Mn5 gene for regulating and controlling corn kernel size, molecular marker and application thereof

Abstract

The invention belongs to the technical field of plant molecular biology, and discloses a Mn5 gene for regulating and controlling the size of corn kernels, and a molecular marker and application of the Mn5 gene. According to the Mn5 gene for regulating and controlling the corn kernel size, a G-C single base mutation exists at the ATG downstream 325bp position of the gene with the nucleotide sequence shown as SEQ ID No.1, and the 109th amino acid coded by the Mn5 gene is mutated into valine from leucine. The Mn5 gene for regulating and controlling the size of the corn kernels is obtained by adopting a map-based cloning method, specifically influences the size of the corn kernels, participates in the development of the corn kernels, and influences the development speed of corn embryos, endosperm and basal transfer layers. Technical support is provided for the aspects of corn yield improvement, corn germplasm resource analysis, molecular assisted genetic breeding and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of plant molecular biology, and in particular to a method for regulating the size of corn kernels. Mn5 Genes, their molecular markers and applications. Background Art

[0002] Corn is the world's largest food crop, with the unique advantage of being a food, feed, industrial raw material and energy crop. With the development of society and the improvement of people's living standards, people's demand for corn is growing.

[0003] However, corn germplasm is the material carrier for breeding excellent corn hybrids and developing corn production. The improvement and innovation of corn germplasm has become one of the development directions of corn breeding in the world. Germplasm resources are the premise and foundation of corn breeding. In-depth understanding and rational selection of germplasm resources can significantly improve breeding efficiency and accelerate the breeding process. The traditional hybrid corn new variety breeding is a long and complicated process. It is necessary to hybridize corns with different advantages, identify good combinations suitable for production needs, and then cultivate new varieties with high and stable yields, multiple resistances, wide adaptability, and excellent quality. This breeding method is not only time-consuming, labor-intensive, and inefficient, but also prone to gene linkage encumbrances.

[0004] Therefore, it is urgent to establish a scientific, practical, rapid and accurate method to discover and select corn germplasm resources, which has very important application value for corn breeding. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method for regulating the size of corn kernels. Mn5 Genes, their molecular markers and applications.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a method for regulating corn kernel size. Mn5 A gene, wherein a single base mutation from G to C exists at 325 bp downstream of ATG of the gene shown in the nucleotide sequence of SEQ ID No. 1.

[0007] In a second aspect, the present invention provides a method for regulating corn kernel size. Mn5 The protein encoded by the gene has an amino acid sequence such as that shown in SEQ ID NO. 2, in which the amino acid at position 109 encoded by the protein is mutated from leucine to valine.

[0008] In a third aspect, the present invention provides a method for amplifying the method for regulating corn kernel size. Mn5 The PCR primers for the gene have nucleotide sequences shown in SEQ ID No. 3 and 4.

[0009] In a fourth aspect, the present invention provides a method for regulating corn kernel size. Mn5 A molecular marker of a gene, wherein the molecular marker comprises at least one of the following primer sets: i. The nucleotide sequence of the primer set is shown in SEQ ID No.35, 36, 37, 38; ii. The nucleotide sequences of the primer sets are shown in SEQ ID No.35, 36, 43, and 44.

[0010] In a fifth aspect, the present invention provides a method for identifying a method for regulating corn kernel size. Mn5 A gene kit comprises the molecular marker.

[0011] As a preferred embodiment of the kit of the present invention, it also includes a restriction endonuclease XOt I and / or Nco Ⅰ.

[0012] In a sixth aspect, the present invention provides a method for identifying corn kernel size mutants. Mn5 The genetic method comprises the following steps: (1) extracting genomic DNA of the corn material to be tested as a template, and performing PCR amplification using the molecular marker or the kit; (2) Performing electrophoresis analysis on the PCR amplification product. If the amplified product is a 752 bp DNA fragment, the corn material to be tested has Mn5 Genotypes of corn.

[0013] Preferably, the DNA fragment is cleaved by restriction endonuclease XOt Ⅰ After digestion, it is 143 bp, or after restriction endonuclease Nco After digestion with enzyme Ⅰ, the fragment is 135 bp.

[0014] In a seventh aspect, the present invention comprises the method for regulating the size of corn kernels. Mn5 Gene, the regulating corn kernel size Mn5 Application of gene molecular markers in improving corn yield.

[0015] In an eighth aspect, the present invention comprises the method for regulating the size of corn kernels. Mn5 Gene, the regulating corn kernel size Mn5 Application of gene molecular markers in analysis and identification of maize germplasm resources.

