SiMYB4 gene in saussurea involucrata as well as encoding product and application thereof

Abstract

The invention discloses a SiMYB4 gene in saussurea involucrata as well as a coding product and application thereof, and belongs to the technical field of plant genetic engineering. The saussurea involucrata SiMYB4 gene is one of the following nucleotide sequences: (1) the saussurea involucrata SiMYB4 gene has a nucleotide sequence as shown in SEQ ID NO.1; and (2) a homologous sequence obtained by adding, substituting, inserting or deleting one or more basic groups in the nucleotide sequence as shown in SEQ ID NO.1 or an allele of the homologous sequence and a nucleotide sequence derived from the allele. The SiMYB4 gene obtained in the invention is a key gene for regulating and controlling the synthesis of the flavonoids of Tianshan snow, which has huge value and production potential for obtaining an ideal saussurea involucrata engineering cell line with high flavonoids through directional genetic improvement; siMYB4 is subjected to molecular regulation and control, the content of saussurea involucrata flavonoid compounds can be improved, great significance is achieved for increasing saussurea involucrata flavonoid natural active ingredients, and the application prospect of saussurea involucrata cell lines is greatly widened.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a SiMYB4 gene in snow lotus and its encoding product and application. Background Art

[0002] Saussurea involucrata (Kar. & Kir.) Sch. Bip. belongs to the genus Saussurea of ​​the family Asteraceae, dicotyledonous plants, and is an endangered perennial alpine plant. In order to adapt to the plateau environment of strong ultraviolet radiation, low temperature and thin air, Saussurea involucrata has evolved a series of unique secondary metabolites, which make it have significant therapeutic effects in the treatment of rheumatoid arthritis, tumor diseases and altitude sickness. In recent decades, with the continuous advancement of biotechnology, the widespread application of plant tissue and cell culture technology has played a vital role in the preservation and development of medicinal plant resources. It is worth noting that the cell culture of Saussurea involucrata has become a promising ingredient in cosmetics and food.

[0003] There are also abundant flavonoids in Chinese herbal medicine, and flavonoids have a wide range of pharmacological effects, such as anti-oxidation, anti-cancer, antibacterial, anti-allergic, anti-inflammatory, promoting wound healing, protecting the liver and stomach, etc. In the wild plants of snow lotus, the main biologically active ingredients of snow lotus are mostly flavonoids, such as acacia, plantain, etc. (Gong et al, Saussureae Involucrata Herba (Snow Lotus): Review of Chemical Compositions and Pharmacological Properties. Frontiers in Pharmacology, 2020, 9: 2019), but the main biologically active ingredients in the callus of snow lotus are phenolic acid compounds, lacking flavonoids (Qiu et al, Metabolic engineering of the phenylpropanoid pathway enhances the antioxidant capacity of Saussurea involucrata. PLoS One, 2013, 8: e70665). Therefore, the improvement of flavonoids in snow lotus callus is a key issue to improve its application, which is of great significance. MYB transcription factors are widely present in many plants, and MYB proteins have been found to be involved in a variety of plant life processes, including primary metabolism, secondary metabolism, plant development, and responses to biotic and abiotic stresses. MYB proteins have been widely studied as regulators of phenylpropanoid metabolism in plants, such as the biosynthesis of proanthocyanidins, anthocyanidins, flavonols, and lignin. The transcription level of MYB4 transcription factors can significantly affect the synthesis of flavonoids in plants (Wang et al, Arabidopsis MYB4 plays dual roles in flavonoid biosynthesis. The Plant Journal, 2019, 101: 637-652). Summary of the invention

[0004] The present invention provides a gene related to the synthesis of flavonoid compounds - SiMYB4 gene. The SiMYB4 gene is regulated by overexpression technology to regulate the transcript level of SiMYB4 in snow lotus callus, and the effect of SiMYB4 on flavonoid compounds in snow lotus callus is identified, which has important reference value for resource utilization and directional molecular improvement of snow lotus and precious and endangered species.

