaciens fused with the UvASE2 protein into tobacco leaves, it was found that UvASE2 could induce cell death in tobacco leaves, and its degree of death was close to that caused by the positive control BAX (cell apoptosis promoting gene in the mouse Bcl-2 gene family), while the negative control GFP (pGR107-GFP) could not induce tobacco cell necrosis. The present invention also quantitatively analyzed the cell death on the leaves of Nicotiana benthamiana by ion leakage experiment. The results showed that the cell death of Nicotiana benthamiana induced by BAX and UvASE2 produced serious ion leakage, while after expressing GFP, the degree of ion leakage of leaf cells was significantly reduced. These results show that UvASE2 can induce cell necrosis on Nicotiana benthamiana.

[0032] In the present invention, the UvASE2 gene of the rice smut fungus can induce a burst of reactive oxygen species in transgenic rice plants. Chitin, a component of the fungal cell wall, can induce a strong innate immune response in rice callus, suspension cell lines, and leaves, such as a burst of reactive oxygen species (ROS). In order to explore the effect of UvASE2 on the defense response of host rice, the leaf samples were taken with a puncher and soaked in sterile water for 16 hours, induced with 10 μg / mL chitin, and the ROS level within 25 minutes was detected. The experimental results show that transgenic rice lines can significantly induce a burst of ROS.

[0033] The present invention also provides a method for improving the resistance of rice to false smut and bacterial blight. Overexpressing the UvASE2 gene of the U.S. smut pathogen in a rice receptor material can improve the resistance of the rice receptor material to false smut and bacterial blight. In the present invention, the method preferably comprises the following steps: connecting the UvASE2 gene of the U.S. smut pathogen to a plant expression vector pCAMBIAI1305 to construct a pCAMBIAI1305-UvASE2 plant overexpression vector; using an Agrobacterium-mediated method, introducing the constructed pCAMBIAI1305-UvASE2 overexpression vector into a rice receptor material, and cultivating a transgenic rice plant with resistance to false smut and bacterial blight. The present invention preferably designs primers used for PCR based on the sequence of the UvASE2 gene of the rice smut fungus, performs PCR amplification, and then connects to the pCAMBIAI1305 vector cut with KpnI and HindⅢ to construct the pCAMBIAI1305-UvASE2 plant overexpression vector, and introduces the constructed pCAMBIAI1305-UvASE2 overexpression vector into the rice receptor material Nipponbare by Agrobacterium transformation to obtain transgenic rice heterologously overexpressing the UvASE2 gene of the rice smut fungus. In the present invention, the Agrobacterium is preferably EHA105. The present invention verifies the resistance of the constructed transgenic rice plant heterologously expressing UvASE2, and finds that the transgenic rice plant can significantly improve the resistance to rice smut and bacterial blight.

[0034] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0035] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0036] Example 1

[0037] This example uses the pSUC2 yeast secretion system to verify the secretion function of UvASE2. YTK12 is an auxotrophic yeast that lacks the sucrose invertase gene (SUC2) and the tryptophan synthase gene. The pSUC2 vector can synthesize tryptophan and carries a sucrose invertase gene fragment lacking a signal peptide. When the gene with secretion function is connected to the N-terminus of the pSUC2 vector and transferred into the YTK12 yeast, the YTK12 yeast can synthesize tryptophan and convert raffinose into glucose, and then can grow normally on CMD-W and YPRAA culture media; at the same time, the color reaction can be used to further verify the results, because the enzyme activity product of SUC2, glucose, can reduce 2,3,5-triphenyltetrazolium chloride (TTC) to insoluble red 1,3,5-triphenylformic acid (TPF). In this example, pSUC2-Avr1b, pSUC2 empty vector and pSUC2-Mg87 are used as controls, among which pSUC2-Avr1b can grow in CMD-W medium and YPRAA medium and can reduce TTC, so pSUC2-Avr1b is used as a positive control, and pSUC2 empty vector and pSUC2-Mg87 are used as negative controls. The specific verification method is as follows:

[0038] (1) Construction of a vector carrying the sucrase transformation gene SUC2