[0016] In a ninth aspect, the present invention comprises the method for regulating the size of corn kernels. Mn5 Gene, the regulating corn kernel size Mn5 The molecular markers of genes are used in molecular marker-assisted breeding of maize.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention found Mn5 The mutant kernels became smaller, the top was slightly wrinkled, the seed coat color became lighter, the 100-kernel weight was significantly reduced, the embryo, endosperm and basal transfer layer were delayed in development, and the mutants could grow and develop normally but the plant height was reduced. Mn5 Genes that specifically affect corn kernel size. Mn5 Genes regulate kernel size, participate in the development of corn kernels, affect the development speed of corn embryo, endosperm and basal transfer layer, and play an important role in increasing corn yield. Mn5 The molecular markers of the mutation sites provide an efficient detection marker for the utilization of this gene. The detection method is highly accurate and simple to operate, providing technical support for improving corn yield, corn germplasm resource analysis, molecular-assisted genetic breeding, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 for Mn5 Phenotypic and biochemical analysis of mutant grains; Figure 1 A: Grain phenotypes on mature detached ears; B: wild type and Mn5 Comparison of mutant grain length and width; C: Difference in 100-grain weight between wild-type and mutant grains; D: Difference in starch content between wild-type and mutant grains; E: Difference in non-alcohol-soluble protein, alcohol-soluble protein and total protein content between wild-type and mutant grains; F: SDS-PAGE electrophoresis analysis of non-alcohol-soluble protein, alcohol-soluble protein and total protein content between wild-type and mutant grains; G, H: Difference in seedling emergence between wild-type and mutant grains; I, J, K: Difference in plant height and ear position and leaf between wild-type and mutant at adult stage; L, M: Difference in mature ear and 100-grain weight between wild-type and mutant.

[0019] Figure 2 for Mn5 Gene map cloning, gene structure and allelic testing verification; Figure 2 In, A: Mn5 Map-based cloning of genes; B: Mn5 Schematic diagram of gene structure; C: Mn5 and Mn5 Premature gene termination mutant mn5-1 Allelic test verification; D: Mn5 Allelic testing for genotyping.

[0020] Figure 3 for Mn5 Mutation site-specific analysis; Figure 3A: dCAPs markers were used to identify 355 maize inbred lines. Mn5 The red arrows indicate the mutation sites that contain Mn5 Inbred lines with the same mutation site; B: based on Mn5 Statistics and analysis of grain length and width of 355 maize inbred lines divided by mutation sites; C: containing Mn5 Sequencing verification of inbred lines with the same mutation site.

[0021] Figure 4 for Mn5 Correlation analysis between natural genetic variation and maize kernel size; Figure 4 In, A: Mn5 Linkage disequilibrium (LD) analysis of SNP sites significantly associated with 100-grain weight and grain length within the gene segment. The schematic diagram shows a 3.7-kb segment, including an approximately 2-kb promoter region and a 300 bp 3'-downstream region. The start codon (ATG) is marked as "+1". Each dot represents a single nucleotide polymorphism (SNP) site. P The values ​​are displayed as -log10, and the orange blocks indicate the degree of LD; B: The significant SNP loci are Mn5 Schematic diagram of the location of the CDS region; chr5.s_201335080 is a non-synonymous mutation site associated with both 100-grain weight and grain length, and n represents the number of genotypes corresponding to each haplotype; C: A two-tailed t-test was used to compare the 100-grain weight and grain length of the two haplotypes at the chr5.s_201335080 locus, and the statistical results are shown in the box plot. DETAILED DESCRIPTION

[0022] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0023] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0024] Example 1: Corn Mn5 Genes influence kernel size Maize kernel mutants purchased from the American Maize Genetics Cooperative Germplasm Center mn5 The phenotype of mature mutant grains was observed and it was found that the length and width of mutant grains were significantly smaller than those of wild type (see Figure 1 A, B), statistical analysis of the 100-grain weight of wild type and mutant from the same ear showed that the 100-grain weight of mutant grains was significantly reduced (see Figure 1 C), maize kernel mutants in seedling experiment mn5 Seedlings can grow normally (see Figure 1 G, H), the mutant can grow to the adult stage and develop and bear fruit normally, but the plant height, ear leaf length and width, and 100-grain weight of mature ears of the mutant are significantly reduced (see Figure 1 I - M).

[0025] The starch and protein contents of mature wild-type and mutant grains were analyzed using starch and alcohol-soluble protein content assay kits. It was found that the starch content of mutant grains was not significantly different from that of wild-type (see Figure 1 D); The contents of alcohol-soluble proteins, non-alcohol-soluble proteins, and total protein in the mutant were not significantly different from those in the wild type (see Figure 1 E, F).