[0005] In a first aspect, the present invention provides a SiMYB4 gene of Saussurea involucrata, wherein the Saussurea involucrata SiMYB4 gene is one of the following nucleotide sequences:

[0006] (1) having the nucleotide sequence shown in SEQ ID NO.1;

[0007] (2) A homologous sequence in which one or more bases are added, substituted, inserted or deleted from the nucleotide sequence shown in SEQ ID NO.1, or its alleles and nucleotide sequences derived therefrom.

[0008] In a second aspect, the present invention provides a protein encoded by the SiMYB4 gene, wherein the amino acid sequence of the protein is one of the following sequences:

[0009] (1) having the amino acid sequence shown in SEQ ID NO.2;

[0010] (2) A homologous protein sequence with one or more amino acids added, substituted, inserted or deleted from SEQ ID NO.2.

[0011] In a third aspect, the present invention provides a recombinant vector comprising the SiMYB4 gene.

[0012] In a fourth aspect, the present invention provides a recombinant bacterium, wherein the recombinant bacterium comprises the SiMYB4 gene or the recombinant vector described in 1.

[0013] In the present invention, the recombinant expression vector containing SiMYB4 gene can be constructed using existing plant expression vectors. The plant expression vectors include Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment, such as pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN or other derived plant expression vectors. The plant expression vector carrying the SiMYB4 gene of the present invention can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc.

[0014] When the SiMYB4 gene is used to construct a recombinant plant expression vector, any enhanced, constitutive, tissue-specific or inducible promoter can be added before the transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), etc., which can be used alone or in combination with other plant promoters; in addition, when the SiMYB4 gene of the present invention is used to construct a plant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene.

[0015] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can express enzymes or luminescent compounds that can produce color changes in plants (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.) or chemical resistance marker genes (such as herbicide resistance genes), etc.

[0016] In a fifth aspect, the present invention provides a primer pair for amplifying the full length or any fragment of the above-mentioned gene, the primer pair comprising:

[0017] The upstream primer has the nucleotide sequence: ATGGGAAGGTCTCCTTGTTG (SEQ ID NO. 3);

[0018] The nucleotide sequence of the downstream primer is: TTATTTCATCTCCAAGCCTC (SEQ ID NO. 4).

[0019] In a sixth aspect, the present invention provides the use of the SiMYB4 gene and the protein encoded by it, the recombinant vector or the recombinant bacteria in regulating the synthesis of saussurea flavonoid compounds.

[0020] In a seventh aspect, the present invention provides a method for regulating flavonoid compounds in snow lotus, comprising the steps of transferring the SiMYB4 gene into the snow lotus to increase the content of flavonoid compounds in the snow lotus.

[0021] The beneficial effects of the present invention compared with the prior art are as follows:

[0022] (1) The SiMYB4 gene obtained in the present invention is a key gene for regulating the synthesis of flavonoid compounds in Saussurea tianshanica, which has great value and production potential for obtaining an ideal Saussurea tianshanica engineering cell line with high flavonoid compounds through directed genetic improvement;

[0023] (2) Molecular regulation of SiMYB4 can improve the content of flavonoid compounds in Saussurea involucrata, which is of great significance for increasing the natural active ingredients of flavonoids in Saussurea involucrata and greatly broadens the application prospects of Saussurea involucrata cell lines;

[0024] (3) The genetically modified cell lines produced in the present invention can be integrated into the improvement and production projects of conventional natural active products of Chinese herbal medicines, thereby providing a new channel for the utilization of endangered and precious Chinese herbal medicine resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the gel electrophoresis image of PCR amplification of SiMYB4 gene coding sequence;

[0026] Figure 2 This is the map of the snow lotus pEarley100-GFP-SiMYB4 overexpression vector;

[0027] Figure 3 The fluorescence identification results of transgenic snow lotus callus overexpressing pEarley100-GFP-SiMYB4 ((A) Detailed picture of regenerated seedlings observed under blue excitation light; (B) Detailed picture of regenerated seedlings observed under natural light);

[0028] Figure 4 The qRT-PCR results of SiMYB4 gene in the transgenic snow lotus callus overexpressing pEarley100-GFP-SiMYB4 (Control represents pEarley100-GFP empty vector transgenic callus, SiMYB4_OE1 / 2 / 3 / 4 / 5 / 6 represent six independent positive overexpression transgenic cell lines respectively);