[0039] ① Based on the SEQ ID NO: 1 sequence of gene UvASE2, primers used for PCR were designed, the forward primer was TTTAATTAAGAATTCATGAAGCTCTCGTCGACAATGC (SEQ ID NO: 3), the reverse primer was AGGGAGAACGAGCTCTGACATGGAGTCCATGACTGG (SEQ ID NO: 4), and the cDNA of U.S. smut pathogen P1FZ was used as a template. The reaction system was mixed in a 200 μL centrifuge tube. The reaction system is shown in Table 1:

[0040] Table 1 Reaction system

[0041] Reagents 50μL reaction system 2×PhantaMaxBuffer 25μL dNTPMix (10 mM each) 1μL DNA template 400ng 10 μM forward primer 2μL 10 μM reverse primer 2μL PhantaMaxSuper-FidelityDNAPolymerase(1U / μL) 1μL <![CDATA[ddH2O]]> Make up to 50 μL

[0042] ② The mixed reaction system was used for gene amplification in a PCR instrument, wherein the PCR reaction conditions were set as shown in Table 2:

[0043] Table 2 PCR reaction system

[0044]

[0045]

[0046] (2) Enzyme digestion of expression vector

[0047] The desired pSUC2 vector was double-digested with EcoRI and XhoI, and the reaction system was mixed in a 200 μL centrifuge tube (see Table 3) and incubated in a 37°C water bath for 3 to 4 h;

[0048] Table 3 Enzyme digestion reaction system

[0049] Reagents 50μL reaction system Plasmid vector 2000~3000ng Restriction endonuclease EcoRI 2-3 μL Restriction endonuclease XhoI 2-3 μL 10×rCutSmartbuffer 5μL <![CDATA[ddH2O]]> Make up to 50 μL

[0050] (3) Obtaining glue recovery products

[0051] After the products of step (1) and step (2) are completed, 10× Loading Buffer is added to the tube, and the fragment size is verified by electrophoresis using 1% agarose gel at 150V; the target fragment band in the gel is recovered and purified using a gel recovery kit, and the recovered product is stored in a -20°C refrigerator. The experimental method refers to the agarose gel DNA recovery kit of Kangwei Century Biological Reagent Co., Ltd., and the steps are as follows:

[0052] ①Put the cut target gel block into a 2.0mL centrifuge tube and weigh it, add 1 volume of PG Buffer, put it into a 65℃ dry bath to sol, invert and mix until it is completely dissolved, then take it out and cool it to room temperature.

[0053] ②Balance of adsorption column: Add 200 μL PPS Buffer to the adsorption column and centrifuge at 12000 rpm for 1 min.

[0054] ③ Remove the waste liquid, add the gel solution to the adsorption column, place it at room temperature for 2 minutes, and centrifuge it at 12000rpm for 1 minute.

[0055] ④ Remove the waste liquid, add 500μLPWBuffer to the adsorption column for rinsing, centrifuge at 12000rpm for 1min, and then rinse again.

[0056] ⑤ Remove the waste liquid and centrifuge the empty column at 12000rpm for 3min to remove the residual ethanol.

[0057] ⑥ Place the adsorption column in a new 1.5mL centrifuge tube and open the lid. Leave it at room temperature for 5 minutes to evaporate the ethanol.

[0058] ⑦ Add 30-50 μL EB Buffer (preheated at 65°C) to the adsorption column, let it stand for 1 min, centrifuge at 12000 rpm for 1 min to obtain DNA solution, and store it at -20°C for later use.

[0059] (4) Obtaining expression vector by homologous recombination

[0060] The experimental method refers to the cloning kit of Nanjing Novozyme Biotechnology Co., Ltd. The steps are as follows:

[0061] ① Use DNA ligase to connect the digested vector and the target fragment, mix the reaction system in a 200 μL centrifuge tube (see Table 4); incubate in a 37°C water bath for 30 min;

[0062] Table 4 Ligation reaction system

[0063]

[0064] ② Thaw the competent clone (DH5α Competent cell, Vazyme#C502) on ice.

[0065] ③ Take 10 μL of the recombinant product and add it to 100 μL of competent medium, gently tap the tube wall to mix (do not shake to mix), and let it stand on ice for 30 minutes.

[0066] ④After heat shock in a 42℃ water bath for 45s, immediately cool on ice for 2-3min.

[0067] ⑤ Add 900 μL LB (without antibiotics) and shake at 37°C for 1 hour (speed 200-250 rpm).

[0068] ⑥ Preheat the LB solid culture medium plate containing the corresponding antibody in a 37°C incubator.