[0026] Embodiment 2: Mn5 Gene cloning and functional verification Using maize kernel mutants from the American Maize Genetics Cooperative Germplasm Center mn5 , the original material mn5 The heterozygote was crossed with the inbred line Zheng 58 to obtain the F1 population, which was then self-fertilized to obtain the F2 population. Through genetic analysis and positional cloning, the target gene was located in a physical interval of about 210 kb on chromosome 5 of maize (see Figure 2 A).

[0027] The linkage markers and their sequences used in the map-based cloning process are shown in Table 1. Gene annotation, natural population restriction enzyme verification and sequencing analysis within the candidate segment showed that Zm00001d017603 The gene (CDS sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2) is a potential candidate gene. mn5 In mutant Zm00001d017603 There is a single base mutation from G to C at 325 bp downstream of the ATG of the gene, which causes the amino acid at position 109 encoded by it to mutate from leucine to valine (see Figure 2 B).

[0028] Zm00001d017603 The gene preparation method is as follows: 1) Grind wild-type and mutant grain endosperms 10 days after pollination in a mortar with liquid nitrogen, and extract RNA using the Plant Polysaccharide Polyphenol RNA Extraction Kit according to the instructions. Dissolve total RNA in RNase free ddH2O. Use DNase I to remove any residual DNA.

[0029] 2) RNA quality was tested by 1.5% agarose gel electrophoresis, and RNA concentration and RNAA were tested by NanoDrop instrument. 260 / 280The light absorption value, A 260 / 280 The value is between 1.8 and 2.2, the RNA integrity is good (28S: 18S>1.0), and there is no contamination by protein, guanidine salt, or DNA.

[0030] 3) Using the obtained RNA as a template and oligo(dT) as a reverse transcription primer, the HiScript Ⅲ 1st Strand cDNA Synthesis Kit from Novozymes was used for reverse transcription according to the instructions. The obtained cDNA was packaged and stored in a -20℃ refrigerator for later use.

[0031] 4) According to the corn B73 Zm00001d017603 Transcript reference sequence, design amplification primers: F: 5' ATGCCGCCGCCGCCGCCACCA 3' (SEQ ID No. 3); R: 5' CAATCTTATTTCTCGTCGCA 3' (SEQ ID No. 4); To verify the candidate gene, the EMS mutant gene was purchased from the maize EMS mutant library (http: / / elabcaas.cn / memd / ) Zm00001d017603 Premature termination mutant material ( mn5-1 ),and mn5 / + Allele tests were performed on the forward and reverse crosses, and the phenotypes and segregation ratios of the F1 ears obtained by the hybridization were observed. The results showed that the segregation ratio of wild-type and mutant grains on mature F1 ears was 3:1. Zm00001d017603 To cause mn5 The functional gene of the mutant phenotype is named Mn5 .

[0032] Mn5 The primers and sequences used for map-based cloning are shown in Table 1: Example 3: Corn Mn5 Molecular markers For corn mn5 Mutation sites and corn mn5-1 The mutation sites were used to develop easily detectable molecular markers dCAPs 1 and dCAPs 2, as follows: mn5 The actual position of the mutation site in the maize B73 reference genome V4 version is 201,336,012, and the following dCAPs 1 primers were designed: dCAPs 1-F1: 5' GATCCCGGCATCCCCAAAA 3'; (SEQ ID No. 35) dCAPs 1-R1: 5' CCCATGCGTGCTGCAACTGT 3'; (SEQ ID No. 36) dCAPs 1-F2: 5'AACGCCGTCATCAAACTCCT 3'; (SEQ ID No. 37) dCAPs 1-R2: 5' GTGGGTGGCGCAGGCGCGCGGCGAGCTCGA 3'; (SEQ ID No. 38) Among them, dCAPs 1-F1R1 is the outer primer pair, which can specifically amplify Mn5 gene sequence; dCAPs 1-F2R2 was used as the inner primer pair, and the PCR product of dCAPs 1-F1R1 was used as the template for the second round of amplification.