[0029] Figure 5 This is the PCA diagram for metabolome analysis of transgenic snow lotus callus with overexpression of pEarley100-GFP-SiMYB4 (Control represents pEarley100-GFP empty vector transgenic callus, SiMYB4_OE represents three independent positive overexpression transgenic cell lines);

[0030] Figure 6 KEGG classification diagram for metabolome analysis of transgenic snow lotus callus overexpressing pEarley100-GFP-SiMYB4 (Control VS SiMYB4_OE, Control represents pEarley100-GFP empty vector transgenic callus, SiMYB4_OE represents three independent positive overexpression transgenic cell lines). DETAILED DESCRIPTION

[0031] The technical solution of the present invention is described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] Example 1 Amplification of SiMYB4 sequence and construction of expression vector

[0033] According to NCBI ( https: / / www.ncbi.nlm.nih.gov / ) website, designed SiMYB-F and SiMYB-R primers according to the obtained SiMYB4 gene sequence information, and used the genomic cDNA library of Saussurea involucrata as a template to perform PCR amplification with the following primers.

[0034] The primer sequences are as follows:

[0035] SiMYB4-F:ATGGGAAGGTCTCCTTGTTG

[0036] SiMYB4-R:TTATTTCATCTCCAAGCCTC

[0037] The PCR reaction system for target fragment amplification was: 2 μL cDNA, 2.5 μL SiMYB4-F forward primer (10 μM), 2.5 μL SiMYB4-R reverse primer (10 μM), 25 μL PrimeSTAR Max Premix (2X) polymerase and 18 μL ddH 2 O. The PCR reaction conditions were: 98°C for 3 min; 98°C for 10 s, 55°C for 15 s; 72°C for 1 min, 35 cycles; 72°C for 10 min.

[0038] The PCR amplification product was subjected to agarose DNA gel electrophoresis and the size was about 930 bp ( Figure 1 ) fragments, and the obtained DNA amplified fragments were purified and recovered (Novozyme_ Gel DNA Extraction MiniKit gel recovery / DNA purification kit), and the recovered product was subjected to Sanger DNA sequencing (Beijing Qingke Biotechnology Co., Ltd. Qingdao Branch). The sequencing results show that the sequenced SiMYB sequence is shown in SEQ ID NO.1, the gene sequence is 930 bases in length, and the encoded amino acid residue sequence is shown in SEQ ID NO.2, and the amino acid residue sequence is 310 amino acid residues in length.

[0039] Example 2: Acquisition of SiMYB4 overexpression vector

[0040] Based on the sequence fragment of SEQ ID NO.1 obtained in Example 1 as a template, SiMYB4 was designed with a linker primer that seamlessly connects to the entry intermediate vector pGWC, and PCR amplification was performed using the following primers. PCR amplification was performed using the following primers.

[0041] The primer sequences are as follows:

[0042] SiMYB-pGWC-F:AAAGCAGGCTTTGACTTTATGGGAAGGTCT

[0043] SiMYB-pGWC-R:GCTGGGTCTAGAGACTTTTATTTCATCTCCA

[0044] The target fragment amplification PCR reaction system and reaction conditions refer to Example 1, using restriction endonuclease BanHI

[0045] The intermediate vector pGWC was digested with enzymes. The SiMYB4 gene fragment and the pENTR digested vector fragment were purified and recovered, and then the fragment and digested vector were seamlessly cloned (ClonExpress II One Step Cloning Kit). The directional cloning product was transformed into Escherichia coli DH5α. The positive monoclonal DNA was sequenced and verified to obtain the recombinant plasmid pGWC-SiMYB4. The successfully constructed recombinant vector pGWC-SiMYB4 was used LR ClonaseTM EnzymeⅡMix (ThermoScientific) was then cloned into the pEarley100-GFP vector through attL-attR recombination reaction. The reaction system was: 100 ng pGWC-SiMYB4 vector plasmid, 50 ng pEarley100-GFP vector plasmid, 1 μL LRClonaseTMEnzymeⅡMix, use ddH2O to make up to 10μL reaction system, react at 25℃ for 4-6h. The recombinant product was transformed into Escherichia coli DH5α. The positive monoclonal DNA was selected for verification by sequencing, and the recombinant plasmid pEarley100-GFP-SiMYB4( Figure 2 The successfully constructed recombinant vector pEarley100-GFP-SiMYB4 was transformed into Agrobacterium EHA105 and stored at -80°C for future use.