[0069] ⑦ Centrifuge at 5000rpm (2400×g) for 5 minutes, remove 900μL of supernatant in the clean bench, resuspend the bacteria in the remaining culture medium, and spread it evenly on the plate containing the correct resistance using a sterile spreader.

[0070] ⑧Incubate inverted in a 37°C constant temperature incubator for 12 to 16 hours.

[0071] ⑨Pick the monoclonal transformant colony on the plate, add 5 mL of LB liquid medium with antibiotics to the test tube, and place it at an angle in a constant temperature shaker at 37°C and 180 rpm for 12 hours;

[0072] ⑩ Take part of the bacterial solution and use a plasmid extraction kit to purify the plasmid (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP103), and use PCR technology and first-generation sequencing technology to verify whether the target gene is successfully and correctly connected to the plasmid vector. If the construction is successful, mix the remaining bacterial solution with 40% glycerol in a 1:1 ratio and store it in a -80℃ refrigerator for long-term storage.

[0073] (5) Construction of pSUC2 vector and transfer into yeast YTK12

[0074] Transfer pSUC2-Avr1b, pSUC2-Mg87, pSUC2-EV (empty vector) and pSUC2-UvASE2 into YTK12. Take 100 μL of yeast YTK12 competent cells from the -80°C refrigerator and thaw them on ice. Slowly add 2000 / c μL of the constructed pSUC2 expression vector (c is the concentration of the expression vector, unit ng / μL) and 500 μL of EZ3. Stir gently with a pipette tip and place in a 30°C water bath for transformation for 45 minutes. During this period, turn it upside down and mix it every 15 minutes. Then use a centrifuge to centrifuge at 8000 rpm for 1 minute, apply it to CMD-W medium, and invert it in a 28°C constant temperature incubator for 3 days to obtain monoclonal transformants.

[0075] (6) YPRAA culture medium plate verification method

[0076] The monoclonal transformant in (3) was streaked on CMD-W and YPRAA medium, inverted and cultured in a 28°C constant temperature incubator for 3 days, and the growth of the colony was observed.

[0077] (7)TTC Restoration Verification Method

[0078] ① The monoclonal transformant in step (3) was transferred into 5 mL CMD-W liquid medium and cultured in a constant temperature shaker at 28°C and 200 rpm for 12 h. The YTK12 yeast without any vector was cultured in 5 mL YPD liquid medium;

[0079] ② Collect the bacterial solution in a 2 mL centrifuge tube, centrifuge at 11000 rpm for 1 min, discard the supernatant, add sterilized ddH2O, gently pipette and resuspend the bacteria for washing, centrifuge at 11000 rpm for 1 min, discard the supernatant, and repeat the washing process;

[0080] ③ Add 750 μL ddH2O, 250 μL HAc-NaAc buffer (10 mM, pH = 4.7) and 500 μL 10% sucrose solution to the tube to mix the bacterial solution, and place it in a 37°C water bath for 10 min;

[0081] ④ Centrifuge at 11000rpm for 1min, pipette 100μL of supernatant into a clean test tube, add 900μL of 0.1% TTC solution (adjust to alkaline environment with NaOH solution), leave at room temperature for 5min, and observe the color change of the solution.

[0082] according to Figure 1The results showed that although UvASE2 does not have a signal peptide, it can guide the secretion of SUC2 protein and successfully guide the protein into the secretory pathway, so that the YTK12 transformant carrying UvASE2 can grow in CMD-W medium and YPRAA medium. In a further color reaction, the enzyme activity product glucose of SUC2 carrying UvASE2 can reduce 2,3,5-triphenyltetrazolium chloride (TTC) to insoluble red 1,3,5-triphenylformic acid (TPF), which proves that UvASE2 has secretory function.

[0083] Example 2

[0084] This example uses a tobacco transient expression system to verify the effect of atypical effector protein UvASE2 on plant immunity, and finds that UvASE2 can induce tobacco cell necrosis. The specific operation is as follows:

[0085] (1) Construction of pGR107 (Potato virus X, PVX) expression vector

[0086] Based on the SEQ ID NO:1 sequence of gene UvASE2, primers used for PCR were designed, the forward primer was CTAGAACTAGTGGATCCCCCGGGATGAAGCTCTCGTCGACAATG (SEQ ID NO:5), and the reverse primer was

[0087] TTAACCGTTCATCGGCGGTCGACTCATGACATGGAGTCCATGAC (SEQ ID NO: 6), PCR amplified, and then ligated into the pGR107 vector digested with SmaⅠ and SalⅠ to construct the pGR107-UvASE2 expression vector. For the specific method, refer to Example 1.