[0033] mn5-1 The actual position of the mutation site in the maize B73 reference genome V4 version is 201,336,772, and the following dCAPs 2 primers were designed: dCAPs 2-F1: 5' AGATGAAGAGGAGAGGCAGC 3'; (SEQ ID No. 39) dCAPs 2-R1: 5' ATGTCCTCTGCCCTCTTACG 3'; (SEQ ID No. 40) dCAPs 2-F2: 5' CCAAATGTGGTTACCTATACTGTCTGGATC 3'; (SEQ ID No. 41) dCAPs 2-R2: 5' TCCCTTGCTCATTGTCTCGA 3'; (SEQ ID No. 42) Among them, dCAPs 2-F1R1 is the outer primer pair, which can specifically amplify mn5-1 gene sequence; dCAPs 2-F2R2 was used as the inner primer pair, and the PCR product of dCAPs 2-F1R1 was used as the template for the second round of amplification.

[0034] against mn5 and mn5-1 The molecular marker detection of mutants includes the following steps: (1) The reaction system is shown in Table 2: (2) The PCR amplification procedures for dCAPs 1-F1R1 and dCAPs 2-F1R1 are as follows: 1 cycle 95℃ pre-denaturation for 3 min; 35 cycles of 95°C denaturation for 30 s, 58°C annealing for 30 s, and 72°C extension for 70 s; Delay 72℃ 5 min; Soak 25℃ ; (3) The PCR amplification procedures for dCAPs 1-F2R2 and dCAPs 2-F2R2 are as follows: 1 cycle 95℃ pre-denaturation for 3 min; 35 cycles of 95°C denaturation for 30 s, 58°C annealing for 30 s, and 72°C extension for 25 s; Delay 72℃ 5 min; Soak 25℃ ; The PCR product of dCAPs 1-F2R2 was amplified using restriction enzymes from Thermo Fisher. XOt Ⅰ Enzyme digestion: The PCR product of dCAPs2-F2R2 was digested with restriction endonucleases from Thermo Fisher. Bam H Ⅰ digestion, using 10% polyacrylamide gel electrophoresis for 70 min, the size of the bands after digestion were 143 bp and 201 bp respectively (see Figure 2 D).

[0035] Embodiment 4: Mn5 Specific analysis of mutation sites in natural populations To further clarify Zm00001d017603 is a candidate gene related to maize kernel size. Zm00001d017603 Point mutation of the coding region G to C (Leu-Val) was used to design dCAPs 3 markers. NcoⅠ Restriction endonucleases were used to identify 349 natural populations from tropical, subtropical and temperate zones (CML423, CML169, GY237, P138, GEMS16, JING24, SHEN137, YE8001, B73(Su), J4112, CIMBL53, CML454, Zheng58, CIMBL147, CML497, CML114, QI319, 812, CML290, YE107, TY2, CIMBL77, CML192, CIMBL157, SY1039, CML20, CML50CIMBL142, GEMMS60, GEMS64, CML 287, RY732, ZZ01, LIAO5114, 975-12, ZHENG28, CML360, BY4960, CML171, CIMBL144, CIMBL135, 04K5686, TY10, 238, GY1032, CIMMBL129, D863F, CIMBL6, ZHENG32, W22, etc., and the inbred lines containing GC mutations can be Nco I restriction endonuclease digestion to a 135 bp band (see Figure 3 A). Based on the inbred lines obtained by enzyme digestion and the phenotypic data of the associated population published by Professor Yan Jianbing's laboratory at Huazhong Agricultural University, statistical analysis was performed (Yang et al. 2014). The results showed that BY4960 and GY1032 were mn5 The mutants have the same phenotype, all of which are small-grain mutants, indicating that the mutation of GC is a key SNP site affecting maize grain size (see Figure 3 B). The results of sequencing verification showed that there were real GC mutations in BY4960 and GY1032 (see Figure 3 C). The above results show Mn5 The mutation site is a potential site associated with corn kernel size.

[0036] Example 5: Corn Mn5 Molecular markers of natural populations using enzyme digestion of mutation sites against Mn5 The mutation sites were developed with molecular markers dCAPs 3-F2 and dCAPs 3-R2 that are easy to detect. The outer primer pairs refer to dCAPs 1-F1 (SEQ ID No.35) and dCAPs 1-R1 (SEQ ID No.36). The inner primer pairs are as follows: dCAPs 3-F2: 5' CCGTGCACGGTCGACCCCATG 3'; (SEQ ID No. 43) dCAPs 3-R2: 5' CTCGAACAGGATGGGGAACG 3'; (SEQ ID No. 44) against Mn5 The molecular marker detection steps of mutation sites in natural populations refer to " mn5 and mn5-1 "Molecular marker detection steps for mutants"; dCAPs 3-F2R2 PCR products were PCR amplified using Thermo Fisher restriction endonucleases Nco Ⅰ Enzyme digestion, using 10% polyacrylamide gel electrophoresis for 70 min, the size of the band after enzyme digestion is 135 bp, which is the inbred line containing the GC mutation (see Figure 3 A).