[0046] Example 3: Acquisition of SiMYB4 transgenic material

[0047] The Agrobacterium-mediated genetic transformation method of snow lotus suspension callus was used (Rapid suspension culture and genetic transformation method of snow lotus cells, 2023, CN 115786232 B). pEarley100-GFP-SiMYB4 was introduced into the snow lotus callus, and DNA was extracted after obtaining resistant callus. PCR detection was performed using pEarley100-GFP vector primers and SiMYB4-R primers of the SiMYB4 gene.

[0048] The primer sequences are as follows:

[0049] pEarley100-GFP-F:CACGAGGAGCATCGTGGAA

[0050] SiMYB4-R:TTATTTCATCTCCAAGCCTC

[0051] The PCR reaction system for target fragment amplification was: 2 μL DNA, 1 μL pEarley100-GFP-F forward primer (10 μM), 1 μL SiMYB-R reverse primer (10 μM), 25 μL PrimeSTAR Max Premix (2X) polymerase and 18 μL ddH2O. The PCR reaction conditions were: 95°C for 3 min; 94°C for 30 s, 56°C for 30 s; 72°C for 1 min, 30 cycles; 72°C for 5 min. After identification, the callus fluorescence state was observed under a fluorescent inverted microscope, and the positive transgenic lines were finally determined ( Figure 3 ).

[0052] Example 4: Molecular identification of SiMYB4 transgenic material

[0053] The positive callus obtained in Example 3 was selected, and the RNA of the positive callus was extracted using TransZol (TransGen Biotech). The positive callus was frozen and ground with liquid nitrogen until powder appeared, then transferred to a 1.5 mL centrifuge tube and 1 mL of TransZol was added, mixed with a vortexer, and oscillated at room temperature for 5 min. Then 200 μL of RNA Extraction Agent was added, oscillated vigorously for 15 s, and incubated at room temperature for 3 min. Centrifuged at 8°C 12000 rpm for 15 min. The upper colorless liquid was taken into a new centrifuge tube, 500 μL of isopropanol was added, mixed upside down, incubated at room temperature for 10 min to precipitate RNA, and centrifuged at 4°C 12000 rpm for 10 min. The liquid was discarded and the precipitate was retained, 1 ml of 75% ethanol (prepared with DEPC-treated water) was added, vortexed to wash away impurities, and centrifuged at 4°C 1000 rpm for 5 min. The liquid was discarded and the precipitate was dried at room temperature. The precipitate was dissolved in 50 μL of RNA dissolving solution, and the sample was stored in a -80°C refrigerator for standby use. The extracted RNA was reverse transcribed using One-Step gDNA Removal and cDNA Synthesis SuperMix (Quanshijin Biotechnology Co., Ltd.) was used to reverse and obtain cDNA products. The reverse transcription reaction steps refer to the instructions for the TransScript One-Step gDNA Removal and cDNA Synthesis Kit. The obtained cDNA products were used to perform real-time fluorescence quantitative PCR to detect the transcription abundance of the target gene using primers SiMYB4-qRT-F and SiMYB4-qRT-R. The internal reference gene used was the Saussurea GAPDH gene. The primer sequences are as follows:

[0054] SiMYB4-qRT-F:ACAATTTCAGGCCGTCGAGTATC

[0055] SiMYB4-qRT-R:AACTGCATTCCTTGCTGTTCGG

[0056] GAPDH-F:TAGCAAGGATGCTCCCCATGTTCGT

[0057] GAPDH-R:AAAGGAGCAAGGCAGTTGGTTGTG

[0058] The real-time quantitative PCR reaction system was: 2 μL cDNA, 1 μL SiMYB4-qRT-F forward primer (10 μM), 1 μL SiMYB4-qRT-R reverse primer (10 μM), 10 μL 2X SYBR Green Pro Taq HS Premix* (Hunan Aikerui Biotechnology Co., Ltd.), and 16 μL ddH2O. 480 real-time fluorescence quantitative PCR instrument (Roche) was used to detect the real-time fluorescence quantitative PCR reaction. The reaction conditions were as follows: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s, 60℃ annealing and extension for 30s, and 45 cycles. Melting curve determination: 65℃ to 95℃. The baseline and cycle threshold (Ct value) were automatically generated by the instrument software. The detection results showed that compared with the Control pEarley100-GFP empty vector transgenic callus, the expression levels of SiMYB4 in the overexpressing callus lines SiMYB4_OE1 / 2 / 3 / 4 / 5 / 6 were significantly increased.

[0059] Example 5: Identification of Metabolic Components of SiMYB4 Transgenic Material

[0060] SiMYB4 transgenic materials were quickly frozen in liquid nitrogen. After the samples were vacuum freeze-dried, 50 mg of the sample was weighed, 1000 μL of extraction solution (methanol: acetonitrile: water = 2:2:1) was added, and vortexed for 30 seconds. The mixed sample was added with steel beads 45

[0061] Hz grinding for 10 min, ultrasonic for 10 min, and stand at -20℃ for 1 h. After standing, centrifuge at 4℃ 12000rpm for 15 min, take 500μL of supernatant and vacuum dry in a centrifuge tube, add 160μL of reconstitution solution (acetonitrile-water volume ratio = 1:1) to the dried tube for reconstitution, and the reconstitution conditions are: vortex 30s, ice water bath ultrasonic for 10min. Finally, centrifuge the reconstituted material at 4℃ 12000rpm for 15min, take 120μL of supernatant in a 2mL injection bottle, and take 10μL of each sample for detection. Use the liquid chromatography-mass spectrometry system Acquity I-Class PLUS ultra-high performance liquid phase tandem AB Sciex Qtrap 6500+ high-sensitivity mass spectrometer (Waters). Use the database built by the testing agency for analysis of metabolic components (Beijing Biomarker Biotechnology Co., Ltd.), and use the Biomarker cloud platform ( http: / / www.biomarker.com.cn / biocloud ) were used for PCA (Principal Component Analysis). The PCA plot analysis results showed that there were significant differences between the metabolic components of Control and SiMYB4_OE ( Figure 5 ). The separation of differential products was analyzed using KEGG (Kyoto Encyclopedia of Genes and Genomes), showing that the SiMYB4_OE material accumulated a large amount of flavonoids in the biosynthesis of secondary metabolites ( Figure 6 ).

[0062] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. The SiMYB4 gene of Saussurea involucrata is characterized by: The snow lotus SiMYB4 gene is one of the following nucleotide sequences: (1) having the nucleotide sequence shown in SEQ ID NO.1; (2) A homologous sequence in which one or more bases are added, substituted, inserted or deleted from the nucleotide sequence shown in SEQ ID NO.1, or its alleles and nucleotide sequences derived therefrom.

2. The protein encoded by the SiMYB4 gene according to claim 1, characterized in that: The amino acid sequence of the protein is one of the following sequences: (1) having the amino acid sequence shown in SEQ ID NO.2; (2) A homologous protein sequence with one or more amino acids added, substituted, inserted or deleted from SEQ ID NO.

2.

3. A recombinant vector, characterized in that: The recombinant vector contains the SiMYB4 gene according to claim 1.

4. A recombinant bacterium, characterized in that: The recombinant bacteria comprises the SiMYB4 gene according to claim 1 or the recombinant vector according to claim 3.

5. A primer pair for amplifying the full length or any fragment of the gene according to claim 1, characterized in that: The primer pair comprises: The upstream primer has the nucleotide sequence: SEQ ID NO.3; The nucleotide sequence of the downstream primer is: SEQ ID NO.

4.

6. Use of the SiMYB4 gene and the protein encoded by it according to claim 1, the recombinant vector according to claim 3 or the recombinant bacteria according to claim 4 in regulating the synthesis of saussurea flavonoids.

7. A method for regulating saussurea flavonoids, characterized in that: The SiMYB4 gene described in claim 1 is transferred into the body of snow lotus to increase the content of flavonoid compounds in the snow lotus.

Images