[0088] (2) Expression of pGR107-UvASE2 in Agrobacterium tumefaciens GV3101 and obtaining a single clone transformed strain

[0089] ①Take 100 μL of Agrobacterium GV3101 competent cells from the -80℃ refrigerator and thaw them on ice, then slowly add 10 μL of the correctly constructed pGR107-UvASE2 expression vector, gently stir with a pipette tip to mix, and place in an ice bath for 30 minutes, then quickly freeze it in liquid nitrogen for 1 minute, and then place it in a 37℃ water bath for 90 seconds. Do not shake the bacterial solution during this period, then quickly and gently transfer it to an ice bath for 3 minutes, and finally add 500 μL of LB liquid culture medium, and place it horizontally in a constant temperature shaker at 28℃ and 150rpm to recover for 3 hours;

[0090] ② Use a centrifuge to centrifuge at 8000rpm for 1min, remove 500μL of supernatant in the clean bench, gently mix the remaining 100μL of supernatant with the precipitated bacteria, and use a sterilized and cooled applicator to evenly apply it on the LA medium plate to which two antibiotics, Kanamycin (working concentration 50μg / mL) and Rifampicin (working concentration 25μg / mL), have been added, and invert it in a 28℃ constant temperature incubator for 3d;

[0091] ③Pick the monoclonal transformant colony on the plate, add 5 mL of LB liquid medium with Kanamycin and Rifampicin antibiotics to the test tube, and place it in a constant temperature shaker at 37°C and 180 rpm to expand until the concentration reaches OD 600 =1, and obtain Agrobacterium liquid.

[0092] (3) Transient expression of monoclonal transformed strains in tobacco

[0093] The present invention uses Agrobacterium GV3101 transferred with pGR107-BAX as a positive control, and Agrobacterium GV3101 transferred with pGR107-GFP as a negative control, and then the desired Agrobacterium is streaked and activated in an LA medium plate added with two antibiotics, Kanamycin (working concentration 50 μg / mL) and Rifampicin (working concentration 25 μg / mL), and then inverted in a 28°C constant temperature incubator for 3 days. The activated Agrobacterium is shaken with liquid LB for 12-16 hours, and the shaken Agrobacterium is subjected to the next step of treatment, and the specific method is as follows:

[0094] ① Prepare Buffer suspension. The specific formula is shown in Table 5:

[0095] Table 5 Buffer suspension formula

[0096] Mother liquor Final concentration 100mL solution <![CDATA[1MMgCl2·6H2O]]> 10mM 1mL 1MMES 10mM 1mL 1M Cetosyringone 150μM 15μL <![CDATA[ddH2O]]> / Fill up to 100mL

[0097] ② Use a 2mL centrifuge tube to collect the bacterial solution, centrifuge at 9000rpm for 1min, discard the supernatant, add sterilized ddH2O, gently pipette and resuspend the bacteria for washing, centrifuge at 9000rpm for 1min, discard the supernatant, and repeat the washing process;

[0098] ③ Use 1mL of buffer to resuspend the cells, and then measure the OD using a spectrophotometer. 600 value, adjust the bacterial solution concentration to 1.0 with buffer suspension and let stand at 28℃ for 4-6h;

[0099] ④ Use a 1mL disposable syringe (without a needle) to absorb the Agrobacterium bacterial solution and pressure-inject it into the lower epidermis of Nicotiana benthamiana leaves. After one week, observe the tissue necrosis at the injection site of the leaves.

[0100] (4) Conductivity measurement

[0101] ① After the target protein is expressed in tobacco for 3 days, use a 9 mm diameter puncher to punch holes at the inoculation site to obtain enough leaf discs.

[0102] ② Add 5 mL of ddH2O to a 10 mL centrifuge tube, place 5 leaf disks in one tube, and shake at 80 rpm for 3 h.

[0103] ② Take out the leaf disc, test the liquid with a conductivity meter and record the number; put the leaf disc into the liquid again and treat it in a boiling water bath for 25 minutes.