[0037] Example 6: Corn Mn5 Natural variation in the kernel size trait is significantly associated with The phenotypic data of 507 maize inbred line materials were collected, including tropical, subtropical and temperate materials, and the germplasm sources were composed of GME materials (Germplasm Enhancement of Maize), CIMMYT materials and Chinese inbred line materials. The phenotypic data and SNP information of various agronomic traits, lysine content, etc. were obtained from the MaizeGo website (http: / / www.maizego.org / Resources.html).

[0038] The association analysis was conducted using the phenotypic data of 360 maize inbred lines from tropical, subtropical and temperate zones and 99 SNPs in the approximately 3.7-kb region from 2-kb upstream of the Mn5 gene promoter to 300 bp downstream of the 3' gene. Mn5 The gene was significantly correlated with 100-grain weight and grain length. Mn5 Four SNPs in the gene coding region were significantly associated with 100-grain weight (HKW) and grain length (KL) (see Figure 4 A). Among the four SNPs, only SNP1257 (chr5.s_201335080) leads to Mn5 The change of amino acid at position 419 (see Figure 4 B). 360 maize inbred lines were divided into two major haplotypes Mn5 based on SNP1257 (chr5.s_201335080) Glu419 and Mn5 Asp419 , including 321 and 39 inbred lines, respectively (see Figure 4 C). Mn5 Glu419 、Mn5 Asp419There were significant differences in 100-grain weight (HKW) and grain length (KL) between the two haplotype inbred lines. Asp419 The 100-grain weight (HKW) and grain length (KL) of the haploid inbred lines were significantly increased (see Figure 4 C). This indicates that Hap2 is the optimal haplotype for grain-related traits, and also indicates that SNP1257 is a key locus associated with corn grain size. Asp419 The haplotype appears to be less selected and used in maize breeding, so this haplotype provides an important gene target for breeding high-yield maize.

[0039] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

[0040] References: Yang, N., Lu, Y., Yang, X., Huang, J., Zhou, Y., Ali, F., ...&Yan, J.(2014). Genome wide association studies using a new nonparametric model reveal the genetic architecture of 17 agronomic traits in an enlargedmaizeassociation panel. PLoS Genetics, 10(9), e1004573.

Claims

1. A method for regulating corn kernel size Mn5 A gene characterized by There is a single base mutation from G to C at 325 bp downstream of ATG of the gene with the nucleotide sequence shown in SEQ ID No.

1.

2. A method for regulating corn kernel size Mn5 The protein encoded by the gene is characterized in that The amino acid at position 109 encoded by the protein in the amino acid sequence shown in SEQ ID NO. 2 is mutated from leucine to valine.

3. A method for amplifying the method for regulating corn kernel size according to claim 1 Mn5 A PCR primer for a gene, characterized in that The nucleotide sequences thereof are shown in SEQ ID Nos. 3 and 4.

4. A method for regulating corn kernel size Mn5 A molecular marker of a gene, characterized in that The molecular markers include at least one of the following primer sets: i. The nucleotide sequence of the primer set is shown in SEQ ID No.35, 36, 37, 38; ii. The nucleotide sequences of the primer sets are shown in SEQ ID No.35, 36, 43, and 44.

5. A method for identifying and regulating corn kernel size Mn5 A gene kit, characterized in that Comprising the molecular marker described in claim 4.

6. The kit according to claim 5, characterized in that Also includes restriction endonucleases XOt I and / or Nco Ⅰ.

7. A method for identifying corn kernel size mutants Mn5 A genetic method, characterized in that The following steps are involved: (1) Extracting genomic DNA of the corn material to be tested as a template, and performing PCR amplification using the molecular marker described in claim 4 or the kit described in claim 5 or 6; (2) Performing electrophoresis analysis on the PCR amplification product. If the amplified product is a 752 bp DNA fragment, the corn material to be tested has Mn5 Genotypes of corn.

8. The method for regulating corn kernel size according to claim 1 Mn5 Gene, the gene for regulating corn kernel size according to claim 4 Mn5 Application of gene molecular markers in improving corn yield.

9. The method for regulating corn kernel size according to claim 1 Mn5 Gene, the gene for regulating corn kernel size according to claim 4 Mn5 Application of gene molecular markers in analysis and identification of maize germplasm resources.

10. The method for regulating corn kernel size according to claim 1 Mn5 Gene, the gene for regulating corn kernel size according to claim 4 Mn5 Application of gene molecular markers in maize molecular marker-assisted breeding.

Images