[0104] ③ Use the conductivity meter to test the liquid again and record the numbers.

[0105] ④The conductivity of the blade disk is the ratio of the two values.

[0106] In order to determine the function of UvASE2 in plant immunity, the present invention uses a tobacco transient expression system for verification. Five days after the Agrobacterium tumefaciens fused with UvASE2 protein was injected into tobacco leaves, it was found that UvASE2 could induce tobacco leaf cell death, and its degree of death was close to that caused by the positive control group BXA (cell apoptosis promoting gene in the mouse Bcl-2 gene family), while the negative control GFP (pGR107-GFP) could not induce tobacco cell necrosis ( Figure 2 A). The present invention also quantitatively analyzes the cell death on Nicotiana benthamiana leaves through ion leakage experiment. Figure 2 The results in Figure B show that BAX and UvASE2-induced cell death in Nicotiana benthamiana resulted in severe ion leakage, while the degree of ion leakage in leaf cells was significantly reduced after GFP expression. These results indicate that UvASE2 can induce cell necrosis in Nicotiana benthamiana.

[0107] Example 3

[0108] In this example, a transgenic rice plant heterologously overexpressing the UvASE2 gene of U. oryzae oryzae was constructed, and the specific steps were as follows:

[0109] (1) Construction of plant overexpression vector pCAMBIAI1305-UvASE2

[0110] Based on the SEQ ID NO:1 sequence of the gene UvASE2, primers used for PCR were designed, the forward primer was TGTACAGAGCTTCGGTACCATGAAGCTCTCGTCGACAATGC (SEQ ID NO:7), and the reverse primer was GTCTTGTAGTCAAGCTTTGACATGGAGTCCATGACTGG (SEQ ID NO:8), PCR amplification was performed, and then ligated into the pCAMBIAI1305 vector after digestion with KpnI and HindⅢ to construct the pCAMBIAI1305-UvASE2 overexpression vector. For the specific method, refer to Example 1.

[0111] (2) Obtaining heterologous transgenic rice plants

[0112] In Wuhan Boyuan Biotechnology Co., Ltd. (project number TRGEN_31639C23F668, order number T78569), transgenic rice plants heterologously overexpressing the rice smut fungus gene UvASE2 were obtained by transforming Boyuan Nipponbare with Agrobacterium EHA105.

[0113] (3) Detection of expression in transgenic rice plants

[0114] ① Cut the corresponding tissue samples, then put them into liquid nitrogen for rapid freezing, grind them, and use the kit to extract plant tissue protein;

[0115] ②Take 20μL of extracted protein sample, add 5μL of 5×SDS Loading Buffer and mix well, heat and cook the sample in a 100℃ dry bath for 10min. Place the prepared polyacrylamide gel in the BIO-RAD electrophoresis tank, perform spotting operation, and perform electrophoresis at 80V for about 2h; cut off the separation gel and soak it in transfer buffer;

[0116] ③ Cut a PVDF membrane of the same size as the separation gel, rinse it with anhydrous methanol for 15 seconds, rinse it with ddH2O for 2 minutes, and then soak it in the transfer solution for 5 minutes; cut a filter paper of appropriate size and soak it in the transfer solution for 5 minutes; soak the sponge pad of the transfer clip in the transfer solution for 5 minutes;

[0117] ④ Open the transfer clamp and cover the layers in the order of "negative electrode clamp - sponge pad - filter paper - separation gel - PVDF membrane - filter paper - sponge pad - positive electrode clamp" according to the color of the clamps. During the process, be careful to avoid bubbles between the layers. Use 80V voltage in the transfer solution to transfer the membrane for about 2 hours.

[0118] ⑤ Take out the transferred PVDF membrane and place it in the blocking solution, and block it on a shaker at 60rpm for at least 1h; pour out the blocking solution, add 20mL Anti-FLAG (Beijing Quanshijin Biotechnology Co., Ltd., catalog number: HT201-01), and incubate for 1h; after incubation, recover the hybridization solution, add 20mL 1×TBST, and wash it on a shaker at 60rpm for 10min, repeat the washing step twice; use the same method with the secondary antibody Anti-Mouse (Beijing Quanshijin Biotechnology Co., Ltd., catalog number: HS201-01), incubate for 1h, and then wash three times with 1×TBST;

[0119] ⑥ Place the treated PVDF membrane in a cut transparent ziplock bag, add reaction substrate (500μL HRP Substrate Peroxide Solution + 500μL HRP Substrate Luminol Reagent; Immobilon Western, Millipore) and react for 5 minutes. Use absorbent paper to absorb the reaction solution and press the X-ray film in a dark room for about 5 minutes. Determine the length of pressing time according to the signal intensity, then develop it in developer (Kangwei Century), take it out and fix it in fixer (Kangwei Century) to obtain an X-ray film; or treat the PVDF membrane with luminescent liquid and use a chemiluminescence imager to take pictures directly to observe the luminescence of the protein bands.

[0120] The formula of some reagents required for the experiment is shown in Table 6 and Table 7:

[0121] Table 6 Transfer solution formula

[0122] Reagents 1L system Tris 3.03g Glycine 14.4g Methanol 100mL <![CDATA[H2O]]> Fill to 1L

[0123] Table 7 10×TBS Buffer recipe

[0124] Reagents 1L system Tris 24.23g NaCl 87.66g

[0125] Add distilled water to dissolve the solution in Table 7, pH 7.5, and adjust the volume to 1 L. 1×TBST solution configuration: 100 mL 10×TBS Buffer, 500 μL Tween 20, adjust the volume to 1 L with distilled water.

[0126] The experimental results showed that the SEQ ID NO:1 sequence of the UvASE2 gene of the rice smut fungus was fused into the pCAMBIAI1305 plant expression vector, and the heterologous overexpression transgenic rice plants were obtained by Agrobacterium-mediated transformation. Because FLAG and UvASE2 are fusion proteins, the protein expression of UvASE2 can be detected using FLAG antibodies. The results of Western-blot showed (see Figure 3 ), rice plant 1( Figure 3 UvASE2OE-1) and 2( Figure 3 UvASE2OE-2) was expressed in the gene, thereby obtaining two T0 generation homozygous strains expressing UvASE2 containing the protein fusion tag FLAG transgene.

[0127] Example 4

[0128] After cultivating the T0 generation homozygous rice plant 1 and rice plant 2 seedlings obtained in Example 3, the T1 generation seeds of rice plant 1 and rice plant 2 were obtained, and the T1 generation seeds were further propagated to obtain T2 generation transgenic rice plants. In this example, the resistance of T2 generation transgenic rice plants to rice false smut was verified, and the specific steps were as follows:

[0129] (1) Take out the wild type of U.S. smut fungus (PJ60-2) from the -80℃ refrigerator and activate it on a solid plate, and culture it in a 28℃ incubator for 10 days. Cut the bacterial block into 100mL liquid culture medium and culture it in a shaker at 28℃ and 180rpm for 5-7 days;

[0130] (2) Adjust the spore concentration of the rice smut pathogen to 1×10 6 / mL, 1mL of bacterial solution was injected into the panicles of T2 rice plants 1 and 2 that had just emerged, and each sample was repeated 3 times, with 20 panicles inoculated each time. The number of rice balls and the incidence rate were counted 28 days after inoculation.

[0131] according to Figure 4 The results showed that the rice false smut pathogen invaded the rice floral organs before heading, and a large number of thick-walled spores were formed in the late stage of the disease, which wrapped the infected filaments to form rice false smut balls ( Figure 4 In order to further explore the effect of UvASE2 on rice immunity, the T2 rice plants 1 and 2 were artificially inoculated with a suspension of rice smut pathogen, and photographed 28 days after inoculation. It was found that the number of rice smut balls in the transgenic rice (UvASE2OE-1 and UvASE2OE-2) was significantly lower than that in the Nipponbare wild type ( Figure 4 B) in the figure shows that transgenic rice heterologously expressing UvASE2 has improved resistance to rice false smut.

[0132] Example 5

[0133] The T2 transgenic rice plants heterologously overexpressing the UvASE2 gene of U. oryzae oryzae obtained in Example 4 were tested for resistance to bacterial blight. The specific steps are as follows:

[0134] (1) Take out the bacterial blight pathogen (Xanthomonas oryzae pv.oryzae, Xoo) from the -4°C refrigerator and streak the plate, then activate it with NA liquid medium containing 25 μg / mL cephalexin, collect the cells by centrifugation at 9000 rpm, wash them twice with 10 mM MgCl2 solution, resuspend them, and adjust the OD 600 is 0.8.

[0135] (2) Dip a pair of scissors in the bacterial solution and inoculate the second leaf after the flag leaf of the rice seedling. Count the length from the cut end to the end of the lesion 14 days after inoculation.

[0136] The suspension of Xanthomonas spp. was inoculated by leaf clipping method. After 14 days of inoculation, photos were taken and the length of lesions was measured. Figure 5 The results of A to B in Figure 1 showed that the length of the lesions in the transgenic rice was significantly lower than that in the Nipponbare wild type, indicating that the transgenic rice heterologously expressing UvASE2 had improved resistance to bacterial blight.

[0137] Example 6

[0138] Chitin, a component of fungal cell walls, can trigger a strong innate immune response in leaves, such as the outbreak of reactive oxygen species (ROS). This example explores the effect of the UvASE2 gene of U. oryzae var. oryzae on the defense response of host rice. The specific steps are as follows:

[0139] (1) Planting the T2 transgenic rice plants obtained in Example 4, removing the second leaf after the flag leaf before heading, punching the leaves with a 5 mm diameter puncher, and placing the intact leaves in ddH2O in the dark for 16 h;

[0140] (2) Place the samples and reagents listed in Table 8 in a 1.5 mL centrifuge tube:

[0141] Table 8 Reaction samples and reagents

[0142] Substrate concentration 200 μL solution L-012 500μM 2μL HRP 1mg / mL 4μL chitin 1mg / mL 0.2μL <![CDATA[ddH2O]]> / Make up to 200 μL Rice leaves / 3 pieces

[0143] The final concentration of chitin was 10 μg / mL; mock treatment was performed by replacing chitin with an equal volume of ddH2O.

[0144] (3) A chemiluminescence detector was used to detect the luminescence every minute for 25 min. The treatment of each leaf needed to be repeated three times, and three different sampling treatments were required. Finally, the data were plotted into a curve to compare the differences between the transgenic rice and the wild type in the treatment group.

[0145] Chitin, a component of fungal cell walls, can induce strong innate immune responses in rice callus, suspension cell lines, and leaves, including the generation of reactive oxygen species (ROS). Figure 6 The results showed that after induction with chitin, the ROS level in the leaves of UvASE2OE transgenic rice was detected within 25 minutes, and it was found that the transgenic rice lines 1 (UvASE2OE-1-Chitin) and 2 (UvASE2OE-2-Chitin) could significantly induce the burst of ROS.

[0146] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A U.S. smut fungus gene UvASE2 for regulating rice resistance, characterized in that: The nucleotide sequence of the U.S. smut fungus gene UvASE2 is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the U.S. smut fungus gene UvASE2 is shown in SEQ ID NO:

2.

2. Use of the UvASE2 gene of U.S. smut fungus according to claim 1 in improving resistant rice varieties.

3. The use according to claim 2, characterized in that: The resistance includes resistance to rice false smut and resistance to bacterial blight.

4. The use according to claim 2, characterized in that: The UvASE2 gene of the rice smut fungus is overexpressed in a rice receptor material to obtain a transgenic rice plant resistant to rice smut and bacterial blight.

5. The use according to claim 2, characterized in that: The U. smut fungus gene UvASE2 acts as an elicitor to induce rice immunity.

6. The use according to claim 2, characterized in that: The U.S. smut fungus gene UvASE2 can induce a burst of active oxygen in transgenic rice plants.

7. A method for improving rice resistance to rice false smut and bacterial blight, characterized in that: The UvASE2 gene of the rice smut fungus according to claim 1 is overexpressed in a rice receptor material to improve the resistance of the rice receptor material to rice smut and bacterial blight.

8. The method according to claim 7, characterized in that The rice false smut fungus gene UvASE2 was connected to the plant expression vector pCAMBIAI1305 to construct the pCAMBIAI1305-UvASE2 plant overexpression vector; the constructed pCAMBIAI1305-UvASE2 overexpression vector was introduced into the rice receptor material using the Agrobacterium-mediated method to cultivate transgenic rice plants resistant to rice false smut and bacterial blight.

9. The method according to claim 8, characterized in that The Agrobacterium is Agrobacterium EHA105.

10. The method according to claim 7, characterized in that The rice receptor material is Nipponbare.

Images